Dataset for CDS BCL-2 of organism Oncorhynchus mykiss

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7Q7B4_BCL2-01      ---atggcaaacgataatccttataacagtcgctttattgttgaaaaata
A0A8C7RG50_BCL2-01      atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaata
                           *********** ************************** ********

A0A8C7Q7B4_BCL2-01      catacatcacaaactgttgaagaagggatttgtatgggaattttatccag
A0A8C7RG50_BCL2-01      catccatcacaaactgttgaaaatgggatttgtatggaaatttcaaggag
                        *** ***************** * ************* ***** *   **

A0A8C7Q7B4_BCL2-01      aaaacgattccccaaataatggttttggggagccctctccccctaactcc
A0A8C7RG50_BCL2-01      aaaacgattctccaaataatggctttggggacccctctacacccaactcc
                        ********** *********** ******** ****** * ** ******

A0A8C7Q7B4_BCL2-01      cccgaagtttttgcacggaggtcccaaccctccgccgaaggcgtggacac
A0A8C7RG50_BCL2-01      cccgaagtttttgcacggaggtcccagcccactgccgcgggagaggacac
                        ************************** *** * ****  ** * ******

A0A8C7Q7B4_BCL2-01      tgactctccgctccaaaacaggatcccgcaacctgaccgacatgcccggc
A0A8C7RG50_BCL2-01      cgactctccttaccaaaacaggagtccgcaacctgacccacatgccaggc
                         ********   ***********  ************* ******* ***

A0A8C7Q7B4_BCL2-01      tccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcag
A0A8C7RG50_BCL2-01      tccacagggtcctgcgcgatgcgggtggcgagattgaaagaatgtatcag
                        **** ***** ******** ***** * *********** **********

A0A8C7Q7B4_BCL2-01      cgggactttgcagagatgtcggggcagttgcattttacgcccagtacggc
A0A8C7RG50_BCL2-01      cgggactttgcagagatgtcggggcagttgcattttacacccagcacggc
                        ************************************** ***** *****

A0A8C7Q7B4_BCL2-01      acagagaaggtttactgctgttatagaggagctcttcagcgacggtataa
A0A8C7RG50_BCL2-01      acagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
                        *************** ***** ***** *****************  ***

A0A8C7Q7B4_BCL2-01      actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtg
A0A8C7RG50_BCL2-01      actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtg
                        **************************************************

A0A8C7Q7B4_BCL2-01      gagagcgtcaaccgggagatgacgtcccaggtagacaacattgcccattg
A0A8C7RG50_BCL2-01      gagagcgtcaaccgggagatgacgtcccaggtagacaacatcgctcgttg
                        ***************************************** ** * ***

A0A8C7Q7B4_BCL2-01      gatgacagagtacctgaacggacccctgcagaactggatccaggagaatg
A0A8C7RG50_BCL2-01      gatgacggagtacttgaacggacccctacagaactggatccaggagaatg
                        ****** ****** ************* **********************

A0A8C7Q7B4_BCL2-01      gtgactgggacgcctttgtggagatctatgggcagcagaggatctctgcc
A0A8C7RG50_BCL2-01      gtggctgggacgcctttgtggagatctatgagcagcagaggatctct---
                        *** ************************** ****************   

A0A8C7Q7B4_BCL2-01      ttccactcctggccctacctaaagacagtgttcggcctggccgccctggg
A0A8C7RG50_BCL2-01      ---cactcctggccgtacttaaagacagtgttcggcctggccgccctggg
                           *********** *** *******************************

A0A8C7Q7B4_BCL2-01      tgcagccggagtcaccattggagccttgttcatccagaagtga
A0A8C7RG50_BCL2-01      agccgccggagtcaccatcggagccttgttcacccagaagtga
                         ** ************** ************* **********

© 1998-2023Legal notice