Dataset for CDS BOK of Organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8VGS5_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
A0A3P8WH41_BOK-01      atggaggttctgcggaggtcttctgtgtttgcagcagaggtcctggatgt
                       ****** *  ****  * ** *********** ** **          **

A0A3P8VGS5_BOK-01      gttcgaccgctcgcccaccgacaaggagctggtgtcccaggcgaaagctc
A0A3P8WH41_BOK-01      gtttgaccgctcactgactgagaaggacctagtgtcccagtccaaagccc
                       *** ******** *  ** ** ***** ** ********* * ***** *

A0A3P8VGS5_BOK-01      tgtgccgagactacatcaactcaaggctgaatcgtgtcggtatgggctgg
A0A3P8WH41_BOK-01      tttgcagagactacattctgttcagactcaaccagaatgggctgggatgg
                       * *** **********    *  ** ** ** *     **  **** ***

A0A3P8VGS5_BOK-01      actagccctgaacacggactagcttcatcctcagggacaatgagagagat
A0A3P8WH41_BOK-01      tccaaatctgagctcaacctcgtgccctccaatgcagcactcgctgaagt
                        * *   **** * *   ** *   * ***   *   ** *    **  *

A0A3P8VGS5_BOK-01      ttcatcggttttgctgtggttaggcgatgagctggaatacctccgaccca
A0A3P8WH41_BOK-01      gtcttcagttcttctgtgcctcggcgacgagctggagtgtttacagccat
                        ** ** *** * *****  * ***** ******** *   * *  **  

A0A3P8VGS5_BOK-01      atgtttatcgtaacgtagcgcggcagctaaatatcactgttgcctcggag
A0A3P8WH41_BOK-01      ctttgtacaggaacgtggcacggcagctcagcatctctgttgccatggag
                        * * **  * ***** ** ******** *  *** ********  ****

A0A3P8VGS5_BOK-01      agtgtggtctctgacgccttcctggctgtggcggctgacattttctctac
A0A3P8WH41_BOK-01      aacatggtctccgatgcgttcattggtgtgtcaacagaaatctttgctac
                       *   ******* ** ** *** * * **** *  * ** ** **  ****

A0A3P8VGS5_BOK-01      aggtataacatggggaaaggtggtgtccttgtacgcagtggcgggggcct
A0A3P8WH41_BOK-01      aggtataacctggggtaaagttgtggccatgtatgctgtagctgcagccc
                       ********* ***** ** ** *** ** **** ** ** ** *  *** 

A0A3P8VGS5_BOK-01      tggcagtggattgtgttcgccatggtcatccttcaatcgtccataccatt
A0A3P8WH41_BOK-01      tggccgtggactgtgtcagacaagaccgggcggccaacgtcaacatcata
                       **** ***** *****  * ** *  *   *  * * **** * * *** 

A0A3P8VGS5_BOK-01      gtggactgcatgggagagtttgtccgcaagagtctgacctcctggttaaa
A0A3P8WH41_BOK-01      gtgcagagtctgggacagtttgtccgcaagttcctggtttcctggctgaa
                       *** *  *  ***** **************   ***   ****** * **

A0A3P8VGS5_BOK-01      aaaaagaggcggctggatggatgtcactaagtgtgtggtcaatactga--
A0A3P8WH41_BOK-01      gagacggggaggatggggtgatatcacgaaatgtgtggtaaagaaagatt
                        * * * ** ** ***   *** **** ** ******** ** *  **  

A0A3P8VGS5_BOK-01      ---ccccagattcagctctcactggtt------ggtgatggctgcct---
A0A3P8WH41_BOK-01      ttcccccagaacaga-----actggttaacctcggtcatggagtccctga
                          *******          *******      *** ****   **    

A0A3P8VGS5_BOK-01      -gtacctttggacattatgtgaagaccattgtgt---tgtacctgctcag
A0A3P8WH41_BOK-01      agtactttc-----tt--------accacagtgtacgtctacatcatgaa
                        **** **      **        ****  ****   * *** *  * * 

A0A3P8VGS5_BOK-01      ggagaagtga
A0A3P8WH41_BOK-01      agagccatga
                        ***   ***

© 1998-2023Legal notice