Dataset for CDS BCL-2-like of organism Varanus komodoensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D2Q8F9_BCL2A1-      atg-----------------------------------------------
A0A8D2L5P2_BCL2L1-      atgtcga-------------------------------------------
A0A8D2IVC0_MCL1-04      ---------------aact-------------------------------
A0A8D2IVC0_MCL1-01      acgggc-ctgagcggaactcg-----------------ccgc----gcgc
A0A8D2IVC0_MCL1-02      atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgc
A0A8D2IVC0_MCL1-03      atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgc
A0A8D2Q1J0_BCL2-02      atgatgg-------------------------------ct-------cat
A0A8D2Q1J0_BCL2-01      atgctgt-------------------------------tcgcagagatgt
A0A8D2Q1J0_BCL2-03      atgctgt-------------------------------tcgcagagatgt
                                                                          

A0A8D2Q8F9_BCL2A1-      -----------------------------------------gaaagctac
A0A8D2L5P2_BCL2L1-      ----------------------gcagaaacagggcgcttgtgacagactt
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      gccgccgccgccgccggggggagcgg--------gacgggacggg---cc
A0A8D2IVC0_MCL1-02      cccggcgtcgccgccggtgggggcggcgggcggcggcggggagggagccg
A0A8D2IVC0_MCL1-03      cccggcgtcgccgccggtgggggcggcgggcggcggcggggagggagccg
A0A8D2Q1J0_BCL2-02      cctgggataagagcttatgataatagggagattgtgctgagg------ta
A0A8D2Q1J0_BCL2-01      ccggg-----gcgctgctgctggcggcgg----ccgccgggg------tc
A0A8D2Q1J0_BCL2-03      ccggg-----gcgctgctgctggcggcgg----ccgccgggg------tc
                                                                          

A0A8D2Q8F9_BCL2A1-      gatttcctttatgtttacaatttgattcaggatcacttggaacatgtttg
A0A8D2L5P2_BCL2L1-      catttcctacaagctgtc--------------tcagcggggccacagctg
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      accctgcgc---gctcgc--------------gcgtccgcggccaatccg
A0A8D2IVC0_MCL1-02      gccccgcgctgagccggc--------------tccccgagggcc--tcgg
A0A8D2IVC0_MCL1-03      gccccgcgctgagccggc--------------tccccgagggcc--tcgg
A0A8D2Q1J0_BCL2-02      catccgttacaaactctc--------------acagaaaggatatgactg
A0A8D2Q1J0_BCL2-01      gccctcctcgtggccttc--------------ctgctgttgctgtatctg
A0A8D2Q1J0_BCL2-03      gccctcctcgtggccttc--------------ctgctgttgctgtatctg
                                                                          

A0A8D2Q8F9_BCL2A1-      ------------------cgcagaagtgcagctc----------------
A0A8D2L5P2_BCL2L1-      gaatgagatcgaaggcgacgagggaagcaggact----------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      -------------cgcgccggcgctgccaggct-----------------
A0A8D2IVC0_MCL1-02      -------------cgcgc--gcgcgggccggctccccnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      -------------cgcgc--gcgcgggccggctccccnnnnnnnnnnnnn
A0A8D2Q1J0_BCL2-02      --------------g-gtggctggtg--gagacc----------------
A0A8D2Q1J0_BCL2-01      --------------gtgtcgccggtgacaagccc----------------
A0A8D2Q1J0_BCL2-03      --------------gtgtcgccggtgacaagccc----------------
                                                                          

A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
                                                                          

A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      ------------------------gagctggccgacgagatggggggcgt
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      -------------------------------------ggcggccccgcg-
A0A8D2IVC0_MCL1-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgcggatcggcgg
A0A8D2IVC0_MCL1-03      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgcggatcggcgg
A0A8D2Q1J0_BCL2-02      ---------------------------------------cagaaaacctt
A0A8D2Q1J0_BCL2-01      ---------------------------------------caagccactgt
A0A8D2Q1J0_BCL2-03      ---------------------------------------caagccactgt
                                                                          

A0A8D2Q8F9_BCL2A1-      -----------------------------aaagaagctcc-----caatg
A0A8D2L5P2_BCL2L1-      cctcaacgggagcccctcttggcacaccggcagcagcccggtcgtcaatg
A0A8D2IVC0_MCL1-04      -----------tcctgt-tag-----------------------------
A0A8D2IVC0_MCL1-01      -ggggccctggccctgc-tcgggcccctggagggggcgccgcgcctgccg
A0A8D2IVC0_MCL1-02      aggggccctggccctgc-tcgggcccctggagggggcgccgcgcctgccg
A0A8D2IVC0_MCL1-03      aggggccctggccctgc-tcgggcccctggagggggcgccgcgcctgccg
A0A8D2Q1J0_BCL2-02      cctgctcctgctcctgc-tcctgctcctgctgggagcatccctgcccttg
A0A8D2Q1J0_BCL2-01      ccttgtccggcgcccacgtcgtggta--actggtggctccagtggcattg
A0A8D2Q1J0_BCL2-03      ccttgtccggcgcccacgtcgtggta--actggtggctccagtggcattg
                                                                          

A0A8D2Q8F9_BCL2A1-      aag-----------ctgcccaagtcttaagaaaaa----ttgcgccttca
A0A8D2L5P2_BCL2L1-      gggcgacggggcacctgaccatcctcgaagac-------ctggaagacgg
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      gagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgaggg
A0A8D2IVC0_MCL1-02      gagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgaggg
A0A8D2IVC0_MCL1-03      gagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgaggg
A0A8D2Q1J0_BCL2-02      ctgggctggcatccctgcc-----ttctgagctgcctgactctgctgc--
A0A8D2Q1J0_BCL2-01      --ggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacga
A0A8D2Q1J0_BCL2-03      --ggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacga
                                                                          

A0A8D2Q8F9_BCL2A1-      cttcagggagaagtggaagagaacctaag---------------------
A0A8D2L5P2_BCL2L1-      tccccgggagga-tgtgaggcagacgctc---------------------
A0A8D2IVC0_MCL1-04      ------ggacaaatgcaatttataagttg---------------------
A0A8D2IVC0_MCL1-01      cgagctggacggctgcgagccggacgccg---------------------
A0A8D2IVC0_MCL1-02      cgagctggacggctgcgagccggacgccg---------------------
A0A8D2IVC0_MCL1-03      cgagctggacggctgcgagccggacgccg---------------------
A0A8D2Q1J0_BCL2-02      ----tgtgaggaatgttgccc--ctgctg----------acgaact----
A0A8D2Q1J0_BCL2-01      taattgcaaggaatgagaaccgtctgatggaaacaaaaaaagaaattgag
A0A8D2Q1J0_BCL2-03      taattgcaaggaatgagaaccgtctgatggaaacaaaaaaagaaattgag
                                *    **                                   

A0A8D2Q8F9_BCL2A1-      -------------------------------accctattt----------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8D2IVC0_MCL1-04      agtttaagtggtggc-gtggcattgttctttt--------------ccat
A0A8D2IVC0_MCL1-01      ag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgc
A0A8D2IVC0_MCL1-02      ag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgc
A0A8D2IVC0_MCL1-03      ag----ggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgc
A0A8D2Q1J0_BCL2-02      acacccagtgccagcgcca--caggttgtccattcaactt----------
A0A8D2Q1J0_BCL2-01      aaattctctgttaatgataagcaggttgtacagtccatttctgtggatgt
A0A8D2Q1J0_BCL2-03      aaattctctgttaatgataagcaggttgtacagtccatttctgtggatgt
                                                                          

A0A8D2Q8F9_BCL2A1-      ----------------------------------ggactccctggagatc
A0A8D2L5P2_BCL2L1-      ----------------------------------agggaggctggcgacg
A0A8D2IVC0_MCL1-04      ggtatttctga----------------------aatgcaagtttaa----
A0A8D2IVC0_MCL1-01      gtcctcgcagg----------------------agggcgagcccgagccg
A0A8D2IVC0_MCL1-02      gtcctcgcagg----------------------agggcgagcccgagccg
A0A8D2IVC0_MCL1-03      gtcctcgcagg----------------------agggcgagcccgagccg
A0A8D2Q1J0_BCL2-02      --------------------------------tacgccaagctggagatg
A0A8D2Q1J0_BCL2-01      ttccaaggatggtacaaatgtggcaagggttctaaaacaggctcaagaga
A0A8D2Q1J0_BCL2-03      ttccaaggatggtacaaatgtggcaagggttctaaaacaggctcaagaga
                                                                          

A0A8D2Q8F9_BCL2A1-      agctccatcagtgatgctag------------------------------
A0A8D2L5P2_BCL2L1-      agttcgaactgcggtaccggc--gggctttcagcgacctcacct--ccca
A0A8D2IVC0_MCL1-04      ---------------------------------------tgcca------
A0A8D2IVC0_MCL1-01      gcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacga
A0A8D2IVC0_MCL1-02      gcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacga
A0A8D2IVC0_MCL1-03      gcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacga
A0A8D2Q1J0_BCL2-02      agttttcacggctttaccgg---agggattttgctcagatgtct-ggcca
A0A8D2Q1J0_BCL2-01      agttgggtccagttgacatgctcataaattgtgctggaacatca-gttaa
A0A8D2Q1J0_BCL2-03      agttgggtccagttgacatgctcataaattgtgctggaacatca-gttaa
                                                                          

A0A8D2Q8F9_BCL2A1-      -------------------------------cagaattttcagtcaagtg
A0A8D2L5P2_BCL2L1-      gctgcaca---tcacccccggcaccgcgtaccag-agcttcgagcaggtg
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      cctgcgcaaagtgacgctggaggtggtgggccggtacctgcgcgaggcgg
A0A8D2IVC0_MCL1-02      cctgcgcaaagtgacgctggaggtggtgggccggtacctgcgcgaggcgg
A0A8D2IVC0_MCL1-03      cctgcgcaaagtgacgctggaggtggtgggccggtacctgcgcgaggcgg
A0A8D2Q1J0_BCL2-02      gttgca------------cttgac-----tccagtcactgccagaagccg
A0A8D2Q1J0_BCL2-01      --tgcaaaatttgaagatcttgac-----atcagtaagtttgagcaactg
A0A8D2Q1J0_BCL2-03      --tgcaaaatttgaagatcttgac-----atcagtaagtttgagcaactg
                                                                          

A0A8D2Q8F9_BCL2A1-      ------------------atggaagaggaatt----------tgctgatg
A0A8D2L5P2_BCL2L1-      ------------------gtgaacgaactctt------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ----ccagccagggccccgcggagg------------------gcggcgg
A0A8D2IVC0_MCL1-02      ----ccagccagggccccgcggagg------------------gcggcgg
A0A8D2IVC0_MCL1-03      ----ccagccagggccccgcggagg------------------gcggcgg
A0A8D2Q1J0_BCL2-02      tttcgtggctg-----tggtggaagagctgtt------------------
A0A8D2Q1J0_BCL2-01      ----atggctatcaactacttggggagcatttacccaactcgtgcagtag
A0A8D2Q1J0_BCL2-03      ----atggctatcaactacttggggagcatttacccaactcgtgcagtag
                                                                          

A0A8D2Q8F9_BCL2A1-      gaaccacc-----------------------aactg--------------
A0A8D2L5P2_BCL2L1-      ------ccgcg------------acggggtgaactg--------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      cggcgccggcaagttcctgcaggggctggtgggccgcttcggggcccccc
A0A8D2IVC0_MCL1-02      cggcgccggcaagttcctgcaggggctggtgggccgcttcggggcccccc
A0A8D2IVC0_MCL1-03      cggcgccggcaagttcctgcaggggct-----------------------
A0A8D2Q1J0_BCL2-02      ------ccgtg------------atgggatcaattg--------------
A0A8D2Q1J0_BCL2-01      ttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcc
A0A8D2Q1J0_BCL2-03      ttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcc
                                                                          

A0A8D2Q8F9_BCL2A1-      ------gggacggattttgacaa---------------------------
A0A8D2L5P2_BCL2L1-      ------ggggcggattgtggcgt---------------------------
A0A8D2IVC0_MCL1-04      -------------------------------------------actccat
A0A8D2IVC0_MCL1-01      agggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccgc
A0A8D2IVC0_MCL1-02      agggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccgc
A0A8D2IVC0_MCL1-03      -------------------------------ggcgctggagacgctccgc
A0A8D2Q1J0_BCL2-02      ------gggcaggattgtagcgt--------------------------t
A0A8D2Q1J0_BCL2-01      caggctgggcagg-ttggagtat--------------------------t
A0A8D2Q1J0_BCL2-03      caggctgggcagg-ttggagtat--------------------------t
                                                                          

A0A8D2Q8F9_BCL2A1-      -------------------------------tattcctgtttggaggaat
A0A8D2L5P2_BCL2L1-      --------------------------------ttttctccttcggagggg
A0A8D2IVC0_MCL1-04      c--------------------------------ctttcccacccaggaat
A0A8D2IVC0_MCL1-01      cgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaat
A0A8D2IVC0_MCL1-02      cgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaat
A0A8D2IVC0_MCL1-03      cgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaat
A0A8D2Q1J0_BCL2-02      c--------------------------------tttg-aattcggtggca
A0A8D2Q1J0_BCL2-01      tggctacacagcttattctgcaacaa-----agtttgcacttcgaggact
A0A8D2Q1J0_BCL2-03      tggctacacagcttattctgcaacaa-----agtttgcacttcgaggact
                                                          *           *   

A0A8D2Q8F9_BCL2A1-      ccttgcaaa---------gaagctaaaacaacatggaattcctttgacag
A0A8D2L5P2_BCL2L1-      ccctgt--------gcgtggaga--------------------gtgtcga
A0A8D2IVC0_MCL1-04      gcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcag
A0A8D2IVC0_MCL1-01      gcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcag
A0A8D2IVC0_MCL1-02      gcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcag
A0A8D2IVC0_MCL1-03      gcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcag
A0A8D2Q1J0_BCL2-02      tgctga--------gcgtggaga--------------------gtgtcag
A0A8D2Q1J0_BCL2-01      agctgaagctttgcagatggaggtaaagccctacaatatctacataacag
A0A8D2Q1J0_BCL2-03      agctgaagctttgcagatggaggtaaagccctacaatatctacataacag
                           *                **                      *  *  

A0A8D2Q8F9_BCL2A1-      c------------aga----------------------------------
A0A8D2L5P2_BCL2L1-      caagg--------agat---------------------------------
A0A8D2IVC0_MCL1-04      -------------aaattgcctcacacgt---------------------
A0A8D2IVC0_MCL1-01      -------------aaattgcctcacacgt---------------------
A0A8D2IVC0_MCL1-02      -------------aaattgcctcacacgt---------------------
A0A8D2IVC0_MCL1-03      -------------aaattgcctcacacgt---------------------
A0A8D2Q1J0_BCL2-02      tcggg--------agat---gtcacccct---------------------
A0A8D2Q1J0_BCL2-01      ttgcgtatcctccagatacagacacccctggctatgcagaagaaaataag
A0A8D2Q1J0_BCL2-03      ttgcgtatcctccagatacagacacccctggctatgcagaagaaaataag
                                     * *                                  

A0A8D2Q8F9_BCL2A1-      -------------------------------------------------a
A0A8D2L5P2_BCL2L1-      --gagagtgttggtgg----------------------------------
A0A8D2IVC0_MCL1-04      -------tttcagtga------------------------cggtgtgaca
A0A8D2IVC0_MCL1-01      -------tttcagtga------------------------cggtgtgaca
A0A8D2IVC0_MCL1-02      -------tttcagtga------------------------cggtgtgaca
A0A8D2IVC0_MCL1-03      -------tttcagtga------------------------cggtgtgaca
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8D2Q1J0_BCL2-01      cataaggttttagagaccaagcttatttcagaagcatcatcaatctgcca
A0A8D2Q1J0_BCL2-03      cataaggttttagagaccaagcttatttcagaagcatcatcaatctgcca
                                                                          

A0A8D2Q8F9_BCL2A1-      aacacagagcagctttcttgttttattac---------------------
A0A8D2L5P2_BCL2L1-      -------gccggattgccagctggatggc---------------------
A0A8D2IVC0_MCL1-04      aactgggggcgaattgtgactctcatcgc---------------------
A0A8D2IVC0_MCL1-01      aactgggggcgaattgtgactctcatcgc---------------------
A0A8D2IVC0_MCL1-02      aactgggggcgaattgtgactctcatcgc---------------------
A0A8D2IVC0_MCL1-03      aactgggggcgaattgtgactctcatcgc---------------------
A0A8D2Q1J0_BCL2-02      ---------tg--tggacaatatcactgt--------------gtggatg
A0A8D2Q1J0_BCL2-01      acctgattatg--ttgctagaatcattgtaaaagatgcaattcaaggaaa
A0A8D2Q1J0_BCL2-03      acctgattatg--ttgctagaatcattgtaaaagatgcaattcaaggaaa
                                     *          *                         

A0A8D2Q8F9_BCL2A1-      ------agactatattgtaaa---------caccaaagctaagtggatca
A0A8D2L5P2_BCL2L1-      ------tacttacctgaccga--------gcacctggacccctggatcca
A0A8D2IVC0_MCL1-04      ctttggtgcctttgttgccaa--------gcatctgaagaatataaacca
A0A8D2IVC0_MCL1-01      ctttggtgcctttgttgccaa--------gcatctgaagaatataaacca
A0A8D2IVC0_MCL1-02      ctttggtgcctttgttgccaa--------gcatctgaagaatataaacca
A0A8D2IVC0_MCL1-03      ctttggtgcctttgttgccaa--------gcatctgaagaatataaacca
A0A8D2Q1J0_BCL2-02      actgagtacctgaacaggcac----------------------ctgcaca
A0A8D2Q1J0_BCL2-01      attcagcagttctattggtacggatggtcacatgttgacagtattgacca
A0A8D2Q1J0_BCL2-03      attcagcagttctattggtacggatggtcacatgttgacagtattgacca
                                  *                                     **

A0A8D2Q8F9_BCL2A1-      atgaaaa-------------------------------------tggagg
A0A8D2L5P2_BCL2L1-      agagaac--------------------------------------ggcgg
A0A8D2IVC0_MCL1-04      ggagagtggcatcagtactttgacagaaatcattacggacgtgctggtga
A0A8D2IVC0_MCL1-01      ggagagtggcatcagtactttgacagaaatcattacggacgtgctggtga
A0A8D2IVC0_MCL1-02      ggagagtggcatcagtactttgacagaaatcattacggacgtgctggtga
A0A8D2IVC0_MCL1-03      ggagagtggcatcagtactttgacagaaatcattacggacgtgctggtga
A0A8D2Q1J0_BCL2-02      actggat----------------------------ccaggacaatggagg
A0A8D2Q1J0_BCL2-01      gtgggatgtcaccagtttctt--------ctattgctgaagtcctagagg
A0A8D2Q1J0_BCL2-03      gtgggatgtcaccagtttctt--------ctattgctgaagtcctagagg
                                                                      * * 

A0A8D2Q8F9_BCL2A1-      atgggt----------------------------------aagatttctg
A0A8D2L5P2_BCL2L1-      ctgggagcggtttgtggatctctatgggaacgatg---------------
A0A8D2IVC0_MCL1-04      c--agataagcgggaatggctggtcaaccataatgcttgggaggggtttg
A0A8D2IVC0_MCL1-01      c--agataagcgggaatggctggtcaaccataatgcttgggaggggtttg
A0A8D2IVC0_MCL1-02      c--agataagcgggaatggctggtcaaccataatgcttgggaggggtttg
A0A8D2IVC0_MCL1-03      c--agataagcgggaatggctggtcaaccataatgcttgggaggggtttg
A0A8D2Q1J0_BCL2-02      ctgggatgcctttgtggagctgtacagcaacaacat----gaggcctttg
A0A8D2Q1J0_BCL2-01      c--ggatgcctttgtggagctgtacagcaacaacat----gaggcctttg
A0A8D2Q1J0_BCL2-03      c--ggttatttgcatgggtatttttcg------------------tttcg
                            *                                             

A0A8D2Q8F9_BCL2A1-      ctcagtt---tttca-----------------------------------
A0A8D2L5P2_BCL2L1-      ----------ccgccgcgaagagcaggaaa-gggcaggagcgcttcaaca
A0A8D2IVC0_MCL1-04      ttaaatt---cttccatgtagaggacatagaaggca-----gcatcagaa
A0A8D2IVC0_MCL1-01      ttaaatt---cttccatgtagaggacatagaaggca-----gcatcagaa
A0A8D2IVC0_MCL1-02      ttaaatt---cttccatgtagaggacatagaaggca-----gcatcagaa
A0A8D2IVC0_MCL1-03      ttaaatt---cttccatgtagaggacatagaaggca-----gcatcagaa
A0A8D2Q1J0_BCL2-02      tttgact---tttcc----------------tggct-----gcctctgaa
A0A8D2Q1J0_BCL2-01      tttgact---tttcc----------------tggct-----gcctctgaa
A0A8D2Q1J0_BCL2-03      ttagtctttatttta----------------tagca-----ggttttgac
                                                                          

A0A8D2Q8F9_BCL2A1-      -----ttactagttttcatcctcaatgccgcat------cggtttctgta
A0A8D2L5P2_BCL2L1-      ggtggctcttgacgggggccaccgtggccggcg--tgctcctcctcggct
A0A8D2IVC0_MCL1-04      acgttctgatgacttttgcaggcgttgctggattaggagcaagtttgg--
A0A8D2IVC0_MCL1-01      acgttctgatgacttttgcaggcgttgctggattaggagcaagtttgg--
A0A8D2IVC0_MCL1-02      acgttctgatgacttttgcaggcgttgctggattaggagcaagtttgg--
A0A8D2IVC0_MCL1-03      acgttctgatgacttttgcaggcgttgctggattaggagcaagtttgg--
A0A8D2Q1J0_BCL2-02      a-acaatcctgagcctggcggtcgtgggcgcgt--gcatcaccctcggtg
A0A8D2Q1J0_BCL2-01      a-acaatcctgagcctggcggtcgtgggcgcgt--gcatcaccctcggtg
A0A8D2Q1J0_BCL2-03      a-gca-----tagttcgtcgttgcatggtacaa--agagaaaagtctgaa
                                                  *                 *  *  

A0A8D2Q8F9_BCL2A1-      aaccttcagacc-----tga
A0A8D2L5P2_BCL2L1-      cgctgctgagccgcaagtag
A0A8D2IVC0_MCL1-04      catacatgatcc---ggtga
A0A8D2IVC0_MCL1-01      catacatgatcc---ggtga
A0A8D2IVC0_MCL1-02      catacatgatcc---ggtga
A0A8D2IVC0_MCL1-03      catacatgatcc---ggtga
A0A8D2Q1J0_BCL2-02      cttacctgggccacaagtga
A0A8D2Q1J0_BCL2-01      cttacctgggccacaagtga
A0A8D2Q1J0_BCL2-03      aagac--------tgactga
                                         *  

© 1998-2023Legal notice