Dataset for CDS BCL-2-like of organism Varanus komodoensis

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=972 residues).
acgggcctgagcggaactcgccgcgcgcgccgccgccgccgccggggggagcgggacgggacgggccaccctgcgcgctc
gcgcgtccgcggccaatccgcgcgccggcgctgccaggctggcggccccgcgggggccctggccctgctcgggcccctgg
agggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggac
ggctgcgagccggacgccgagggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggaggg
cgagcccgagccggcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgc
tggaggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctg
caggggctggtgggccgcttcggggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccg
ccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagagg
atgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctc
atcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcat
tacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatg
tagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatac
atgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1110 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggtgggccgcttcg
gggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccgccgggtgggcggcggcatcctc
gacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcaga
aattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcctttggtgcctttgttg
ccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacggacgtgctggtgacagat
aagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagaggacatagaaggcagcat
cagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1056 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggcgctggagacgc
tccgccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaa
gaggatgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgac
tctcatcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaa
tcattacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttc
catgtagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggc
atacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=486 residues).
aacttcctgttagggacaaatgcaatttataagttgagtttaagtggtggcgtggcattgttcttttccatggtatttct
gaaatgcaagtttaatgccaactccatcctttcccacccaggaatgcttaaaaagatggaaatcaagaaagaggatgacc
tgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcc
tttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacgga
cgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagagg
acatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatc
cggtga
>gnl|bcl2dbcds|A0A8D2L5P2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Varanus komodoensis GN=BCL2L1 (length=684 residues).
atgtcgagcagaaacagggcgcttgtgacagacttcatttcctacaagctgtctcagcggggccacagctggaatgagat
cgaaggcgacgagggaagcaggactgagctggccgacgagatggggggcgtcctcaacgggagcccctcttggcacaccg
gcagcagcccggtcgtcaatggggcgacggggcacctgaccatcctcgaagacctggaagacggtccccgggaggatgtg
aggcagacgctcagggaggctggcgacgagttcgaactgcggtaccggcgggctttcagcgacctcacctcccagctgca
catcacccccggcaccgcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggggtgaactgggggcgga
ttgtggcgtttttctccttcggaggggccctgtgcgtggagagtgtcgacaaggagatgagagtgttggtgggccggatt
gccagctggatggctacttacctgaccgagcacctggacccctggatccaagagaacggcggctgggagcggtttgtgga
tctctatgggaacgatgccgccgcgaagagcaggaaagggcaggagcgcttcaacaggtggctcttgacgggggccaccg
tggccggcgtgctcctcctcggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1050 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggatgcctttgtggagctgtacagcaacaacatgaggcctttgttt
gacttttcctggctgcctctgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctggg
ccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=711 residues).
atgatggctcatcctgggataagagcttatgataatagggagattgtgctgaggtacatccgttacaaactctcacagaa
aggatatgactgggtggctggtggagacccagaaaaccttcctgctcctgctcctgctcctgctcctgctgggagcatcc
ctgcccttgctgggctggcatccctgccttctgagctgcctgactctgctgctgtgaggaatgttgcccctgctgacgaa
ctacacccagtgccagcgccacaggttgtccattcaactttacgccaagctggagatgagttttcacggctttaccggag
ggattttgctcagatgtctggccagttgcacttgactccagtcactgccagaagccgtttcgtggctgtggtggaagagc
tgttccgtgatgggatcaattggggcaggattgtagcgttctttgaattcggtggcatgctgagcgtggagagtgtcagt
cgggagatgtcaccccttgtggacaatatcactgtgtggatgactgagtacctgaacaggcacctgcacaactggatcca
ggacaatggaggctgggatgcctttgtggagctgtacagcaacaacatgaggcctttgtttgacttttcctggctgcctc
tgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctgggccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1026 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggttatttgcatgggtatttttcgtttcgttagtctttattttata
gcaggttttgacagcatagttcgtcgttgcatggtacaaagagaaaagtctgaaaagactgactga
>gnl|bcl2dbcds|A0A8D2Q8F9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Varanus komodoensis GN=BCL2A1 (length=498 residues).
atggaaagctacgatttcctttatgtttacaatttgattcaggatcacttggaacatgtttgcgcagaagtgcagctcaa
agaagctcccaatgaagctgcccaagtcttaagaaaaattgcgccttcacttcagggagaagtggaagagaacctaagac
cctatttggactccctggagatcagctccatcagtgatgctagcagaattttcagtcaagtgatggaagaggaatttgct
gatggaaccaccaactggggacggattttgacaatattcctgtttggaggaatccttgcaaagaagctaaaacaacatgg
aattcctttgacagcagaaaacacagagcagctttcttgttttattacagactatattgtaaacaccaaagctaagtgga
tcaatgaaaatggaggatgggtaagatttctgctcagtttttcattactagttttcatcctcaatgccgcatcggtttct
gtaaaccttcagacctga
© 1998-2023Legal notice