Dataset for CDS BCL-2-like of organism Strigops habroptila

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672UHF9_BCL2A1-      atggaaactgctg------acttctactacgtttattacttagctcaaga
A0A672TR23_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A672UKR0_BCL2L1-      atg-----tccag-------------cagcaaccgggcgttagtgattga
A0A672UZL1_MCL1-01      atg-----ttcgc-------------gctcaagcggaacgcggtcatcgg
                        ***     * *                               *       

A0A672UHF9_BCL2A1-      ttatctgcagtatgt-------------------------gcttc-----
A0A672TR23_BCL2-01      gtacatccactataa-------------------------actctcac--
A0A672UKR0_BCL2L1-      ctttgtgtcctacaa-------------------------gctctcgc--
A0A672UZL1_MCL1-01      cctcaacctctactgcggcggcagccccgcgctggcccccgctcccgccg
                                  **                             **       

A0A672UHF9_BCL2A1-      -------aggagtcacatc-----------------ttggaccagctcaa
A0A672TR23_BCL2-01      -----agaggggatacgac-------------------------------
A0A672UKR0_BCL2L1-      -----agaagggccacagc-----------------tggagccagctgga
A0A672UZL1_MCL1-01      caccgggagggggcccggccccgccgccgccctccgcggcccccgcgggg
                               * * *   *  *                               

A0A672UHF9_BCL2A1-      a---------ccagagttgctcatgtcttgcgaaac--------------
A0A672TR23_BCL2-01      ---tgggctgccggggaggacagggcacccctg-----------------
A0A672UKR0_BCL2L1-      g-----------gaggaggatgaga----acaggactg------------
A0A672UZL1_MCL1-01      gcttgggccgccgggcgcgctgaggcgctgctgggctgcggcgcggcccc
                                          *           *                   

A0A672UHF9_BCL2A1-      ------------------------------------------------at
A0A672TR23_BCL2-01      ------cctccaggtctctctcctcctgctgctgctgctgctgctgcggt
A0A672UKR0_BCL2L1-      ---------------------------------------------ac-tt
A0A672UZL1_MCL1-01      gctgcccgccccggccccgctgcccgccccggcgcggccggtgccgc-tc

A0A672UHF9_BCL2A1-      tgcatct-----------------tcactgcaagatcaaacc--------
A0A672TR23_BCL2-01      tgctgct-------------------gctgc-------------------
A0A672UKR0_BCL2L1-      tgcagccgaggaggtggagatggacggcgtc-------------------
A0A672UZL1_MCL1-01      tggagcc-ccgaggaggagctggatggctgcgagcccgagcccgagcgcg
                        **   *                     *  *                   

A0A672UHF9_BCL2A1-      ------gaggaggctctcagaccattcctggacagg--------------
A0A672TR23_BCL2-01      ------tgggacttcctctgatcacactg-ggctggtgtctccgcacccc
A0A672UKR0_BCL2L1-      -ctcaacgggagcccctcctggcaccctcccgccagccacgtagtgaacg
A0A672UZL1_MCL1-01      gccccgcgggggactcgctgcccgcgccgccgcccgacgcgctgcgccag
                                **     * *    *   *     *  *              

A0A672UHF9_BCL2A1-      ------------------------------------attgacattacctc
A0A672TR23_BCL2-01      g-----------------agccccccggctcg----gctgctgctagcca
A0A672UKR0_BCL2L1-      g-----------------agccgccgtgcaccgga-gcagcctccaggtc
A0A672UZL1_MCL1-01      gcctcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggc

A0A672UHF9_BCL2A1-      tgtagctgtagccaaga---------------------------------
A0A672TR23_BCL2-01      tgcgcccctggccgaggggctgcgccctgcgccccaggtcgtccacctca
A0A672UKR0_BCL2L1-      cacgacatggttcaagcagcc---------gacgtgaggcaggc------
A0A672UZL1_MCL1-01      cgagcccggagccaagaagctgttcccggggctgctgggcgggcccggcc
                             *      * **                                  

A0A672UHF9_BCL2A1-      --------------------gaatt-------------------------
A0A672TR23_BCL2-01      ccctgcgccaggcaggggacgagtt-------------ctcccgccgcta
A0A672UKR0_BCL2L1-      -gctgagagaggcgggggatgagtt---------tgagctgaggtaccgg
A0A672UZL1_MCL1-01      ggcccggaggggcggcggatgcggtgatggggaaggcgctggagacgctg
                                            *   *                         

A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A672TR23_BCL2-01      ccagagg--gactttgcccaaatgtccggccagctgcacctgacgccctt
A0A672UKR0_BCL2L1-      cgggcgttcagcga---cctcacgtc---ccagctccacatcac------
A0A672UZL1_MCL1-01      cggagggtcggcgacggcgtcatggc---gaagcacgaactcgc------

A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A672TR23_BCL2-01      cacggccaggggccgc----------------------------------
A0A672UKR0_BCL2L1-      --c--cccggcaccgc----------------------------gtacca
A0A672UZL1_MCL1-01      --cttccagggaatgcttcggaagctggaaatccagaaggaggaggacct

A0A672UHF9_BCL2A1-      ----ttcaatggtgtcatgg--aagaaaaa-tttgctgatggaaatacta
A0A672TR23_BCL2-01      ----ttcgtggcggtggtgg--aggagctc-ttccgagacggggtt---a
A0A672UKR0_BCL2L1-      gagctttgagcaggtagtga--acgaactc-ttccgcgatggagtg---a
A0A672UZL1_MCL1-01      gcagtcggtgcgagaggtggctgcgcacttgttcagtgacggagtgacca
                            *        *   **     *      **    ** **       *

A0A672UHF9_BCL2A1-      actggggacgaattatgaccatatttacatttggaggtcttctcactaag
A0A672TR23_BCL2-01      actggggcaggatcgtggccttcttcgagttcggcggcgtcat-------
A0A672UKR0_BCL2L1-      actgggggcgcatcgtggctttcttctccttcggaggagcctt-------
A0A672UZL1_MCL1-01      actggggccgggtggtgacgctcatctccttc---ggggccttcgtcgcg
                        *******  *  *  ** *  *  *    **    **     *       

A0A672UHF9_BCL2A1-      aagctccaagagcatggagttcagctcactggagaggaaaa-------gg
A0A672TR23_BCL2-01      --gt-------gcgtggagagcgtcaaccgagagatgtctccccttgtag
A0A672UKR0_BCL2L1-      --gt-------gcgtggagagcgttgacaaggagatgcgggtattggtgg
A0A672UZL1_MCL1-01      aagc-------acctgaagagcatccagcaggagaagtgcat--------
                          *         * ** **  *         **** *             

A0A672UHF9_BCL2A1-      agcagatttcttatttcatcacagagtacataataaacaac--------a
A0A672TR23_BCL2-01      acagcatcgccgcctggatgaccgagtacctgaaccggcac--------c
A0A672UKR0_BCL2L1-      gacgcattgtatcttggatgaccacctacttgaccgaccacctagatccc
A0A672UZL1_MCL1-01      -cagctccctggcagggatcatcacggacgcgctcgtctcc-----tccc
                                         ** *      **           *         

A0A672UHF9_BCL2A1-      aagccgaatggatagatgcaaatggtggctgggaaaatggcttcctaatg
A0A672TR23_BCL2-01      tgcacaactggatccaggacaacggaggctggg---atgccttcgtggag
A0A672UKR0_BCL2L1-      --------tggatccaggagaatggcggatggg---agcgctttgtggac
A0A672UZL1_MCL1-01      ggcgcgagtggctgctgagccagggaggttggg---agggctttgtggac
                                *** *        * ** ** ****   *   ***  *    

A0A672UHF9_BCL2A1-      aagtttgaaag-------------------------------aagatcac
A0A672TR23_BCL2-01      ttgtatggcaacagtat-------------------------gaggcctt
A0A672UKR0_BCL2L1-      ctctatgggaacgatgctgctgccgaggtgaggaagggccaagagacctt
A0A672UZL1_MCL1-01      ttcttt-----------------cgagtcgagga----cctggaaggcag
                           * *                                     *   *  

A0A672UHF9_BCL2A1-      tactgtctttctccaaaattacagccatgttcatagctgttttcaccttg
A0A672TR23_BCL2-01      tgttcgatttctcctggatctcgctgaagactatcctgagtctggttctg
A0A672UKR0_BCL2L1-      caacaaatggctcctgaccggggc----gacggtggccggggtgctcctg
A0A672UZL1_MCL1-01      catcagaaacgtgctga------t----ggcgtttgcaggcgtggctgga
                                   * *              *    *        *       

A0A672UHF9_BCL2A1-      ttcagagagtact---------------------------attga
A0A672TR23_BCL2-01      gtgggagcttgcatcactcttggcgcttatcttggacataagtag
A0A672UKR0_BCL2L1-      ctgggatc-----------------cctgc-tgagccgcaagtga
A0A672UZL1_MCL1-01      ctgggagcgagctt---------ggcctacatgatccg---gtga
                         *  **                                    *  

© 1998-2021Legal notice