Dataset for CDS BCL-2-like of organism Strigops habroptila

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A672TR23_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Strigops habroptila GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcacagagggg
atacgactgggctgccggggaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgctgctgcgg
ttgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccatgcgcccctggccgaggggctgcgccctgcgccccaggtcgtccacctcaccctgcgccaggcaggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagttcggcggcgtcatg
tgcgtggagagcgtcaaccgagagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcg
atttctcctggatctcgctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A672UHF9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Strigops habroptila GN=BCL2A1 (length=525 residues).
atggaaactgctgacttctactacgtttattacttagctcaagattatctgcagtatgtgcttcaggagtcacatcttgg
accagctcaaaccagagttgctcatgtcttgcgaaacattgcatcttcactgcaagatcaaaccgaggaggctctcagac
cattcctggacaggattgacattacctctgtagctgtagccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcactaagaagctccaagagcatgg
agttcagctcactggagaggaaaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcaaatggtggctgggaaaatggcttcctaatgaagtttgaaagaagatcactactgtctttctccaaaattaca
gccatgttcatagctgttttcaccttgttcagagagtactattga
>gnl|bcl2dbcds|A0A672UKR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Strigops habroptila GN=BCL2L1 (length=693 residues).
atgtccagcagcaaccgggcgttagtgattgactttgtgtcctacaagctctcgcagaagggccacagctggagccagct
ggaggaggaggatgagaacaggactgactttgcagccgaggaggtggagatggacggcgtcctcaacgggagcccctcct
ggcaccctcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctccaggtccacgacatggttcaagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacgtc
ccagctccacatcacccccggcaccgcgtaccagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
gggggcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccacctacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgaggaagggccaagagaccttcaacaaatggctcctgaccg
gggcgacggtggccggggtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A672UZL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Strigops habroptila GN=MCL-1 (length=894 residues).
atgttcgcgctcaagcggaacgcggtcatcggcctcaacctctactgcggcggcagccccgcgctggcccccgctcccgc
cgcaccgggagggggcccggccccgccgccgccctccgcggcccccgcgggggcttgggccgccgggcgcgctgaggcgc
tgctgggctgcggcgcggccccgctgcccgccccggccccgctgcccgccccggcgcggccggtgccgctctggagcccc
gaggaggagctggatggctgcgagcccgagcccgagcgcggccccgcgggggactcgctgcccgcgccgccgcccgacgc
gctgcgccaggcctcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggccgagcccggagccaagaagc
tgttcccggggctgctgggcgggcccggccggcccggaggggcggcggatgcggtgatggggaaggcgctggagacgctg
cggagggtcggcgacggcgtcatggcgaagcacgaactcgccttccagggaatgcttcggaagctggaaatccagaagga
ggaggacctgcagtcggtgcgagaggtggctgcgcacttgttcagtgacggagtgaccaactggggccgggtggtgacgc
tcatctccttcggggccttcgtcgcgaagcacctgaagagcatccagcaggagaagtgcatcagctccctggcagggatc
atcacggacgcgctcgtctcctcccggcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcg
agtcgaggacctggaaggcagcatcagaaacgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcct
acatgatccggtga
© 1998-2020Legal notice