Dataset for CDS BCL-2-like of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F9CXI7_BCL2A1-      atg-----------------------------------------------
A0A5F9CXI7_BCL2A1-      atg-----------------------------------------------
A0A5F9CXI7_BCL2A1-      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
A0A5F9CXI7_BCL2A1-      atgttcgcctcccagggcttcggaagcttccagaagaagcagtcaccggc
G1T2Q0_MCL1-01          atggcgatgtttagcctgagaagaaacg------------cggtaatcgg
G1T2Q0_MCL1-02          ------atgtttagcctgagaagaaacg------------cggtaatcgg
Q9MYW4_BCL2L1-01        atgtct------------------cagagcaaccgggagctggtggttga
G1T264_BCL2L10-01       atggcagacgctttg-gaggagcgcactgcgcgcctgct-----------
G1TV33_BCL2L2-01        atggcg-accccagcct--cagccccagacacacgggctctggtggccga
A0A5F9CRQ4_BCL2-01      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
A0A5F9CRQ4_BCL2-02      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------gcggcggcgg--------------
A0A5F9CXI7_BCL2A1-      --------------------------gcggcggcgg--------------
A0A5F9CXI7_BCL2A1-      tctgctctccgagcagcagaagatgagtgactgcgagtt-----------
A0A5F9CXI7_BCL2A1-      tctgctctccgagcagcagaagatgagtgactgcgagtt-----------
G1T2Q0_MCL1-01          actcaacctctac---------ttgggggggcccgggtt-----------
G1T2Q0_MCL1-02          actcaacctctac---------ttgggggggcccgggtt-----------
Q9MYW4_BCL2L1-01        ctttctctcctacaagctttcgcagaaaggatacagctggagtcagttta
G1T264_BCL2L10-01       ---caccgactac---------ctggagtgctgcgcccg-----------
G1TV33_BCL2L2-01        ctttgtaggctacaagctgaggcagaagggttatgtctg-----------
A0A5F9CRQ4_BCL2-01      gtacatccactataagctgtcccagaggggctacgagtg-----------
A0A5F9CRQ4_BCL2-02      gtacatccactataagctgtcccagaggggctacgagtg-----------
                                                                          

A0A5F9CXI7_BCL2A1-      ----------------cggctgtgagc-----------------------
A0A5F9CXI7_BCL2A1-      ----------------cggctgtgagc-----------------------
A0A5F9CXI7_BCL2A1-      ----------------tggctatgtgcacacactggctcaggactatctg
A0A5F9CXI7_BCL2A1-      ----------------tggctatgtgcacacactggctcaggactatctg
G1T2Q0_MCL1-01          ----------------gggagccggtggcggcggcgtcgcccctccggca
G1T2Q0_MCL1-02          ----------------gggagccggtggcggcggcgtcgcccctccggca
Q9MYW4_BCL2L1-01        gtgatgtggaagagaacaggactgaggccccggaagggactggaccagag
G1T264_BCL2L10-01       ----------------cgagcccgg-------------------------
G1TV33_BCL2L2-01        ----------------tggggctgg-------------------------
A0A5F9CRQ4_BCL2-01      ----------------ggacgctggggacgcgggcgccgcctccgcgccg
A0A5F9CRQ4_BCL2-02      ----------------ggacgctggggacgcgggcgccgcctccgcgccg
                                               *                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ctgtacatc-----------------------------------------
A0A5F9CXI7_BCL2A1-      ctgtacatc-----------------------------------------
G1T2Q0_MCL1-01          gagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagg
G1T2Q0_MCL1-02          gagcggctttt---------------------------------------
Q9MYW4_BCL2L1-01        atggagacccccagtgccatcaatggcaacccagcctgg-----------
G1T264_BCL2L10-01       -------------------------------cacccctg-----------
G1TV33_BCL2L2-01        ----------------------------------ccctg-----------
A0A5F9CRQ4_BCL2-01      ggcgtcttctcctcccagcccgcgcccgctgcgccccgg-----------
A0A5F9CRQ4_BCL2-02      ggcgtcttctcctcccagcccgcgcccgctgcgccccgg-----------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          gggaggggaggccggcgcggtgattggcggaagcccgggcgctagccccc
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        -------------------------------cacccggcggacagccccg
G1T264_BCL2L10-01       -------------------------------ag----------------c
G1TV33_BCL2L2-01        -------------------------------ga-----------------
A0A5F9CRQ4_BCL2-01      -------------------------------gacccggccgccaggacct
A0A5F9CRQ4_BCL2-02      -------------------------------gacccggccgccaggacct
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          cggccgcgctggcgccggacgcccggagggtcgcgcggccggcgcccatt
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        cggtgaacgg----------------------------------------
G1T264_BCL2L10-01       c-------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      c-------------------------------------------------
A0A5F9CRQ4_BCL2-02      c-------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          ggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtactt
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          ggcgcccacccgccgcgcgtcgccgctcgaggagatggaagccccggctg
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          cggacgccatcatgtcgcccgaagaggagctggacggctacgagccggag
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          ccccttgcgaagcggccggccgtcctgcccctgctggacttggtggggga
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          ggccagtaaggtccctagcacggacgggtcgctgccctcgacgccgccgc
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          ccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatc
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      ------------------------------ggcgcca-agcggagcctgc
A0A5F9CXI7_BCL2A1-      ------------------------------ggcgcca-agcggagcctgc
A0A5F9CXI7_BCL2A1-      -------------------------ctgaagacgccacagcctggactg-
A0A5F9CXI7_BCL2A1-      -------------------------ctgaagacgccacagcctggactg-
G1T2Q0_MCL1-01          gcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgat
G1T2Q0_MCL1-02          --------------------ggcgaccggcgccaaggacgcgaagccgat
Q9MYW4_BCL2L1-01        --------------------agccactggccacagca----gcagtttgg
G1T264_BCL2L10-01       ---------------------gcagccgtccacgccg----gaggcggct
G1TV33_BCL2L2-01        -----------------------------------------------gag
A0A5F9CRQ4_BCL2-01      ---------------------gccgccgccgccgccg----gccgccgcg
A0A5F9CRQ4_BCL2-02      ---------------------gccgccgccgccgccg----gccgccgcg
                                                                          

A0A5F9CXI7_BCL2A1-      gggccgagctgaa---gcagcgt-ctgc-------gggccatcagcgc--
A0A5F9CXI7_BCL2A1-      gggccgagctgaa---gcagcgt-ctgc-------gggccatcagcgc--
A0A5F9CXI7_BCL2A1-      ggaccgagcaaaacgtccagggtgctgc-------agaacgtcaccttct
A0A5F9CXI7_BCL2A1-      ggaccgagcaaaacgtccagggtgctgc-------agaacgtcaccttct
G1T2Q0_MCL1-01          gggccg--------ggccggcagcgcgagccggaaggcgctcgagaccct
G1T2Q0_MCL1-02          gggccg--------ggccggcagcgcgagccggaaggcgctcgagaccct
Q9MYW4_BCL2L1-01        atgccc----gggaggtgatccccatgacagcagtga---agcaggctct
G1T264_BCL2L10-01       gtgctgcgctgtgcggcca---cgcagcttcagcgggtccactggccctt
G1TV33_BCL2L2-01        ggcccg------gcagctaacccgctg------------caccaagccat
A0A5F9CRQ4_BCL2-01      gggccc------gcgctcagcccggtgccacctgtggtccacctgaccct
A0A5F9CRQ4_BCL2-02      gggccc------gcgctcagcccggtgccacctgtggtccacctgaccct
                           *                      *                       

A0A5F9CXI7_BCL2A1-      --------cgaggagcg---------------------------actgcg
A0A5F9CXI7_BCL2A1-      --------cgaggagcg---------------------------actgcg
A0A5F9CXI7_BCL2A1-      ccatccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtg
A0A5F9CXI7_BCL2A1-      ccatccagcaagaagtggaagaggctctgcaaccgtacctgcacaatgtg
G1T2Q0_MCL1-01          gcggcgggtcggggacg---------------------------gtgtgc
G1T2Q0_MCL1-02          gcggcgggtcggggacg---------------------------gtgtgc
Q9MYW4_BCL2L1-01        gagggaggcaggcgacg---------------------------agtttg
G1T264_BCL2L10-01       cttctccg---------------------------------------tct
G1TV33_BCL2L2-01        gcgggcagccggagatg---------------------------agttcg
A0A5F9CRQ4_BCL2-01      ccgccaggcgggcgacg---------------------------acttct
A0A5F9CRQ4_BCL2-02      ccgccaggcgggcgacg---------------------------acttct
                                                                          

A0A5F9CXI7_BCL2A1-      ccagtcccgcc---------------------------------------
A0A5F9CXI7_BCL2A1-      ccagtcccgcc---------------------------------------
A0A5F9CXI7_BCL2A1-      cctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatgga
A0A5F9CXI7_BCL2A1-      cctgtcgcgtccgtcgagactgccaggacaattttcaaccaagtgatgga
G1T2Q0_MCL1-01          agcgcaaccacgagacggccttccaagg----------------------
G1T2Q0_MCL1-02          agcgcaaccacgagacggccttccaagg----------------------
Q9MYW4_BCL2L1-01        aactgcggtaccggcgggcattcagcga----------------------
G1T264_BCL2L10-01       accgcggctaccccggcaaccgcatcga----------------------
G1TV33_BCL2L2-01        agacccgcttccggcaaaacttctccga----------------------
A0A5F9CRQ4_BCL2-01      cccggcgctaccgccgcgacttcgcgga----------------------
A0A5F9CRQ4_BCL2-02      cccggcgctaccgccgcgacttcgcgga----------------------
                                  *                                       

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gaaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatat
A0A5F9CXI7_BCL2A1-      gaaagagtttgaggatggtgtgatcaactggggcaggattgtgaccatat
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      ---------------tactgacccagaa----------------------
A0A5F9CXI7_BCL2A1-      ---------------tactgacccagaa----------------------
A0A5F9CXI7_BCL2A1-      ttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgtt
A0A5F9CXI7_BCL2A1-      ttgcattcgaaggggtcctggccaagaagctcctccaggagcaggctgtt
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ccggatgtggacacgttcaagtccatcccttattttgtggctgagttcat
A0A5F9CXI7_BCL2A1-      ccggatgtggacacgttcaagtccatcccttattttgtggctgagttcat
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
                                                                          

A0A5F9CXI7_BCL2A1-      ------------------------------------------ggtgattg
A0A5F9CXI7_BCL2A1-      ------------------------------------------ggtgattg
A0A5F9CXI7_BCL2A1-      aacgaggaggatgggagaatggataaggcaaaacggaggctgggtgattg
A0A5F9CXI7_BCL2A1-      aacgaggaggatgggagaatggataaggcaaaacggaggctgggtgattg
G1T2Q0_MCL1-01          ------------------------------------------aatgcttc
G1T2Q0_MCL1-02          ------------------------------------------aatgcttc
Q9MYW4_BCL2L1-01        ------------------------------------------cctgacat
G1T264_BCL2L10-01       ------------------------------------------gctggc--
G1TV33_BCL2L2-01        ------------------------------------------cctggccg
A0A5F9CRQ4_BCL2-01      ------------------------------------------gatgtcca
A0A5F9CRQ4_BCL2-02      ------------------------------------------gatgtcca
                                                                    **    

A0A5F9CXI7_BCL2A1-      cccaccggca-gtatcagaaatcccagagaatctccatcttcctgagcat
A0A5F9CXI7_BCL2A1-      cccaccggca-gtatcagaaatcccagagaatctccatcttcctgagcat
A0A5F9CXI7_BCL2A1-      cccaccggca-gtatcagaaatcccagagaatctccatcttcctgagcat
A0A5F9CXI7_BCL2A1-      cccaccggca-gtatcagaaatcccagagaatctccatcttcctgagcat
G1T2Q0_MCL1-01          ggaaactggacatcaaaaacgaagacg-atgtcaaatctttgtctcgagt
G1T2Q0_MCL1-02          ggaaactggacatcaaaaacgaagacg-atgtcaaatctttgtctcgagt
Q9MYW4_BCL2L1-01        cccagctccacatcaccccagggacagcatatcagagctttgaacaa-gt
G1T264_BCL2L10-01       ----ggcgcgcgtggcg-----------gaggccgtgctctccgacg-gc
G1TV33_BCL2L2-01        ctcagttgcatgtgaccccaggctcagcacagcagagcttcacccag-gt
A0A5F9CRQ4_BCL2-01      gccagctgcacctgacgccctttcacgcgagggggcgctttgccacg-gt
A0A5F9CRQ4_BCL2-02      gccagctgcacctgacgccctttcacgcgagggggcgctttgccacg-gt
                                    *                                     

A0A5F9CXI7_BCL2A1-      gccggatgaaatcgagacagaagagat---catcaaggatatcttccagc
A0A5F9CXI7_BCL2A1-      gccggatgaaatcgagacagaagagat---catcaaggatatcttccagc
A0A5F9CXI7_BCL2A1-      gccggatgaaatcgagacagaagagat---catcaaggatatcttccagc
A0A5F9CXI7_BCL2A1-      gccggatgaaatcgagacagaagagat---catcaaggatatcttccagc
G1T2Q0_MCL1-01          gatggtccatgttttcagtgatggcgtaacaaactggg----------gc
G1T2Q0_MCL1-02          gatggtccatgttttcagtgatggcgtaacaaactggg----------gc
Q9MYW4_BCL2L1-01        agtgaacgaactcttccgggatggggt---gaactggg----------gc
G1T264_BCL2L10-01       c-------------------acgacct---cagctggg----------gc
G1TV33_BCL2L2-01        ctgcgatgaacttttccaaaggggtcc---caactggg----------gc
A0A5F9CRQ4_BCL2-01      ggtggaggagctcttcagggatggggt---gaactggg----------gg
A0A5F9CRQ4_BCL2-02      ggtggaggagctcttcagggatggggt---gaactggg----------gg
                                              *        * *  **          * 

A0A5F9CXI7_BCL2A1-      aaggcaaagtctgctttatcccccgcta-----ccggt------------
A0A5F9CXI7_BCL2A1-      aaggcaaagtctgctttatcccccgcta-----ccggt------------
A0A5F9CXI7_BCL2A1-      aaggcaaagtctgctttatcccccgcta-----ccggt------------
A0A5F9CXI7_BCL2A1-      aaggcaaagtctgctttatcccccgcta-----ccggt------------
G1T2Q0_MCL1-01          aggattgtgactctgatttctttcggtg-----cctttgtggccaaacac
G1T2Q0_MCL1-02          aggattgtgactctgatttctttcggtg-----cctttgtggccaaacac
Q9MYW4_BCL2L1-01        cgcattgtggcctttttctccttcggcggggc-actgtgcg---------
G1T264_BCL2L10-01       cgcgtggtgacgctcgtgaccttcgccgggacgcttctgga---------
G1TV33_BCL2L2-01        cgcgtggtggccttctttgcctttggggccgc-actgtgtg---------
A0A5F9CRQ4_BCL2-01      aggattgtggccttctttgagttcggtggggt-catgtgtg---------
A0A5F9CRQ4_BCL2-02      aggattgtggccttctttgagttcggtggggt-catgtgtg---------
                                * *     *       *            *            

A0A5F9CXI7_BCL2A1-      -tgcagagc--------aatcacatggata--tg-------gtgaaatta
A0A5F9CXI7_BCL2A1-      -tgcagagc--------aatcacatggata--tg-------gtgaaatta
A0A5F9CXI7_BCL2A1-      -tgcagagc--------aatcacatggata--tg-------gtgaaatta
A0A5F9CXI7_BCL2A1-      -tgcagagc--------aatcacatggata--tg-------gtgaaatta
G1T2Q0_MCL1-01          ttgaagagc--------ataaaccaagaaagctg---------catagaa
G1T2Q0_MCL1-02          ttgaagagc--------ataaaccaagaaagctg---------catagaa
Q9MYW4_BCL2L1-01        -tggaaagc--------gtggacaaggaga--tg-------------gag
G1T264_BCL2L10-01       -cagagggccgccggtgaccacccagcggg--tgaggaggaatgaaatcg
G1TV33_BCL2L2-01        -ctgagagc--------gtcaacaaggaga--tg-------------gag
A0A5F9CRQ4_BCL2-01      -tggagagc--------gtcaaccgggaga--tg-------------tcg
A0A5F9CRQ4_BCL2-02      -tggagagc--------gtcaaccgggaga--tg-------------tcg
                            *  **             *         **                

A0A5F9CXI7_BCL2A1-      gcgtcagcagacgaaatttcttcactt------cctaaaacctcctggaa
A0A5F9CXI7_BCL2A1-      gcgtcagcagacgaaatttcttcactt------cctaaaacctcctggaa
A0A5F9CXI7_BCL2A1-      gcgtcagcagacgaaatttcttcactt------cctaaaacctcctggaa
A0A5F9CXI7_BCL2A1-      gcgtcagcagacgaaatttcttcactt------cctaaaacctcctggaa
G1T2Q0_MCL1-01          cctttagcggaaagta-------tcacagatgtt-------ctcgtcagg
G1T2Q0_MCL1-02          cctttagcggaaagta-------tcacagatgtt-------ctcgtcagg
Q9MYW4_BCL2L1-01        gtattggtgagtcgga--tcgcggcgtggatggccacttacctgaatgac
G1T264_BCL2L10-01       cccgggactgccagcgcttggtggccttgctgtgcgctcgcctcgcaggg
G1TV33_BCL2L2-01        cccctggtgggacaag--tgcaggagtggatggtgacctacctggagacg
A0A5F9CRQ4_BCL2-01      cccctggtggacaaca--tcgccctgtggatgactgagtacctgaaccgg
A0A5F9CRQ4_BCL2-02      cccctggtggacaaca--tcgccctgtggatgactgagtacctgaaccgg
                                                                 **       

A0A5F9CXI7_BCL2A1-      cattcatcagccgagtgagagtgacacgcggg------------------
A0A5F9CXI7_BCL2A1-      cattcatcagccgagtgagagtgacacgcggg------------------
A0A5F9CXI7_BCL2A1-      cattcatcagccgagtgagagtgacacgcggg------------------
A0A5F9CXI7_BCL2A1-      cattcatcagccgagtgagagtgacacgcggg------------------
G1T2Q0_MCL1-01          acgaaacgggactggctagtcaaacaaagaggct----------------
G1T2Q0_MCL1-02          acgaaacgggactggctagtcaaacaaagaggct----------------
Q9MYW4_BCL2L1-01        cacctggagccctggatccaggagaacggcggct----------------
G1T264_BCL2L10-01       cagcaccgcgcctggctgcaggctcaaggcggct----------------
G1TV33_BCL2L2-01        cagctggccggctggatccacagcaccgggggct----------------
A0A5F9CRQ4_BCL2-01      cacctgcacacctggatccaggataatggaggct----------------
A0A5F9CRQ4_BCL2-02      cacctgcacacctggatccaggataatggaggctgggcagacaaaagccc
                                   *  *               **                  

A0A5F9CXI7_BCL2A1-      ---------aggaggccttgg-----------------------------
A0A5F9CXI7_BCL2A1-      ---------aggaggccttgg-----------------------------
A0A5F9CXI7_BCL2A1-      ---------aggaggccttgg-----------------------------
A0A5F9CXI7_BCL2A1-      ---------aggaggccttgg-----------------------------
G1T2Q0_MCL1-01          ---------gggatgggtttg-----------------------------
G1T2Q0_MCL1-02          ---------gggatgggtttg-----------------------------
Q9MYW4_BCL2L1-01        ---------gggacacgtttg-----------------------------
G1T264_BCL2L10-01       ---------gggatggcttt------------------------------
G1TV33_BCL2L2-01        ---------gggcggagttca-----------------------------
A0A5F9CRQ4_BCL2-01      ---------gggatgccttcg-----------------------------
A0A5F9CRQ4_BCL2-02      ttggatctcggggtgtctttgtacttctcggagagccaccccaggagcac
                                  **     **                               

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      attccctgacggagggctcagccacctcttccgcctcattatactctgct
                                                                          

A0A5F9CXI7_BCL2A1-      ----------------------------------------------ccac
A0A5F9CXI7_BCL2A1-      ----------------------------------------------ccac
A0A5F9CXI7_BCL2A1-      ----------------------------------------------ccac
A0A5F9CXI7_BCL2A1-      ----------------------------------------------ccac
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      ------------------------------tggaa---------------
A0A5F9CRQ4_BCL2-02      cagcaccgagaagcctggcatggtttctgctggaatgaaaagattggcag
                                                                          

A0A5F9CXI7_BCL2A1-      cgggggcctcgacctcatcttca---------------------------
A0A5F9CXI7_BCL2A1-      cgggggcctcgacctcatcttca---------------------------
A0A5F9CXI7_BCL2A1-      cgatg--------caca----ca---------------------------
A0A5F9CXI7_BCL2A1-      cgggggcctcgacctcatcttca---------------------------
G1T2Q0_MCL1-01          --tggagttcttcca-----------------------------------
G1T2Q0_MCL1-02          --tggagttcttcca-----------------------------------
Q9MYW4_BCL2L1-01        --tggaactctacggcaacaa-----------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --cagctctgtacgg-------ggatcgggccctggaggagg--------
A0A5F9CRQ4_BCL2-01      -------ctgtacggccccagcg---------------------------
A0A5F9CRQ4_BCL2-02      agctgccctagacaacagcaccgcaaaacactgtggcagaaggtttggtc
                                                                          

A0A5F9CXI7_BCL2A1-      ----------------------------tgc-------------------
A0A5F9CXI7_BCL2A1-      ----------------------------tgc-------------------
A0A5F9CXI7_BCL2A1-      ----------------------------tgc-------------------
A0A5F9CXI7_BCL2A1-      ----------------------------tgc-------------------
G1T2Q0_MCL1-01          ----------------------------tgtag-----------------
G1T2Q0_MCL1-02          ----------------------------tgtag-----------------
Q9MYW4_BCL2L1-01        ----------------------------cgcagcagccgagagccgca--
G1T264_BCL2L10-01       ----------------------------tgtgtcttctac----------
G1TV33_BCL2L2-01        ----------------------------cgcggcgtctgcgggag-----
A0A5F9CRQ4_BCL2-01      ----------------------------tgcggcctctgt----------
A0A5F9CRQ4_BCL2-02      tacataccaaggcagccaaagtattaattgcattctctgtgatcgcaaaa
                                                     *                    

A0A5F9CXI7_BCL2A1-      -------------------------------------cgggcctcgggc-
A0A5F9CXI7_BCL2A1-      -------------------------------------cgggcctcgggt-
A0A5F9CXI7_BCL2A1-      -------------------------------------aga----------
A0A5F9CXI7_BCL2A1-      -------------------------------------cgggcctcgggt-
G1T2Q0_MCL1-01          -------------------------------------aggacct------
G1T2Q0_MCL1-02          -------------------------------------aggacct------
Q9MYW4_BCL2L1-01        -------------------------------------agggcc-------
G1T264_BCL2L10-01       -------------------------------------cggactccc----
G1TV33_BCL2L2-01        -------------------------------------gggacct------
A0A5F9CRQ4_BCL2-01      -------------------------------------cagacttctcct-
A0A5F9CRQ4_BCL2-02      aaggcgctgaattcttctcttcacgttttcagaatgacagacttctgctc
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      tgccagctctgagcacagcgcatcacatggaaaggagcggctagatttga
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      gggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaa
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
G1T264_BCL2L10-01       --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      gagttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaa
                                                                          

A0A5F9CXI7_BCL2A1-      --------------------------t---------ttgccccctgctgc
A0A5F9CXI7_BCL2A1-      --------------------------tcgacagggacggcaaccggctgg
A0A5F9CXI7_BCL2A1-      --------------------------tgagcagaga-------aggctat
A0A5F9CXI7_BCL2A1-      --------------------------tcgacagggacggcaaccggctgg
G1T2Q0_MCL1-01          ------------------------------agaaagcggcatcag-----
G1T2Q0_MCL1-02          ------------------------------agaaagcggcatcag-----
Q9MYW4_BCL2L1-01        --------------------------------aggagcgcttcaa-----
G1T264_BCL2L10-01       --------------------------ttaccgctgaccttctgga-----
G1TV33_BCL2L2-01        gggcg---------------------tcagtgaggacagtgctga-----
A0A5F9CRQ4_BCL2-01      gggtg---------------------tctctgaagactttgttca-----
A0A5F9CRQ4_BCL2-02      ggatgtacttccatgcatttacataatctacgaagccttttcccatcttg
                                                                          

A0A5F9CXI7_BCL2A1-      t-----gcttttgctactccgacatccgtt--cttcgcttgctgc----t
A0A5F9CXI7_BCL2A1-      ggaggggcaggggctactacgacacctacctgcagcgctgcctgcagcag
A0A5F9CXI7_BCL2A1-      ggaagagaagaacc------------------cagcgc-----------a
A0A5F9CXI7_BCL2A1-      ggaggggcaggggctactacgacacctacctgcagcgctgcctgcagcag
G1T2Q0_MCL1-01          ---------------------------aaatgtgctgctggcttttgcgg
G1T2Q0_MCL1-02          ---------------------------aaatgtgctgctggcttttgcgg
Q9MYW4_BCL2L1-01        ---------------------------ccgctggttcctgacgggcatga
G1T264_BCL2L10-01       --------------------------------gaagactgc---------
G1TV33_BCL2L2-01        ---------------------cgggggccgtggca--ctgg---------
A0A5F9CRQ4_BCL2-01      ---------------------------gcctggcc--ctgatag------
A0A5F9CRQ4_BCL2-02      aagtcttactttatgtgttgcagtgggacctggccagctgccagctgcag
                                                             *            

A0A5F9CXI7_BCL2A1-      caggtgcggagtttacgcttcctcttcttgctctcggaacgccagcatgg
A0A5F9CXI7_BCL2A1-      cagggggcaaagccctacaccatcgccctggccttcagagagcagatctg
A0A5F9CXI7_BCL2A1-      caggg---aaggctgttc-------------tctctggagggcgg-----
A0A5F9CXI7_BCL2A1-      cagggggcaaagccctacaccatcgccctggccttcagagagcagatctg
G1T2Q0_MCL1-01          gtgttgc----------cggagtaggagcg--------------------
G1T2Q0_MCL1-02          gtgttgc----------cggagtaggagcg--------------------
Q9MYW4_BCL2L1-01        ccgtggc----------tggcgtggttctg--------------------
G1T264_BCL2L10-01       ---tggtccgcacttttctgtcctgctttg--------------------
G1TV33_BCL2L2-01        ---gggccc--------tggta--actgta--------------------
A0A5F9CRQ4_BCL2-01      ---gagc----------ttgcatcaccctc--------------------
A0A5F9CRQ4_BCL2-02      tttgagcccatttccttttgcattggtttc--------------------
                                                                          

A0A5F9CXI7_BCL2A1-      tc------------tggagaccagcggctgatactcctaagagcttctct
A0A5F9CXI7_BCL2A1-      cccccaggtgcccgtggacgacacagacatgagcgtcgacgaggtgctgt
A0A5F9CXI7_BCL2A1-      -----------------------taggcagaaatgttaa-----------
A0A5F9CXI7_BCL2A1-      cccccaggtgcccgtggacgacacagacatgagcgtcgacgaggtgctgt
G1T2Q0_MCL1-01          -----------------------------gggct---ggct------tat
G1T2Q0_MCL1-02          -----------------------------gggct---ggct------tat
Q9MYW4_BCL2L1-01        -----------------------------ctg-----ggct---ccctct
G1T264_BCL2L10-01       -----------------------------tagctacagcct---tactct
G1TV33_BCL2L2-01        -----------------------------ggg-----gcct------ttt
A0A5F9CRQ4_BCL2-01      -----------------------------ggt-----gcct------acc
A0A5F9CRQ4_BCL2-02      -----------------------------tgt-----gtccagggaaacc
                                                                          

A0A5F9CXI7_BCL2A1-      ttgttga-------------------------
A0A5F9CXI7_BCL2A1-      acgtggacgcggccgcttccctcgcgccctga
A0A5F9CXI7_BCL2A1-      --------------------------------
A0A5F9CXI7_BCL2A1-      acgtggacgcggccgcttccctcgcgccctga
G1T2Q0_MCL1-01          ctgataaga--------------------tag
G1T2Q0_MCL1-02          ctgataaga--------------------tag
Q9MYW4_BCL2L1-01        tcagccgga------------------aatga
G1T264_BCL2L10-01       tcgcctggacgcgcgtgtatcgtgagttgtaa
G1TV33_BCL2L2-01        ttgctagca------------------aatga
A0A5F9CRQ4_BCL2-01      tgggccaca------------------agtga
A0A5F9CRQ4_BCL2-02      ttgtttctc------------------tatga
                                                        

© 1998-2022Legal notice