Dataset for CDS BCL-2-like of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1T2Q0_MCL1-02         ------atgtttagcctgagaagaaacg------------cggtaatcgg
G1T2Q0_MCL1-01         atggcgatgtttagcctgagaagaaacg------------cggtaatcgg
Q9MYW4_BCL2L1-01       atgtct------------------cagagcaaccgggagctggtggttga
G1T264_BCL2L10-01      atggcagacgctttg-gaggagcgcactgcgcgcctgct-----------
G1TV33_BCL2L2-01       atggcg-accccagcct--cagccccagacacacgggctctggtggccga
G1TW27_BCL2-01         atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
G1TW27_BCL2-02         atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
                                                                         

G1T2Q0_MCL1-02         actcaacctctac---------ttgggggggcccgggtt-----------
G1T2Q0_MCL1-01         actcaacctctac---------ttgggggggcccgggtt-----------
Q9MYW4_BCL2L1-01       ctttctctcctacaagctttcgcagaaaggatacagctggagtcagttta
G1T264_BCL2L10-01      ---caccgactac---------ctggagtgctgcgcccg-----------
G1TV33_BCL2L2-01       ctttgtaggctacaagctgaggcagaagggttatgtctg-----------
G1TW27_BCL2-01         gtacatccactataagctgtcccagaggggctacgagtg-----------
G1TW27_BCL2-02         gtacatccactataagctgtcccagaggggctacgagtg-----------
                                ***            *    *                    

G1T2Q0_MCL1-02         ----------------gggagccggtggcggcggcgtcgcccctccggca
G1T2Q0_MCL1-01         ----------------gggagccggtggcggcggcgtcgcccctccggca
Q9MYW4_BCL2L1-01       gtgatgtggaagagaacaggactgaggccccggaagggactggaccagag
G1T264_BCL2L10-01      ----------------cgagcccgg-------------------------
G1TV33_BCL2L2-01       ----------------tggggctgg-------------------------
G1TW27_BCL2-01         ----------------ggacgctggggacgcgggcgccgcctccgcgccg
G1TW27_BCL2-02         ----------------ggacgctggggacgcgggcgccgcctccgcgccg
                                            * *                          

G1T2Q0_MCL1-02         gagcggctttt---------------------------------------
G1T2Q0_MCL1-01         gagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagg
Q9MYW4_BCL2L1-01       atggagacccccagtgccatcaatggcaacccagcctgg-----------
G1T264_BCL2L10-01      -------------------------------cacccctg-----------
G1TV33_BCL2L2-01       ----------------------------------ccctg-----------
G1TW27_BCL2-01         ggcgtcttctcctcccagcccgcgcccgctgcgccccgg-----------
G1TW27_BCL2-02         ggcgtcttctcctcccagcccgcgcccgctgcgccccgg-----------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         gggaggggaggccggcgcggtgattggcggaagcccgggcgctagccccc
Q9MYW4_BCL2L1-01       -------------------------------cacccggcggacagccccg
G1T264_BCL2L10-01      -------------------------------ag----------------c
G1TV33_BCL2L2-01       -------------------------------ga-----------------
G1TW27_BCL2-01         -------------------------------gacccggccgccaggacct
G1TW27_BCL2-02         -------------------------------gacccggccgccaggacct
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         cggccgcgctggcgccggacgcccggagggtcgcgcggccggcgcccatt
Q9MYW4_BCL2L1-01       cggtgaacgg----------------------------------------
G1T264_BCL2L10-01      c-------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         c-------------------------------------------------
G1TW27_BCL2-02         c-------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         ggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtactt
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         ggcgcccacccgccgcgcgtcgccgctcgaggagatggaagccccggctg
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         cggacgccatcatgtcgcccgaagaggagctggacggctacgagccggag
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         ccccttgcgaagcggccggccgtcctgcccctgctggacttggtggggga
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         ggccagtaaggtccctagcacggacgggtcgctgccctcgacgccgccgc
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         ccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatc
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         --------------------------------------------------
                                                                         

G1T2Q0_MCL1-02         --------------------ggcgaccggcgccaaggacgcgaagccgat
G1T2Q0_MCL1-01         gcccggtaccttcgggagcaggcgaccggcgccaaggacgcgaagccgat
Q9MYW4_BCL2L1-01       --------------------agccactggccacagca----gcagtttgg
G1T264_BCL2L10-01      ---------------------gcagccgtccacgccg----gaggcggct
G1TV33_BCL2L2-01       -----------------------------------------------gag
G1TW27_BCL2-01         ---------------------gccgccgccgccgccg----gccgccgcg
G1TW27_BCL2-02         ---------------------gccgccgccgccgccg----gccgccgcg
                                                                         

G1T2Q0_MCL1-02         gggccg--------ggccggcagcgcgagccggaaggcgctcgagaccct
G1T2Q0_MCL1-01         gggccg--------ggccggcagcgcgagccggaaggcgctcgagaccct
Q9MYW4_BCL2L1-01       atgccc----gggaggtgatccccatgacagcagtga---agcaggctct
G1T264_BCL2L10-01      gtgctgcgctgtgcggcca---cgcagcttcagcgggtccactggccctt
G1TV33_BCL2L2-01       ggcccg------gcagctaacccgctg------------caccaagccat
G1TW27_BCL2-01         gggccc------gcgctcagcccggtgccacctgtggtccacctgaccct
G1TW27_BCL2-02         gggccc------gcgctcagcccggtgccacctgtggtccacctgaccct
                          *                      *                   *  *

G1T2Q0_MCL1-02         gcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaag
G1T2Q0_MCL1-01         gcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaag
Q9MYW4_BCL2L1-01       gagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagcg
G1T264_BCL2L10-01      cttctccg------------tctaccgcggctaccccggcaaccgcatcg
G1TV33_BCL2L2-01       gcgggcagccggagatgagttcgagacccgcttccggcaaaacttctccg
G1TW27_BCL2-01         ccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcgg
G1TW27_BCL2-02         ccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcgg
                              *            *            *           *   *

G1T2Q0_MCL1-02         gaatgcttcggaaactggacatcaaaaacgaagacg-atgtcaaatcttt
G1T2Q0_MCL1-01         gaatgcttcggaaactggacatcaaaaacgaagacg-atgtcaaatcttt
Q9MYW4_BCL2L1-01       acctgacatcccagctccacatcaccccagggacagcatatcagagcttt
G1T264_BCL2L10-01      agctggc------ggcgcgcgtggcg-----------gaggccgtgctct
G1TV33_BCL2L2-01       acctggccgctcagttgcatgtgaccccaggctcagcacagcagagcttc
G1TW27_BCL2-01         agatgtccagccagctgcacctgacgccctttcacgcgagggggcgcttt
G1TW27_BCL2-02         agatgtccagccagctgcacctgacgccctttcacgcgagggggcgcttt
                          **                *                        **  

G1T2Q0_MCL1-02         gtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggca
G1T2Q0_MCL1-01         gtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggca
Q9MYW4_BCL2L1-01       gaacaa-gtagtgaacgaactcttccgggatggggt---gaactggggcc
G1T264_BCL2L10-01      ccgacg-gcc-------------------acgacct---cagctggggcc
G1TV33_BCL2L2-01       acccag-gtctgcgatgaacttttccaaaggggtcc---caactggggcc
G1TW27_BCL2-01         gccacg-gtggtggaggagctcttcagggatggggt---gaactggggga
G1TW27_BCL2-02         gccacg-gtggtggaggagctcttcagggatggggt---gaactggggga
                              *                       *        * ******  

G1T2Q0_MCL1-02         ggattgtgactctgatttctttcggtg-----cctttgtggccaaacact
G1T2Q0_MCL1-01         ggattgtgactctgatttctttcggtg-----cctttgtggccaaacact
Q9MYW4_BCL2L1-01       gcattgtggcctttttctccttcggcggggc-actgtgcg----------
G1T264_BCL2L10-01      gcgtggtgacgctcgtgaccttcgccgggacgcttctgga----------
G1TV33_BCL2L2-01       gcgtggtggccttctttgcctttggggccgc-actgtgtg----------
G1TW27_BCL2-01         ggattgtggccttctttgagttcggtggggt-catgtgtg----------
G1TW27_BCL2-02         ggattgtggccttctttgagttcggtggggt-catgtgtg----------
                       *  * *** *  *  *    ** *  *       * **            

G1T2Q0_MCL1-02         tgaagagc--------ataaaccaagaaagctg---------catagaac
G1T2Q0_MCL1-01         tgaagagc--------ataaaccaagaaagctg---------catagaac
Q9MYW4_BCL2L1-01       tggaaagc--------gtggacaaggaga--tg-------------gagg
G1T264_BCL2L10-01      cagagggccgccggtgaccacccagcggg--tgaggaggaatgaaatcgc
G1TV33_BCL2L2-01       ctgagagc--------gtcaacaaggaga--tg-------------gagc
G1TW27_BCL2-01         tggagagc--------gtcaaccgggaga--tg-------------tcgc
G1TW27_BCL2-02         tggagagc--------gtcaaccgggaga--tg-------------tcgc
                          *  **             *         **                 

G1T2Q0_MCL1-02         ctttagcggaaagta-------tcacagatgtt-------ctcgtcagga
G1T2Q0_MCL1-01         ctttagcggaaagta-------tcacagatgtt-------ctcgtcagga
Q9MYW4_BCL2L1-01       tattggtgagtcgga--tcgcggcgtggatggccacttacctgaatgacc
G1T264_BCL2L10-01      ccgggactgccagcgcttggtggccttgctgtgcgctcgcctcgcagggc
G1TV33_BCL2L2-01       ccctggtgggacaag--tgcaggagtggatggtgacctacctggagacgc
G1TW27_BCL2-01         ccctggtggacaaca--tcgccctgtggatgactgagtacctgaaccggc
G1TW27_BCL2-02         ccctggtggacaaca--tcgccctgtggatgactgagtacctgaaccggc
                                                  * **         **        

G1T2Q0_MCL1-02         cgaaacgggactggctagtcaaacaaagaggct-----------------
G1T2Q0_MCL1-01         cgaaacgggactggctagtcaaacaaagaggct-----------------
Q9MYW4_BCL2L1-01       acctggagccctggatccaggagaacggcggct-----------------
G1T264_BCL2L10-01      agcaccgcgcctggctgcaggctcaaggcggct-----------------
G1TV33_BCL2L2-01       agctggccggctggatccacagcaccgggggct-----------------
G1TW27_BCL2-01         acctgcacacctggatccaggataatggaggct-----------------
G1TW27_BCL2-02         acctgcacacctggatccaggataatggaggctgggcagacaaaagccct
                                 **** *           * ****                 

G1T2Q0_MCL1-02         --------gggatgggtttg------------------------------
G1T2Q0_MCL1-01         --------gggatgggtttg------------------------------
Q9MYW4_BCL2L1-01       --------gggacacgtttg------------------------------
G1T264_BCL2L10-01      --------gggatggcttt-------------------------------
G1TV33_BCL2L2-01       --------gggcggagttca------------------------------
G1TW27_BCL2-01         --------gggatgccttcg------------------------------
G1TW27_BCL2-02         tggatctcggggtgtctttgtacttctcggagagccaccccaggagcaca
                               ***     **                                

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         ttccctgacggagggctcagccacctcttccgcctcattatactctgctc
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         -----------------------------tggaa----------------
G1TW27_BCL2-02         agcaccgagaagcctggcatggtttctgctggaatgaaaagattggcaga
                                                                         

G1T2Q0_MCL1-02         -tggagttcttcca------------------------------------
G1T2Q0_MCL1-01         -tggagttcttcca------------------------------------
Q9MYW4_BCL2L1-01       -tggaactctacggcaacaa------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       -cagctctgtacgg-------ggatcgggccctggaggagg---------
G1TW27_BCL2-01         ------ctgtacggccccagcg----------------------------
G1TW27_BCL2-02         gctgccctagacaacagcaccgcaaaacactgtggcagaaggtttggtct
                                                                         

G1T2Q0_MCL1-02         ---------------------------tgtag------------------
G1T2Q0_MCL1-01         ---------------------------tgtag------------------
Q9MYW4_BCL2L1-01       ---------------------------cgcagcagccgagagccgca---
G1T264_BCL2L10-01      ---------------------------tgtgtcttctac-----------
G1TV33_BCL2L2-01       ---------------------------cgcggcgtctgcgggag------
G1TW27_BCL2-01         ---------------------------tgcggcctctgt-----------
G1TW27_BCL2-02         acataccaaggcagccaaagtattaattgcattctctgtgatcgcaaaaa
                                                   *                     

G1T2Q0_MCL1-02         ------------------------------------aggacct-------
G1T2Q0_MCL1-01         ------------------------------------aggacct-------
Q9MYW4_BCL2L1-01       ------------------------------------agggcc--------
G1T264_BCL2L10-01      ------------------------------------cggactccc-----
G1TV33_BCL2L2-01       ------------------------------------gggacct-------
G1TW27_BCL2-01         ------------------------------------cagacttctcct--
G1TW27_BCL2-02         aggcgctgaattcttctcttcacgttttcagaatgacagacttctgctct
                                                             * *         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         gccagctctgagcacagcgcatcacatggaaaggagcggctagatttgag
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       --------------------------------------------------
G1TW27_BCL2-01         --------------------------------------------------
G1TW27_BCL2-02         ggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaag
                                                                         

G1T2Q0_MCL1-02         --------------------------------------------------
G1T2Q0_MCL1-01         --------------------------------------------------
Q9MYW4_BCL2L1-01       --------------------------------------------------
G1T264_BCL2L10-01      --------------------------------------------------
G1TV33_BCL2L2-01       -------------------------------------------------g
G1TW27_BCL2-01         -------------------------------------------------g
G1TW27_BCL2-02         agttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaag
                                                                         

G1T2Q0_MCL1-02         -----------------------------agaaagcggcatcag------
G1T2Q0_MCL1-01         -----------------------------agaaagcggcatcag------
Q9MYW4_BCL2L1-01       -------------------------------aggagcgcttcaa------
G1T264_BCL2L10-01      -------------------------ttaccgctgaccttctgga------
G1TV33_BCL2L2-01       ggcg---------------------tcagtgaggacagtgctga------
G1TW27_BCL2-01         ggtg---------------------tctctgaagactttgttca------
G1TW27_BCL2-02         gatgtacttccatgcatttacataatctacgaagccttttcccatcttga
                                                                         

G1T2Q0_MCL1-02         --------------------------aaatgtgctgctggcttttgcggg
G1T2Q0_MCL1-01         --------------------------aaatgtgctgctggcttttgcggg
Q9MYW4_BCL2L1-01       --------------------------ccgctggttcctgacgggcatgac
G1T264_BCL2L10-01      -------------------------------gaagactgc----------
G1TV33_BCL2L2-01       --------------------cgggggccgtggca--ctgg----------
G1TW27_BCL2-01         --------------------------gcctggcc--ctgatag-------
G1TW27_BCL2-02         agtcttactttatgtgttgcagtgggacctggccagctgccagctgcagt
                                                           ***           

G1T2Q0_MCL1-02         tgttgc----------cggagtaggagcggggct---ggct------tat
G1T2Q0_MCL1-01         tgttgc----------cggagtaggagcggggct---ggct------tat
Q9MYW4_BCL2L1-01       cgtggc----------tggcgtggttctgctg-----ggct---ccctct
G1T264_BCL2L10-01      --tggtccgcacttttctgtcctgctttgtagctacagcct---tactct
G1TV33_BCL2L2-01       --gggccc--------tggta--actgtaggg-----gcct------ttt
G1TW27_BCL2-01         --gagc----------ttgcatcaccctcggt-----gcct------acc
G1TW27_BCL2-02         ttgagcccatttccttttgcattggtttctgt-----gtccagggaaacc
                           *             *                  * *          

G1T2Q0_MCL1-02         ctgataaga--------------------tag
G1T2Q0_MCL1-01         ctgataaga--------------------tag
Q9MYW4_BCL2L1-01       tcagccgga------------------aatga
G1T264_BCL2L10-01      tcgcctggacgcgcgtgtatcgtgagttgtaa
G1TV33_BCL2L2-01       ttgctagca------------------aatga
G1TW27_BCL2-01         tgggccaca------------------agtga
G1TW27_BCL2-02         ttgtttctc------------------tatga
                                                    *  

© 1998-2020Legal notice