Dataset for CDS BCL2L1 of organism Sinocyclocheilus grahami

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A672K8R2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=654 residues).
atgtcttactataaccgagaactggtggtattttttattaaatacaaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaatgacgaacctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggtgagtggaaagttacttgtatttttctcctaccctgttagtttgaagattaagtcctatcggt
ttggaacaacatga
>gnl|bcl2dbcds|A0A672N8N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacaaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccgccaaggtcccccgcttcaaccccccagcgtcag
acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
© 1998-2020Legal notice