Dataset for CDS BCL2L1 of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672K8R2_BCL2L1-      atgtcttactataaccgagaactggtggtattttttattaaatacaaact
A0A672N8N5_BCL2L1-      atgtcttactataaccgagaactggtggtattttttattaaatataaact
                        ******************************************** *****

A0A672K8R2_BCL2L1-      ctcgcagaggaactacccctacaaccacattgaatttacagaagacacaa
A0A672N8N5_BCL2L1-      ctcacagaggaactacccctacaatcacattgaatttacagaagacacaa
                        *** ******************** *************************

A0A672K8R2_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaatg
A0A672N8N5_BCL2L1-      atcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacg
                        ************************************ *********** *

A0A672K8R2_BCL2L1-      acgaacctcgttaatggctccctaaacggaacaagtactggttccactgg
A0A672N8N5_BCL2L1-      acaaccctcgttaatggctccctgaacggaacaagtactggttccactgg
                        ** * ****************** **************************

A0A672K8R2_BCL2L1-      gaccccaccaaggtcccccgcttcaaccccccagcgtcagacgaacggga
A0A672N8N5_BCL2L1-      gaccccgccaaggtcccccgcttcaaccccccagcgtcagacaaacggga
                        ****** *********************************** *******

A0A672K8R2_BCL2L1-      ctgggggtctggatgctgtaaaggaggcgcttcgcgattctgccaacgag
A0A672N8N5_BCL2L1-      ctgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgag
                        **************** *********************************

A0A672K8R2_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctcca
A0A672N8N5_BCL2L1-      tttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctcca

A0A672K8R2_BCL2L1-      catcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
A0A672N8N5_BCL2L1-      catcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
                        *************** ** *******************************

A0A672K8R2_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttt
A0A672N8N5_BCL2L1-      tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttc

A0A672K8R2_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgctagt
A0A672N8N5_BCL2L1-      ggaggggctctgtgtgttgagtgcgtggagaaggagatgagcccgctagt

A0A672K8R2_BCL2L1-      gggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagc
A0A672N8N5_BCL2L1-      gggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagc
                        *************** **********************************

A0A672K8R2_BCL2L1-      cctggatccagagccaaggaggatgg------------------------
A0A672N8N5_BCL2L1-      cctggatccagagccaaggaggatgggaacgcttcgcagagatctttgga

A0A672K8R2_BCL2L1-      ---------------gtgagtggaaagttacttgtatttttc--------
A0A672N8N5_BCL2L1-      aaagatgcagcggcagagagcagaaaatcacaagaaaacttcaagaagtg
                                       * ***  **** * **  * *   ***        

A0A672K8R2_BCL2L1-      --tcct----------accctgtt----agtttgaagattaagt--ccta
A0A672N8N5_BCL2L1-      gttgctggcgggaatgaccttgctcacgggtgtcgtggtcgggtcactca
                          * **          *** ** *     ** *   * *   **  *  *

A0A672K8R2_BCL2L1-      tcggtttggaacaac-atga
A0A672N8N5_BCL2L1-      ttgcacagaaacgcctgtga
                        * *    * ***  *  ***

© 1998-2021Legal notice