Dataset for CDS BCL-2-like of organism Ovis aries

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5Q0N6_BCL2A1-01       atgactga------------------------------------------
W5QI41_MCL1-01         gggagccggaaaccccgccctgccccaggccccgcccctgccttgacccc
W5QIG4_BCL2L10-01      ---ggtcg------------------------------------------
W5QDH4_BCL2L2-02       atgggctg------------------------------------------
W5QDH4_BCL2L2-01       atgggctg------------------------------------------
Q9MZS7_BCL2L1-01       atgtctca------------------------------------------
W5PSA5_BCL2L1-01       atgtctca------------------------------------------

W5Q0N6_BCL2A1-01       --------------------------------------------------
W5QI41_MCL1-01         gccggttaggtgccgtgcgcaaccgccggaagctttcgctgccttcccca
W5QIG4_BCL2L10-01      ----------------gccc--ccc--ggtagaggcgg--------agcc
W5QDH4_BCL2L2-02       ----------------gccaaacct--gaaa--------------tacct
W5QDH4_BCL2L2-01       ----------------gccaaacct--gaaa--------------tacct
Q9MZS7_BCL2L1-01       ----------------gagcaaccg--ggagctggtggttgactttctct
W5PSA5_BCL2L1-01       ----------------gagcaaccg--ggaactagtggttgactttctct

W5Q0N6_BCL2A1-01       --------------------------------------------------
W5QI41_MCL1-01         tttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggc
W5QIG4_BCL2L10-01      atggtggacccg--------------------------------------
W5QDH4_BCL2L2-02       ccttctgggcct--------------------------------------
W5QDH4_BCL2L2-01       ccttctgggcct--------------------------------------
Q9MZS7_BCL2L1-01       cttacaagcttt--------------------------------------
W5PSA5_BCL2L1-01       cttacaagtttt--------------------------------------

W5Q0N6_BCL2A1-01       ----------------------------cactgagtttgactacgttcac
W5QI41_MCL1-01         ttcaagaggcgccctgcc---gtccggcctttacctttgat---------
W5QIG4_BCL2L10-01      tttagggagcgcacg------gcccggctgctga--tggact--------
W5QDH4_BCL2L2-02       ctcaccatatattcat-----gccagtcttttatgtttgactccaacagc
W5QDH4_BCL2L2-01       ctcaccatatattcat-----gccagtcttttatgtttgactccaacagc
Q9MZS7_BCL2L1-01       cccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca--
W5PSA5_BCL2L1-01       ttcagaaaggatacagctggagtcagtttagtgacatggaagagaaca--
                                                      *    * **          

W5Q0N6_BCL2A1-01       aagctggctgaggactatctgaaatatgtgttgcagatacagcaacct--
W5QI41_MCL1-01         -----ggtcggagaag-ccagtaacaacagtccaggctcggacggctcgc
W5QIG4_BCL2L10-01      -----ggctggagttc-tgcg-------------------------cc--
W5QDH4_BCL2L2-02       cgcccggatggcgacc-ccag-------------------------cc--
W5QDH4_BCL2L2-01       cgcccggatggcgacc-ccag-------------------------cc--
Q9MZS7_BCL2L1-01       -----gaactgaggcc-ccagaagggacagaatcagatatggaaaccc--
W5PSA5_BCL2L1-01       -----gaactgagacc-ctagaagggacagaatcagatatggaaaccc--
                            *      *       *                             

W5Q0N6_BCL2A1-01       -------------ggatccaagccaagcaaaacatccagggtgttacaag
W5QI41_MCL1-01         tgccctcgacgccgcccccatcagaggaggaggaggacgagttata----
W5QIG4_BCL2L10-01      -----------cgggagccc-----ggcactccagc--------------
W5QDH4_BCL2L2-02       -----------tcagcccca-----gaca------cacgggctcta----
W5QDH4_BCL2L2-01       -----------tcagcccca-----gaca------cacgggctcta----
Q9MZS7_BCL2L1-01       -----------ccagtgccatcaatggcaacccatcttggcacctg----
W5PSA5_BCL2L1-01       -----------ccagtgccatcagtggcaacccatcctggcacctg----

W5Q0N6_BCL2A1-01       acgtggcttcctctg---------------tccaggacgaagtggaa---
W5QI41_MCL1-01         --tcggcagtccctggagattatctctcagtacctcctggagcaagc---
W5QIG4_BCL2L10-01      ----------tcctgcg---------------ccgtccacgcccgag---
W5QDH4_BCL2L2-02       --gtggcagactttgtgg--------gc--tataagctgaggcagaaggg
W5QDH4_BCL2L2-01       --gtggcagactttgtgg--------gc--tataagctgaggcagaaggg
Q9MZS7_BCL2L1-01       --gcggatagccctgcggtgaatggagc--caccggccacagcagaa---
W5PSA5_BCL2L1-01       --gcagatagccctgtggtgaatggagc--cactggtcacagcagaa---

W5Q0N6_BCL2A1-01       -----------------------agga-----------------------
W5QI41_MCL1-01         ------------aaccggcaccaaggacgcgaagcccctgggcgggtctg
W5QIG4_BCL2L10-01      ----------------gctgctgtgct---g-cgccacgtggccg-----
W5QDH4_BCL2L2-02       gtatgtttgtggagctggccccgggga---g-ggcccagcagctgacccg
W5QDH4_BCL2L2-01       gtatgtttgtggagctggccccgggga---g-ggcccagcagctgacccg
Q9MZS7_BCL2L1-01       ----gcttg-------gatgcccgggaagtg-atccccatggcag---cg
W5PSA5_BCL2L1-01       ----gcttg-------gacaccgggaaaatg-atccccatggcag---tg

W5Q0N6_BCL2A1-01       ---------------------------ctctgaagcagtgcttggataag
W5QI41_MCL1-01         gggccaccagccggaaggcgttggagaccctgcgcagagtcggggatggg
W5QIG4_BCL2L10-01      ----cccgtg-----------------tcctggaagcaaatcgaaacgtc
W5QDH4_BCL2L2-02       ctacaccaag-----------------ccatgcgggcagctggagatgag
W5QDH4_BCL2L2-01       ctacaccaag-----------------ccatgcgggcagctggagatgag
Q9MZS7_BCL2L1-01       gtgaagcaag-----------------ccctgagggaggcaggcgatgag
W5PSA5_BCL2L1-01       gtgaagcaag-----------------ccctgagggaggcaagcaatgag
                                                     **             *    

W5Q0N6_BCL2A1-01       ttt---------------------------------gatgtggtgtct--
W5QI41_MCL1-01         gtg------cagcgcaaccacgagacggctttccaaggcatgcttcggaa
W5QIG4_BCL2L10-01      ttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggcc--
W5QDH4_BCL2L2-02       ttt------gagacccgcttccggcgcaccttctccgatttggcagctca
W5QDH4_BCL2L2-01       ttt------gagacccgcttccggcgcaccttctccgatttggcagctca
Q9MZS7_BCL2L1-01       ttt------gaactgaggtaccgacgggcattcagcgacctgacgtccca
W5PSA5_BCL2L1-01       tgt------gaattgaggtaccaacagacattcagcgacctgacgtccca
                                                           *   **        

W5Q0N6_BCL2A1-01       --------------gtagacactgccagaacaatattcaac-caagtgat
W5QI41_MCL1-01         actggacatcaaaaacgaagacg--atgtcaagtctttgtctcgagtgat
W5QIG4_BCL2L10-01      -----------------aggatggcgcagaggctgctcgac-gaag----
W5QDH4_BCL2L2-02       gctgcatgtg-accccgggttcggcccagcagcgcttcacc-caggtctc
W5QDH4_BCL2L2-01       gctgcatgtg-accccgggttcggcccagcagcgcttcacc-caggtctc
Q9MZS7_BCL2L1-01       gctccacatc-accccagggacagcatatcagagctttgaa-caggtagt
W5PSA5_BCL2L1-01       gctccacatc-accccagggaaagcatatcagagctttgaa-caggtaat
                                                           *        *    

W5Q0N6_BCL2A1-01       ggaaaaggaatttgaagatggcattgttaactggggcaggattgtaacca
W5QI41_MCL1-01         ggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactc
W5QIG4_BCL2L10-01      ------accct--------ggcc---ccagctggggccgc---gtggcct
W5QDH4_BCL2L2-02       tgatgaactcttccaagggggcc---ccaactggggtcgccttgtggcct
W5QDH4_BCL2L2-01       tgatgaactcttccaagggggcc---ccaactggggtcgccttgtggcct
Q9MZS7_BCL2L1-01       gaatgaactcttccgggacgggg---tgaactggggtcgcattgtggcct
W5PSA5_BCL2L1-01       aaatgaactcttccaggatgggg---tgaactggggtcgcaatgtggcct
                                 *        **       * ******  *    **  *  

W5Q0N6_BCL2A1-01       tattcg---cctttgaaggtattcttac--------caagaaacttctga
W5QI41_MCL1-01         ttattt---cttttggtgc--ctttgtggccaaacacttgaagagtataa
W5QIG4_BCL2L10-01      cactcgtgaccttcgcggggtctctgct----------------------
W5QDH4_BCL2L2-02       tctttg---tctttggagccgcattgtg--------tgctgagagtgtca
W5QDH4_BCL2L2-01       tctttg---tctttggagccgcattgtg--------tgctgagagtgtca
Q9MZS7_BCL2L1-01       ttttct---ccttcggtggggcactgtg--------cgtggaaagcgtag
W5PSA5_BCL2L1-01       ttttct---ccttcggtggggcactatg--------catgaaaagcatag
                          *       ** *  *      *                         

W5Q0N6_BCL2A1-01       gcaagcgtattgcctcag------acatggacatgtgcaaggacatttct
W5QI41_MCL1-01         atcaa----------gaaagctgcatcgaaccactagcagaaagcatcac
W5QIG4_BCL2L10-01      ----g----------gag------aggcagccgcagacgacccgacggca
W5QDH4_BCL2L2-02       acaag----------gag------atggagccacttgtgggacaagtgca
W5QDH4_BCL2L2-01       acaag----------gag------atggagccacttgtgggacaagtgca
Q9MZS7_BCL2L1-01       acaag----------gag------atgcaggtattggtgagtcggatcgc
W5PSA5_BCL2L1-01       tcaag----------gag------atgcaggtattggtaagtcaggtcac
                                       *       *                         

W5Q0N6_BCL2A1-01       tattt-----cgtggcggagttcatcaccaaaaacacaggagagt-ggat
W5QI41_MCL1-01         a---------gatgttctcgtaaggtcaaaacgagactggatagtcaaac
W5QIG4_BCL2L10-01      gaagagagacgacggcagcgttagcag-----------ggactgtcggct
W5QDH4_BCL2L2-02       ggagtg----gatggtggc-ctacctggagacgcggctggctgactggat
W5QDH4_BCL2L2-01       ggagtg----gatggtggc-ctacctggagacgcggctggctgactggat
Q9MZS7_BCL2L1-01       aacttg----gatggctac-ttacctgaatgaccacctagagccttggat
W5PSA5_BCL2L1-01       gacttg----gatggccac-ttacctaaatgaccacctagagccttggat
                                    *                         *          

W5Q0N6_BCL2A1-01       aaggcaaaacggaggctgggaaaatggttttgtaaaga-agttt------
W5QI41_MCL1-01         --------aaagaggctggg---atgggtttgtgg----agttc----tt
W5QIG4_BCL2L10-01      cctcg-----------tggc---ccttctctgcgctc--agttctgcgaa
W5QDH4_BCL2L2-02       ccacagcagtgggggctggg---cg------gagttcacagctcta--ta
W5QDH4_BCL2L2-01       ccacagcagtgggggctggg---agctggaagcgatcaaagctcgagtta
Q9MZS7_BCL2L1-01       ccaggagaacggcggctggg---acacgtttgtgg----aactc----ta
W5PSA5_BCL2L1-01       ccaggagaatggcgactggg---acatttttgtgg----aactc----ta
                                       ***            *       *  *       

W5Q0N6_BCL2A1-01       -gaaaccaaa--tctggctg------------------------------
W5QI41_MCL1-01         ccgtgtagaggacctagaag-------gcggcatcagaaat---------
W5QIG4_BCL2L10-01      aggcaccgcg--cctggctgatggcgaacggcggctgggat---------
W5QDH4_BCL2L2-02       cggggacggggccctggaggaggcgcggcgtctgcgggag----------
W5QDH4_BCL2L2-01       gggagatgga-----ggaagaagctgagaagctaaaggagctacagaacg
Q9MZS7_BCL2L1-01       cgggaacaac------gcagcagccgagagccggaagggcc---------
W5PSA5_BCL2L1-01       cgaaaacaat------acagcaaccgagagccaaaagggcc---------

W5Q0N6_BCL2A1-01       -------------------------------gctga--------------
W5QI41_MCL1-01         --------------------------gtgctgctgg--------------
W5QIG4_BCL2L10-01      ---------ggattttgtctctccttcagccactca--------------
W5QDH4_BCL2L2-02       -----gggaa----------------------ctgggc------------
W5QDH4_BCL2L2-01       aggtagagaagcagatgaatatgagtccacctccgggcaatgctggccca
Q9MZS7_BCL2L1-01       -----aggag-----------cgcttcaaccgctgg--------------
W5PSA5_BCL2L1-01       -----aagag-----------cacctcaaccgctgg--------------

W5Q0N6_BCL2A1-01       ----------cttttctgga------------------------------
W5QI41_MCL1-01         ----------cttttgcagg------------------------------
W5QIG4_BCL2L10-01      ----ttgcaaccatcttggg------------------------------
W5QDH4_BCL2L2-02       ---------ttcagtgagga------------------------------
W5QDH4_BCL2L2-01       gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatcta
Q9MZS7_BCL2L1-01       ---------ttcctgacggg------------------------------
W5PSA5_BCL2L1-01       ---------tccctgacgga------------------------------

W5Q0N6_BCL2A1-01       ----------------agtta-----------------------------
W5QI41_MCL1-01         ----------------tgttg-----------------------------
W5QIG4_BCL2L10-01      ------aa----agacag--------------------------------
W5QDH4_BCL2L2-02       ------cagtgctgacggggg-----------------------------
W5QDH4_BCL2L2-01       tgttggcaatgtggactatggtgcaacagcagaagagctagaagcacact
Q9MZS7_BCL2L1-01       ------ca----tgactgtgg-----------------------------
W5PSA5_BCL2L1-01       ------ca----tgactgtgg-----------------------------

W5Q0N6_BCL2A1-01       -------------------------------------caggaaagatctg
W5QI41_MCL1-01         -------------------------------------ccggagtagg---
W5QIG4_BCL2L10-01      -------------------------------------ctggtctggtttt
W5QDH4_BCL2L2-02       -------------------------------------ccgtggcacttt-
W5QDH4_BCL2L2-01       tccatggctgtggttcagtcaaccgcgttactatactctgtgacaaatt-
Q9MZS7_BCL2L1-01       -------------------------------------ctggtgtggttc-
W5PSA5_BCL2L1-01       -------------------------------------ccggtatggctc-
                                                            * *          

W5Q0N6_BCL2A1-01       tgaaacattat---------------------------------------
W5QI41_MCL1-01         --------agctggt-----------------------------------
W5QIG4_BCL2L10-01      tcctctcatactgga-----------------------------------
W5QDH4_BCL2L2-02       --------cgctagc-----------------------------------
W5QDH4_BCL2L2-01       --------tagtggccatcccaaagggtttgcgtatatagagttctcaga
Q9MZS7_BCL2L1-01       --------tgctggg-----------------------------------
W5PSA5_BCL2L1-01       --------tgctggg-----------------------------------

W5Q0N6_BCL2A1-01       ---------------------------------------gtcgtctgaag
W5QI41_MCL1-01         ----------------------ttgg-------------catatctaata
W5QIG4_BCL2L10-01      ----------------------cagcaataatcataatctacttctggat
W5QDH4_BCL2L2-02       -----------tgagggct---ctggccg----------cttttttgcag
W5QDH4_BCL2L2-01       caaagagtcagtgaggacttccctggccttagatgaatccttatttagag
Q9MZS7_BCL2L1-01       ----------------------ctcg-------------ctcttcagtcg
W5PSA5_BCL2L1-01       ----------------------cttg-------------ctcttcaactg

W5Q0N6_BCL2A1-01       caatactattga--------------------------------------
W5QI41_MCL1-01         agatag--------------------------------------------
W5QIG4_BCL2L10-01      aaaattatcgtga-------------------------------------
W5QDH4_BCL2L2-02       aaagt---------------------------------------------
W5QDH4_BCL2L2-01       gaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagc
Q9MZS7_BCL2L1-01       gaaatga-------------------------------------------
W5PSA5_BCL2L1-01       taag----------------------------------------------

W5Q0N6_BCL2A1-01       --------------------------------------------------
W5QI41_MCL1-01         --------------------------------------------------
W5QIG4_BCL2L10-01      --------------------------------------------------
W5QDH4_BCL2L2-02       --------------------------------------------------
W5QDH4_BCL2L2-01       acaacagaccgaggtttcccacgagcccgataccgtgcccgaaccaccaa
Q9MZS7_BCL2L1-01       --------------------------------------------------
W5PSA5_BCL2L1-01       --------------------------------------------------

W5Q0N6_BCL2A1-01       --------------------------------------------------
W5QI41_MCL1-01         --------------------------------------------------
W5QIG4_BCL2L10-01      --------------------------------------------------
W5QDH4_BCL2L2-02       --------------------------------------------------
W5QDH4_BCL2L2-01       ctacaacagttcccgctctcgattctacagtggttttaacagcaggcccc
Q9MZS7_BCL2L1-01       --------------------------------------------------
W5PSA5_BCL2L1-01       --------------------------------------------------

W5Q0N6_BCL2A1-01       --------------------------------------------------
W5QI41_MCL1-01         --------------------------------------------------
W5QIG4_BCL2L10-01      --------------------------------------------------
W5QDH4_BCL2L2-02       --------------------------------------------------
W5QDH4_BCL2L2-01       ggggtcgcgtctacaggggccgggctagagcgacatcatggtattcccct
Q9MZS7_BCL2L1-01       --------------------------------------------------
W5PSA5_BCL2L1-01       --------------------------------------------------

W5Q0N6_BCL2A1-01       ------
W5QI41_MCL1-01         ------
W5QIG4_BCL2L10-01      ------
W5QDH4_BCL2L2-02       ------
W5QDH4_BCL2L2-01       tactaa
Q9MZS7_BCL2L1-01       ------
W5PSA5_BCL2L1-01       ------

© 1998-2020Legal notice