Dataset for CDS BOK of Organism Calidris pygmaea

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3K7U8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Calidris pygmaea GN=BOK (length=642 residues).
atggaagtgctacgccgttcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagagactacataaattcgaggctaattcgagcaggtgtcagctggagcaaacctg
agtacaatgttccggtgcctggcggtaagctggccgaggtgtccaccatactgctgcgactaggggatgagcttgaatac
attcgtcccaacgtctaccggaatattgcccgccaattgaacatctccctgcactcggagacggtggtgacagacgcctt
cctggcagtagctgcgcagattttcactgcaggcataacgtggggcaaggtggtgtccctctatgctgtggcagccgggc
tggccgtggactgtgtgcgacatgcacagccagccatggttcacaccatcgtggactgcctgggggagtttgtccgcaag
accttggtgacgtggctgaaaaggagaggaggctgggcagacatcacaaaatgcgtggtgaatactgaccccagccttcg
ctcccactggcttgtggctgctgtttgcagctttggtcacttcctcaaggccatcttcttcgtcctgctgcccgagagat
ga
© 1998-2023Legal notice