Dataset for CDS Unclassified of Organism Aquila chrysaetos chrysaetos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663EYV3_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos (length=447 residues).
atgtctcaaacaaggagaatccccgggcactttgtcctctccagctatcctaatggagcaccagaagaggaaatctacag
taacctccgaacaattccagacaccacagagcaaatggagtttaatatcagctcagctacccaggttggccatcagctgg
ccctgatcggggatgaatttaacaggacataccacagaaagcttgaagatacactgcttcatctggcacatggggttgct
atcagtgttttccagacatggaatattattaaaagtgttataagaagctttggaaatattttgaacaataactggacaaa
gaggatcattggttatggaagctggatttgcaggcttcctttcaggtgcgtctgccagaagctggtgcctgcagccttgc
ttgttattgccttttggtgggccatgaattacggactgcagaattaa
© 1998-2023Legal notice