Dataset for CDS BAX of Organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8RS99_BAX-01      atgtc-tgacagccgagacgaggagaaatcaccgggagagcaggaacctc
A0A3P8TFP0_BAX-01      atggcatcacacccgggaggaggcg-----accaaggaaatggcaa----
                       *** * * *** *** ** **** *     ***  *  *   * **    

A0A3P8RS99_BAX-01      agggcg--ccgtgggcggagaagatg--ttgtt-gatgatcccatcttgg
A0A3P8TFP0_BAX-01      agaacagctcgtggaagtaggagctgctttgttaaaggacttcatttttg
                       **  *    *****  * ** ** **  *****  * **   *** ** *

A0A3P8RS99_BAX-01      agcagggagcagtggtcctcagagggtatgtgattgaacgtataaacaca
A0A3P8TFP0_BAX-01      agc-gggttcagcggcatggagacggta--------aaactgtagtgaca
                       *** ***  *** **     *** ****        **  * **   ***

A0A3P8RS99_BAX-01      gaagaccctagtcggcacgtctcctctgaggatctgggaggaaggccgga
A0A3P8TFP0_BAX-01      aga-----------gcacagct-------gggt---ggaggagagctggt
                         *           ****  **       ** *   ******  ** ** 

A0A3P8RS99_BAX-01      tgaactacaggatccacaaattaaagaagtggtggatcag---cttctca
A0A3P8TFP0_BAX-01      tgaccca----agccat------aagaagc--tcggtcagtgcctgcagc
                       *** * *    * ***       ******   * * ****   ** *   

A0A3P8RS99_BAX-01      agatagctgatgaactgaacaggaacgctgagctccagcgacttatcaac
A0A3P8TFP0_BAX-01      agattggagatgagctggatggaaatgtggaactccagaggatgataaat
                       **** *  ***** *** *  * ** *  ** ****** *  * ** ** 

A0A3P8RS99_BAX-01      caggttcagggaaactgtgctcaggacatcttcatgaaggttgccaggag
A0A3P8TFP0_BAX-01      gattcctcactcagtcctacaaaagacgtgtttctgaaagttgctgttga
                        *          *    * *  * *** * **  **** *****      

A0A3P8RS99_BAX-01      catctttgctgatggaa---ttaactggggtcgagtggtggctctctttc
A0A3P8TFP0_BAX-01      gatcttttcagatggaaaatttaactggggcagggtggttgcgctgttct
                        ****** * *******   **********  * ***** ** ** **  

A0A3P8RS99_BAX-01      atctggcctacagacttatatacaaggctctgactaccaaccatttagag
A0A3P8TFP0_BAX-01      actttgcctgtcgactcgtcattaaggctcttgtaacccaagttcctgat
                       *  * ****   ****  *    ********    *** *   *   ** 

A0A3P8RS99_BAX-01      aacatcagaatggttatcagctgggttctccaagtcattagagagcagct
A0A3P8TFP0_BAX-01      atcatcagaaccattattcattggaccatggactacctccgggaacatgt
                       * ********   ****    ***    *  *   * *  * ** **  *

A0A3P8RS99_BAX-01      ctatgcctggcttgtgcagcagggaggctgggagggggtgatccgt----
A0A3P8TFP0_BAX-01      gatcaactggatcagggagcaaggtggctgggaggg---tattcgttccc
                             **** *   * **** ** ***********    ** ***    

A0A3P8RS99_BAX-01      -----agcttttctcgatggagggcagcagccatagtagcatcagtcgta
A0A3P8TFP0_BAX-01      acttcggcactcccacatggcagacagtgggagttttcttggcaggcgtt
                             **  * *   ****  * ***  *   *  *     *** *** 

A0A3P8RS99_BAX-01      ctggtggcaacttttgtttatctcaggaggacacgctga
A0A3P8TFP0_BAX-01      ctcaccactgttctcgtcattcgcaagatg------tga
                       **     *   * * **   ** ** ** *      ***

© 1998-2020Legal notice