Dataset for CDS BAX of Organism Chrysemys picta bellii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3HFY6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Chrysemys picta bellii GN=BAX (length=498 residues).
attggtggagctgggagagagccaaggactcctattgctgagccgggcagagctggggggccggagccccccccctgcga
cgagaacaccaagcggctcagcgagtgcctgcggcggatcggggacgagctcgacagcaacaccgaactgcagagtatga
ttgaccgggtgggggcccacgcccctaaggacgtcttcttccgcgtggccgccgagatgttctccgacgggaccttcaac
tggggccgggtcgtggcgcttttctactttgcctgcaagctggtgctcaaggctctgtgcaccaaggtccccgagctggt
gcggaccatcgtgggctggacgttggagtacctccgggatcatgtgctggcctggatccaggcccagggaggatgggatg
gcctcctctcctacttcggcacgcccacctggcaaaccatcaccatcttcgctgctggcgtgctcaccgcctccctcacc
atctggaagatgtcgtag
>gnl|bcl2dbcds|A0A8C3HFY6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Chrysemys picta bellii GN=BAX (length=507 residues).
catccgggaccgggcccagcgctgcggggactcccaggccgtggagctgagccgggcagagctggggggccggagccccc
cccctgcgacgagaacaccaagcggctcagcgagtgcctgcggcggatcggggacgagctcgacagcaacaccgaactgc
agagtatgattgaccgggtgggggcccacgcccctaaggacgtcttcttccgcgtggccgccgagatgttctccgacggg
accttcaactggggccgggtcgtggcgcttttctactttgcctgcaagctggtgctcaaggctctgtgcaccaaggtccc
cgagctggtgcggaccatcgtgggctggacgttggagtacctccgggatcatgtgctggcctggatccaggcccagggag
gatgggatggcctcctctcctacttcggcacgcccacctggcaaaccatcaccatcttcgctgctggcgtgctcaccgcc
tccctcaccatctggaagatgtcgtag
© 1998-2023Legal notice