Dataset for CDS BAK1 of Organism Athene cunicularia

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663MKT2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Athene cunicularia GN=BAK1 (length=654 residues).
atggcctcggggaacaacagtgacccaccaagggcccatggacgccagggaagcaacgggcgcaggctgtcacaagagct
caactcagaagaccaggtggcagaggagacggaggaggtgtttcggagttatgccttctaccgctaccaacaggagagag
aggagagaggggaggaaatgcccatggacccagagatcgcggagatccagcaggagctgggcagcaccgggagcctggtg
ggaaggcgcttggccatcatcggcgacgacattaacgagcggtacgacgcggagtttcgctacatgctgaagtccttgca
gcccaccaaggagaacgcctatgagtacttcaccagaatagcctccagcttgttcgagagtggcattaactggggccggg
tgattgcactgctgggctttggctaccgcatggccatccacgtctaccagcacggcataccgggtttcctccgccggatc
gcccggtacgtggcggaattcatgctccggaaccgcatcgcccagtggatcgcccagcagggaggatgggtggctgcact
cgagctggacaatgtttacatgaagtacatgctggtggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctaa
© 1998-2023Legal notice