Dataset for CDS BAX-like of Organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1I5B7_BAX-01      atgg-----------------------ctgacagccgag-----------
A0A3Q1I9F7_BOK-01      atggagatgttgcgccgctcctcagtgtttgcggctgaa---------gt
A0A7N6AK45_BOK-01      atggaagtcctgcggcggtcttctgtctttgccgcagaggtcctggatgt
                       ****                        *  * ** **            

A0A3Q1I5B7_BAX-01      -----aagaggagaagaaagacggagacgaggagcctcagg-----gcgc
A0A3Q1I9F7_BOK-01      gtttgaccgctcgcccaccgacaaggagttggtgtcccaggccaaagcgc
A0A7N6AK45_BOK-01      ctttgaccgatcgctgactgagaaagagctggtgtcccagtccaaagcct
                            *      *   *  **    **   ** * * ***      **  

A0A3Q1I5B7_BAX-01      cgtgggtggagaagatgttgtcgatgattccatcatggagcaagcagcag
A0A3Q1I9F7_BOK-01      tgtgcagggactacattcattcca-ggctgaaccgt-------------g
A0A7N6AK45_BOK-01      tgtgcagggactacatcctgtcca-gactcaaccag-------------a
                        ***   ***  * **    ** * *  *  * *                

A0A3Q1I5B7_BAX-01      tagtgctcagagggtttgtgattgagc--------gccttagcacagatg
A0A3Q1I9F7_BOK-01      ccgggataggctggtctaagcctgagcacggactggctgcatcaggtggg
A0A7N6AK45_BOK-01      acgggctgggatggtccaaaactgaactcaacctctccccatcaaatgca
                         * * *  *  ***       *** *         *   * **      

A0A3Q1I5B7_BAX-01      atcctggtcaacaagtgtcccctgagcaactggg--tggaaggccaaatg
A0A3Q1I9F7_BOK-01      gcactgggag--agatctcctctgtgctgctgtggctggggg-----atg
A0A7N6AK45_BOK-01      gctcttgctg--atgtgtctttggtgcttctctgtctgggcg-----acg
                          ** *     *  * **    * **  **  *  ***  *     * *

A0A3Q1I5B7_BAX-01      aacagcaggatccacagatcaaagacgtggtggaccagctgatcaagatt
A0A3Q1I9F7_BOK-01      agttggagtacctgc-------------------------gacccaacat
A0A7N6AK45_BOK-01      aactggagtgtatac-------------------------agcccagttt
                       *   * **      *                            * *   *

A0A3Q1I5B7_BAX-01      gcagaggaactgaacaggaacgccgaactccaacaactgatcaaccaggt
A0A3Q1I9F7_BOK-01      ttatcgtaacgtagcg--------------cgacagctcaacatccctgt
A0A7N6AK45_BOK-01      gtggaggaatgtggcg--------------cggcagctcaacatctctgt
                            * **     *               *  ** ** * ** *   **

A0A3Q1I5B7_BAX-01      tcaaagtaactgtgcacatgacgtc-------ttcatgaccgtagtcagg
A0A3Q1I9F7_BOK-01      g----gcgtccgagggcgtggtgtcagatgctttcctggctgtggcagca
A0A7N6AK45_BOK-01      t----gccatggagaacatggtttcagatgcttttatcggcgtggcaacg
                            *     * *  * **   **       **  *    ** *     

A0A3Q1I5B7_BAX-01      agcatctttgctgatggca------------------------------t
A0A3Q1I9F7_BOK-01      gacattttctccacaggtagctttattactcgtgtgtctttgccaggtgt
A0A7N6AK45_BOK-01      gaaatcttctcaacaggta------------------------------t
                          ** **  *    ** *                              *

A0A3Q1I5B7_BAX-01      caactggggtcgagtggtggctctcttccatctggcctacaggctcatac
A0A3Q1I9F7_BOK-01      gacgtggggaaaggtggtttctttgtacgccgtggc--aggggccttagc
A0A7N6AK45_BOK-01      aacatggggtaaggtggtgtccatgtatgcagtagc--tggagccctggc
                        *  *****    *****  *  * *      * **      **     *

A0A3Q1I5B7_BAX-01      acagggcactgaccaccaa--ccatctagacaacatcaggatggtcttta
A0A3Q1I9F7_BOK-01      agtggactgcgtccgccatggtcatccagctattgtccacaccatcgtcg
A0A7N6AK45_BOK-01      agtcgactgtgtcagacaaggacatccgtccacagttcacataatagtgg
                       *   * *   * *   **    ****     *   *    *   *  *  

A0A3Q1I5B7_BAX-01      actggttccttgaggtcatcagagagctgctctactcctggctcgtacag
A0A3Q1I9F7_BOK-01      actgtatgggagagtttgtccgcaagagtctgacctcctggttaaaaaag
A0A7N6AK45_BOK-01      acagtctgggacagtttgtccgtaggttcctggttccctggctgaagaga
                       ** *  *     ** *  ** *   *   **     ***** *       

A0A3Q1I5B7_BAX-01      caaggaggctgggtgggggt-----gatccgtgg----------------
A0A3Q1I9F7_BOK-01      agagggggctgggtggatttaacaaaatgtgtggtgaacactgatcccag
A0A7N6AK45_BOK-01      cgaggaggatgggcagagatctcaaaatgcgtggtgaagaaggatctcag
                         *** ** ****  *   *      **  ****                

A0A3Q1I5B7_BAX-01      ------cttctcccggtggaggacagtagccatagcagcatcagtaatat
A0A3Q1I9F7_BOK-01      cttctgctctcactggctggtgtccgctgcctttg---cctttggatatt
A0A7N6AK45_BOK-01      tcctgaacaccactggt---tgtcctctgtcatcgagtcgctgaagtact
                                   * **     * *    * * * *   *          *

A0A3Q1I5B7_BAX-01      tagtggcgacc-------tttgtttactacaggaagacacgctga
A0A3Q1I9F7_BOK-01      atctgaaggccatcgtgttacacctac-tcagagagaag---tga
A0A7N6AK45_BOK-01      tcctca---ccacgatg-tacgtctgcatcatgaaggaaccctga
                          *     **       *     * *  **   **      ***

© 1998-2023Legal notice