Dataset for CDS BAX-like of Organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

R9Y0N7_BAX-01          atgg----------------------catcatacccggg-----------
A0A3Q1I5B7_BAX-02      atgg-----------------------ctgacagccgag-----------
A0A3Q1I5B7_BAX-01      atgg-----------------------ctgacagccgag-----------
A0A3Q1I4R6_BOK-01      atggaagtcctgcggcggtcttctgtctttgccgcagaggtcctggatgt
A0A3Q1I9F7_BOK-01      atggagatgttgcgccgctcctcagtgtttgcggctgaa---------gt
                       ****                        *     * *             

R9Y0N7_BAX-01          -----aggaggcgatcaaggaaataccaaagatcagatactggaagtagg
A0A3Q1I5B7_BAX-02      -----aagaggagaagaaaga-----cggagacgaggagcctcagggc--
A0A3Q1I5B7_BAX-01      -----aagaggagaagaaaga-----cggagacgaggagcctcagggc--
A0A3Q1I4R6_BOK-01      ctttgaccgatcgctgactga-----gaaagagctggtgtcccagtccaa
A0A3Q1I9F7_BOK-01      gtttgaccgctcgcccaccga-----caaggagttggtgtcccaggccaa
                            *      *   *  **         **   *       *      

R9Y0N7_BAX-01          atgtgttttgttaaaggatttcat--------------------------
A0A3Q1I5B7_BAX-02      ----gccgtgggtggagaaggtat--------------------------
A0A3Q1I5B7_BAX-01      ----gccgtgggtggagaagatgttgtcgatgattccatcatggagcaag
A0A3Q1I4R6_BOK-01      a---gccttgtgcagggactacat------cctgtccagactcaaccaga
A0A3Q1I9F7_BOK-01      a---gcgctgtgcagggactacat------tcattccaggctgaaccgtg
                           *   **      **     *                          

R9Y0N7_BAX-01          ---------------------ctatgagcgaattcaga---ggcatggag
A0A3Q1I5B7_BAX-02      -------------------gtttgtgattgagc--------gccttagca
A0A3Q1I5B7_BAX-01      cagcagtagtgctcagagggtttgtgattgagc--------gccttagca
A0A3Q1I4R6_BOK-01      acgggctgg------gatggtccaaaactgaactcaacctctccccatca
A0A3Q1I9F7_BOK-01      ccgggatag------gctggtctaagcctgagcacggactggctgcatca

R9Y0N7_BAX-01          atgccagtactg------cagtgaccagggcacagctagg--tggagg--
A0A3Q1I5B7_BAX-02      cagatgatcctggtcaacaagtgtcccctgagcaactggg--tggaaggc
A0A3Q1I5B7_BAX-01      cagatgatcctggtcaacaagtgtcccctgagcaactggg--tggaaggc
A0A3Q1I4R6_BOK-01      aatgcagctcttgctg--atgtgtctttggtgcttctctgtctgggcg--
A0A3Q1I9F7_BOK-01      ggtggggcactgggag--agatctcctctgtgctgctgtggctggggg--
                                **          *  *    *  *  **  *  ***  *  

R9Y0N7_BAX-01          ----agagctgtgtgacccaaaccacaagaagcttgcccagtgtctgcag
A0A3Q1I5B7_BAX-02      caaatgaacagcaggatccacagatcaaagacgtggtggaccagctgatc
A0A3Q1I5B7_BAX-01      caaatgaacagcaggatccacagatcaaagacgtggtggaccagctgatc
A0A3Q1I4R6_BOK-01      ---acgaactggagtgtatac-------------------------agcc
A0A3Q1I9F7_BOK-01      ---atgagttggagtacctgc-------------------------gacc
                            **   *                                       

R9Y0N7_BAX-01          cagattggagatgagctggatgcaaatgtagatctccaaaggatgataaa
A0A3Q1I5B7_BAX-02      aagattgcagaggaactgaacaggaacgccgaactccaacaactgatca-
A0A3Q1I5B7_BAX-01      aagattgcagaggaactgaacaggaacgccgaactccaacaactgatca-
A0A3Q1I4R6_BOK-01      cagtttgtggaggaatgtggcg--------------cggcagctcaaca-
A0A3Q1I9F7_BOK-01      caacatttatcgtaacgtagcg--------------cgacagctcaaca-
                        *   *       *                      *      * *  * 

R9Y0N7_BAX-01          tgactcttcactcagtcccacaaaagacata------------tttatga
A0A3Q1I5B7_BAX-02      ----accaggttcaaagtaactgtgcacatgacgtc-------ttcatga
A0A3Q1I5B7_BAX-01      ----accaggttcaaagtaactgtgcacatgacgtc-------ttcatga
A0A3Q1I4R6_BOK-01      ----tctctgtt----gccatggagaacatggtttcagatgcttttatcg
A0A3Q1I9F7_BOK-01      ----tccctgtg----gcgtccgagggcgtggtgtcagatgctttcctgg
                            *                     * *             **  *  

R9Y0N7_BAX-01          aagtcgccttagagatcttctcagatggaaaattcaactggggcagagtg
A0A3Q1I5B7_BAX-02      ccgtagtcaggagcatctttgctgatggca---tcaactggggtcgagtg
A0A3Q1I5B7_BAX-01      ccgtagtcaggagcatctttgctgatggca---tcaactggggtcgagtg
A0A3Q1I4R6_BOK-01      gcgtggcaacggaaatcttctcaacaggta---taacatggggtaaggtg
A0A3Q1I9F7_BOK-01      ctgtggcagcagacattttctccacaggtg---tgacgtggggaaaggtg
                         ** *        ** **  *    **     * *  *****    ***

R9Y0N7_BAX-01          gttgctctattctactttgcctgtcgacttgtcatcaaagctgttgtgac
A0A3Q1I5B7_BAX-02      gtggctctcttccatctggcctacaggctcatacacagggcactgaccac
A0A3Q1I5B7_BAX-01      gtggctctcttccatctggcctacaggctcatacacagggcactgaccac
A0A3Q1I4R6_BOK-01      gtgtccatgtatgcagtagc--tggagccctggcagtcgactgtgtcaga
A0A3Q1I9F7_BOK-01      gtttctttgtacgccgtggc--aggggccttagcagtggactgcgtccgc
                       **  *  * *      * **       *            *         

R9Y0N7_BAX-01          ccaggt--tcctgatatcatcagaaccattatcagttggaccatggatta
A0A3Q1I5B7_BAX-02      caa--ccatctagacaacatcaggatggtctttaactggttccttgaggt
A0A3Q1I5B7_BAX-01      caa--ccatctagacaacatcaggatggtctttaactggttccttgaggt
A0A3Q1I4R6_BOK-01      caaggacatccgtccacagttcacataatagtggacagtctgggacagtt
A0A3Q1I9F7_BOK-01      catggtcatccagctattgtccacaccatcgtcgactgtatgggagagtt
                       *       **     *   *    *   *  *     *        *   

R9Y0N7_BAX-01          cctccgggaacatgtgataaactggatcagggagcaaggtggctgggagg
A0A3Q1I5B7_BAX-02      catcagagagctgctctactcctggctcgtacagcaaggaggctgggtgg
A0A3Q1I5B7_BAX-01      catcagagagctgctctactcctggctcgtacagcaaggaggctgggtgg
A0A3Q1I4R6_BOK-01      tgtccgtaggttcctggttccctggctgaagagacgaggaggatgggcag
A0A3Q1I9F7_BOK-01      tgtccgcaagagtctgacctcctggttaaaaaagagagggggctgggtgg
                         ** *        *      **** *         *** ** ****  *

R9Y0N7_BAX-01          gtat---------------------tcgttcctactttggcacacccaca
A0A3Q1I5B7_BAX-02      gggt-----gatccgtgg----------------------cttctcc---
A0A3Q1I5B7_BAX-01      gggt-----gatccgtgg----------------------cttctcc---
A0A3Q1I4R6_BOK-01      agatctcaaaatgcgtggtgaagaaggatctcagtcctgaacaccac---
A0A3Q1I9F7_BOK-01      atttaacaaaatgtgtggtgaacactgatcccagcttctgctctcac---
                          *                                          *   

R9Y0N7_BAX-01          tggcagacggtgggggttttcttggc--tggtgttctca-------ccac
A0A3Q1I5B7_BAX-02      cggtggaggacagtagccatagcagcatcagtaatattagtggcgacc--
A0A3Q1I5B7_BAX-01      cggtggaggacagtagccatagcagcatcagtaatattagtggcgacc--
A0A3Q1I4R6_BOK-01      tggt---tgtcctctgtcatcgagtcgctgaagtacttcctca---ccac
A0A3Q1I9F7_BOK-01      tggctggtgtccgctgcctttg---cctttggatattatctgaaggccat
                        **     *      *   *     *          *         **  

R9Y0N7_BAX-01          tgtt-ctcgtcattcgcaagatg------tga
A0A3Q1I5B7_BAX-02      -----tttgtttactacaggaagacacgctga
A0A3Q1I5B7_BAX-01      -----tttgtttactacaggaagacacgctga
A0A3Q1I4R6_BOK-01      gatg-tacgtctgcatcatgaaggaaccctga
A0A3Q1I9F7_BOK-01      cgtgttacacctac-tcagagagaag---tga
                                       **    *      ***

© 1998-2020Legal notice