Dataset for CDS BCL-2-like of organism Moschus moschiferus

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C6CUC2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgatccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagttgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcgac
tggctgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtgaccgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A8C6CUJ2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Moschus moschiferus GN=BCL-2 (length=687 residues).
atggcgcacgcggcgggcacaggctacgataaccgcgagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggacgccggggacgcgggcgccgcgccccccggggccgcccccgcgccgggcaccctgtccgccgcgccgg
gccgcgcgcccgcgcccgccaggacctccccgccgccgccggccgccgccgccgggcccgcgcccagcccggtgccacct
gtggtccacctgaccctgcgccaggccggcgacgacttctcccggcgctaccgccgcgacttcgccgagatgtccagcca
gctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggcgtgaactggg
ggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggac
agcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgcctt
tgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctggccc
tggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C6DX24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagaaaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcctggcacctggcggatagccctgcggtgaatggagccactggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggtgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaacgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgcttggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggttgcggggaaggaggccgcggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgggcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctcccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccggcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctccg
ggaacaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccgga
aggcgttggagaccctgcgccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6FJ57_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L10 (length=558 residues).
atggtggacccgtttagggagcgcaccgcccggctgctgctggactacctggagttctgcgcccgggagcccggcgcgcc
agcccctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcccgtgtccaggaagcaaatcgaaacgtct
tgcccctctaccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccct
ggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctagagaggcctccgcagacgacccgacg
gctggagaagagagacgacggcggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaa
ggcaccgcgcctggctgctggcgaacggcggctgggatggattttgtctctccttcagccactcattgcagccatcttgg
gaaagacagctggtctggtttttcttctcatactggacagcaataatcataatctacttctggataaaattatcatga
>gnl|bcl2dbcds|A0A8C6FN58_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=738 residues).
atgtctcagagcaactgggaactagtggttgactttctctcttacaagctttcccagaaaggatacatctggagtcagtt
tagtgatatggaagagaacagaactgagaccacagaagggacagaatcagatatggaaaccctaaaagccatcaatggca
acccatcctggcacctagcagatagccctgcagtgaagggagccactggccacagcagaagcttggacgcccggaaaatg
atccctgtgacaacagtaaagcaagccctggggcaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtaataaatgaactcctccgggacg
gggtgagctggagtcgcattgtggcctttttctccttcggtggggcattatgcatgaaaagcatagacaaggagatgcag
gtattggtgagtcaggtcacaacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacacttttgtggaactctacgaaaacaatacagcaaccgagagccagaagggccaagagcgcttcagctgctggt
ccctgatggacatgactgtgtggtatggttctgctgggcttgcttttcaactcataataactattccttttgttatagtc
attcaaattttatactag
>gnl|bcl2dbcds|A0A8C6MJ03_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2A1 (length=621 residues).
atgtttcgccaggctccacaagcttgtgcttcagactgtcttggtcagttgcaggtgagcaggctcaagactctgctccc
cagcaaggagaagatgactgagactgagtttggctacgttcacaggctggccgaggactatctgaaatatgtgttgcaga
tacagcaaactggatccaggccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccagaacgaagtggaa
aggactttgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatgga
aaaggaatttgaagatggcgttgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttatcaagaaac
ttcagggcaagtgtattgccccagacatggacatgtgcaaggacatttcttactttgtggcagagttcatcaccgaaaac
acaggagagtggataaggcaaaatggaggctgggaaaatggttttgtaaagaagtttgaaatcaaatctggctggctgac
ttttctggaagttacaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
© 1998-2022Legal notice