Dataset for CDS BOK of Organism Denticeps clupeoides

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4CYU4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Denticeps clupeoides GN=BOK (length=651 residues).
atgaatggcatggaggtgctgcgccgctcctcggtattcgctgcagaggtcatggaggtctttgatcgctcccccacgga
caaggagctggtgtctcaagccaaagccctgtgcagagactacatacattcgcgcctgatccgggctgggatcggctggt
ctaaacctgaacacgggttctccgctgccggcgtagctcttgcagaggtgtcctcggtgctcatttggttaggcgacgag
ctggagtacctgcgacccaacgtctatcgcaacgtggcgcggcagctgaacatccccgtggcttccgagagcgtggtttc
ggacgccttcctggcggtggcggctgaaattttctccactggagtcacttggggcaaggtagtctccttgtatgcagtag
cgggggctctggcggtggactgtgtccggcacggccaccccgccatggtgctcaccatcatagactgcatgggcgagttc
gtccgcaaaagcctggtctcctggctgaagaggaggggtggatggactgatataacaaaatgtgtggtgaacaccgaccc
gagcttccgctctcattggctggtctctgctgcctgcacctgtggtcactacctgaaagctgtggtcttctacctactga
gggagaaatga
© 1998-2023Legal notice