Dataset for CDS BCL-2-like of organism Xiphophorus maculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B5PQJ0_BCL2L1-      atg--------tcac---gaaacagagaactggtgcttttctac------
M4A558_BCL2L1-01        atg--------gcctacagcaacagagaactggtggagttctac------
M4AUW7_BCL2L10-01       atg--------------------------------------tcct-----
A0A3B5PQ55_MCL1-01      atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaa
A0A3B5PQ55_MCL1-02      atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaa
                        ***                                      * *      

A0A3B5PQJ0_BCL2L1-      ----attaagtttaaac-------------------------tgtctcag
M4A558_BCL2L1-01        ----ataagctacaaat-------------------------tgtctcag
M4AUW7_BCL2L10-01       ----gtgggctgtggaaaga--------gaccgtg-----gttgttgcag
A0A3B5PQ55_MCL1-01      tggagtcgggaatggacaaacacactacgaccagggactcggtgtgcctg
A0A3B5PQ55_MCL1-02      tggagtcgggaatggacaaacacactacgaccagggactcggtgtgcctg
                             *         *                          ***  * *

A0A3B5PQJ0_BCL2L1-      agga--------------actatccgatccaacacatattgcccaacgag
M4A558_BCL2L1-01        agaa--------------actattcaagctctctgctgaggtccgaggtt
M4AUW7_BCL2L10-01       aggattacatccgcctgcgctgctcaagcc--c-----acaccca---gc
A0A3B5PQ55_MCL1-01      agg-tcgcaatgggctccactgtagaatct--cttcattcgcctaaggat
A0A3B5PQ55_MCL1-02      agg-tcgcaatgggctccactgtagaatct--cttcattcgcctaaggat
                        **                 **     * *   *         *       

A0A3B5PQJ0_BCL2L1-      ccc--ccggacggcacc-------------gctgccggggacgtggggat
M4A558_BCL2L1-01        gcc--gggggcaggaccaattgggaaggggacagccgggtccctagcaat
M4AUW7_BCL2L10-01       ccctcca-------------------------------------------
A0A3B5PQ55_MCL1-01      cccttcatgaaacgcccgacgaatctcggagtgaatggatatgttgcgaa
A0A3B5PQ55_MCL1-02      cccttcatgaaacgcccgacgaatctcggagtgaatggatatgttgcgaa

A0A3B5PQJ0_BCL2L1-      gg-----acgacgagc--agacgttagagacacacgctaatgggactttt
M4A558_BCL2L1-01        gg-----ccggctggt--caacagccgggccgggccc-------------
M4AUW7_BCL2L10-01       ---cctcccagcgagc--cggccgccgccatga-----------------
A0A3B5PQ55_MCL1-01      aagccttccgacgagcagcgacgacagcgacgaaggctctctgccatgca
A0A3B5PQ55_MCL1-02      aagccttccgacgagcagcgacgacagcgacgaaggctctctgccatgca
                                *  *  *      *    *                       

A0A3B5PQJ0_BCL2L1-      aacgggacgagtccaggatcccctaggcggcaccaggcggcgtcggcgtc
M4A558_BCL2L1-01        --ccggggaagcccaggggcccaatggc---------cggtgttgaggtc
M4AUW7_BCL2L10-01       ----g-----gcgcctggcccag---------------gacgtggaggc-
A0A3B5PQ55_MCL1-01      ccccg-----gcgcagcacccagacagtgaaaa----agacgcgacggcc
A0A3B5PQ55_MCL1-02      ccccg-----gcgcagcacccagacagtgaaaa----agacgcgacggcc
                            *     *  *     **                 *  *     *  

A0A3B5PQJ0_BCL2L1-      aacgatggacgcggtgaaagtggccctgcgcgacacggcccgtgagtttg
M4A558_BCL2L1-01        -------------gtcaaatcagttctgaaggacgcggcggaggagtttg
M4AUW7_BCL2L10-01       -------caagc-acca----ggctcgctttcactccctggcccag----
A0A3B5PQ55_MCL1-01      gtaggtgcgagcaacca----agtgctggataacgacacaacggagctta
A0A3B5PQ55_MCL1-02      gtaggtgcgagcaacca----agtgctggataacgacacaacggagctta
                                        *     *  *      **          **    

A0A3B5PQJ0_BCL2L1-      agctgcgctactcccgcgccttcaacgacct-tcacagcacgctgcacat
M4A558_BCL2L1-01        agcgcctctacacccaaagctttaaacacctctccttgca-gctggacat
M4AUW7_BCL2L10-01       -----ggcttcctgaagcactgc-----------------------gggt
A0A3B5PQ55_MCL1-01      ttagcagttttctgagagactttacgggactttcaaagtgtcggtggggt
A0A3B5PQ55_MCL1-02      ttagcagttttctgagagactttacgggactttcaaagtgtcggtggggt
                                *          **                            *

A0A3B5PQJ0_BCL2L1-      cacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgt
M4A558_BCL2L1-01        cacccccgacacggcctaccacagcttcaagaccgtgctggacgagttgt
M4AUW7_BCL2L10-01       cggacct--------ctgctccaacctcagaaaggtgatggatgagatgg
A0A3B5PQ55_MCL1-01      caaaata--------aagctctatctac--------gatgaaaagggtgg
A0A3B5PQ55_MCL1-02      caaaata--------aagctctatctac--------gatgaaaagggtgg
                        *                 *   * *  *        * ** *   * ** 

A0A3B5PQJ0_BCL2L1-      tccgggacgg---cgtcaactgggg---------------ccgcatcgtg
M4A558_BCL2L1-01        tcaagggcgg---ggtcaactgggg---------------gcgggtggtg
M4AUW7_BCL2L10-01       tgggggacggacactttaactgggg---------------gagggtggtg
A0A3B5PQ55_MCL1-01      tggaggac-----cttttgtcgaagcacaagtatgcatacaatggtatgg
A0A3B5PQ55_MCL1-02      tggaggac-----cttttgtcgaagcacaagtatgcatacaatggtatgg
                        *   ** *       *     *  *                    *   *

A0A3B5PQJ0_BCL2L1-      gggctc--ttcgcgtttggtggcgcgctg----tgcgtggagtgcgtgga
M4A558_BCL2L1-01        gccatg--tttaccttcggggggattctg----tgtgtggactgcgtcca
M4AUW7_BCL2L10-01       tccctc--ttcgccttcgccggcgtgctggccagaca--------gctgc
A0A3B5PQ55_MCL1-01      tcaataggcttgctctggataacgagccggac-gacatggagtttgttac
A0A3B5PQ55_MCL1-02      tcaataggcttgctctggataacgagccggac-gacatggagtttgttac
                            *    *  *  * *        * *                *    

A0A3B5PQJ0_BCL2L1-      gaagg-------------------agatgag-------------------
M4A558_BCL2L1-01        gaaga-------------------atatgag-------------------
M4AUW7_BCL2L10-01       gggaa------------------cagacggg-caagaacccggtgccgga
A0A3B5PQ55_MCL1-01      ggaaatagcagagagtctcttttcagacgggatcaccaactggggtcgga
A0A3B5PQ55_MCL1-02      ggaaatagcagagagtctcttttcagacgggatcaccaactggggtcgga
                        *                       * * * *                   

A0A3B5PQJ0_BCL2L1-      -------ccacctggtagccaggattgtagag------------------
M4A558_BCL2L1-01        -------tgagctggtctcccgcattgccgaa------------------
M4AUW7_BCL2L10-01       ct-----ccgggaagcagcaggaactgcaaca----agagcccgtaag--
A0A3B5PQ55_MCL1-01      tcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggag
A0A3B5PQ55_MCL1-02      tcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggag
                                             *   **                       

A0A3B5PQJ0_BCL2L1-      ---------------------------------tggatgaccgt------
M4A558_BCL2L1-01        ---------------------------------tggatgaccac------
M4AUW7_BCL2L10-01       --------------ctgccgggcgctgg-----cgga-gaccat-tgctg
A0A3B5PQ55_MCL1-01      aggggcagagagcactgcgtggagctggtgagccgga-aaatatccacgt
A0A3B5PQ55_MCL1-02      aggggcagagagcactgcgtggagctggtgagccgga-aaatatccacgt
                                                          ***  *          

A0A3B5PQJ0_BCL2L1-      -ctacctggatgagcagattgaaccttgggtagaaagccaaggaggatgg
M4A558_BCL2L1-01        -ttacctggatgagcagctcagtccctggatccagagccagggaggatgg
M4AUW7_BCL2L10-01       attacctggagaagcacaaaaaggactggctacaggaaaataatggatgg
A0A3B5PQ55_MCL1-01      atctcctggcaa---accagcgggactggctagcaaaaaacaactcatgg
A0A3B5PQ55_MCL1-02      atctcctggcaa---accagcgggactggctagcaaaaaacaactcatgg
                            *****      *          *** *        *      ****

A0A3B5PQJ0_BCL2L1-      gagcgcttcgctgagatcttcgggggcaacgcggcggcagagagcagaag
M4A558_BCL2L1-01        gaccgctttgctaacctgtacggccaggacgccgctgcagagggccggag
M4AUW7_BCL2L10-01       gaagggttt-tgtagctatgc-------ccgcaacgccagagaagcaag-
A0A3B5PQ55_MCL1-01      gagggctttgtggagtt-----------------ctttagagtatcgga-
A0A3B5PQ55_MCL1-02      gagggctttgtggagtt-----------------ctttagagtatcgga-
                        **  * **     *  *                 *   ****        

A0A3B5PQJ0_BCL2L1-      atctcaggagagcttcaaaaactggctgctgctggggatgagcgtggtga
M4A558_BCL2L1-01        gtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctga
M4AUW7_BCL2L10-01       ---tcaggactcctccatgaagacggcgctggttgctgtcgccggggtcg
A0A3B5PQ55_MCL1-01      ---cccggagtctacagtgaggaacacgctgatggctgttgtgggggtcg
A0A3B5PQ55_MCL1-02      ---cccggagtctacagtgaggaacacgctgatggctgttgtgggggtcg
                            * ***          *       ***  * *   *      * *  

A0A3B5PQJ0_BCL2L1-      c---ggccttcatagccgggtccatcttcgcccagaagcg---------c
M4A558_BCL2L1-01        ccggagctctgctcgtcgtgt---tcgtcgctaagaaacg----------
M4AUW7_BCL2L10-01       gcatcgctggactcacctt---cctcctggt------------------g
A0A3B5PQ55_MCL1-01      ctggtattggggccaccttagcctttcttatcaggagatgcaaagagaag
A0A3B5PQ55_MCL1-02      ctggtattggggccaccttagcctttcttatcag---------------c
                                        *       *  *                      

A0A3B5PQJ0_BCL2L1-      ctgtga
M4A558_BCL2L1-01        --atga
M4AUW7_BCL2L10-01       cgctag
A0A3B5PQ55_MCL1-01      tattga
A0A3B5PQ55_MCL1-02      ttctga

© 1998-2020Legal notice