Dataset for CDS BCL2L2 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q45T69_BCL2L2-01      atggc---gaccccagcctcagccccagacacacgggctctagtggcaga
Q45T69_BCL2L2-02      atggc---gaccccagcctcagccccagacacacgggctctagtggcaga
Q45T69_BCL2L2-03      atggc---gaccccagcctcagccccagacacacgggctctagtggcaga
Q45T69_BCL2L2-04      atggc-----tggaagccttgccgtccgttgcgggg--------------
Q45T69_BCL2L2-05      atggcggcggcggcggcggcggcagcagcagcgggggct------gcggg
                      *****          **     *  * *   *  **              

Q45T69_BCL2L2-01      ctttgtaggctataagctgaggcagaagggttat------------gttt
Q45T69_BCL2L2-02      ctttgtaggctataagctgaggcagaagggttat------------gttt
Q45T69_BCL2L2-03      ctttgtaggctataagctgaggcagaagggttat------------gttt
Q45T69_BCL2L2-04      ----caaggttc----------------------------------acct
Q45T69_BCL2L2-05      cggtcggggctccgggccggggcggcggcgccatcttgtgcccggggccg
                             ** *                                       

Q45T69_BCL2L2-01      gtggagctggccctggagagggcccagcagctgatccactgcaccaagcc
Q45T69_BCL2L2-02      gtggagctggccctggagagggcccagcagctgatccactgcaccaagcc
Q45T69_BCL2L2-03      gtggagctggccctggagagggcccagcagctgatccactgcaccaagcc
Q45T69_BCL2L2-04      gtcacga-aac--ggatgttagcccttcga-------atctcacgagcc-
Q45T69_BCL2L2-05      gtgggga-ggccggggagggggccccgggg-------ggcgcaggggact
                      **   *    *   *  *   ****                **     * 

Q45T69_BCL2L2-01      atgcgggcagctggagatgagtttgagacccgcttccggcgcaccttctc
Q45T69_BCL2L2-02      atgcgggcagctggagatgagtttgagacccgcttccggcgcaccttctc
Q45T69_BCL2L2-03      atgcgggcagctggagatgagtttgagacccgcttccggcgcaccttctc
Q45T69_BCL2L2-04      --------------------------------------------------
Q45T69_BCL2L2-05      acgggaacggcctg----gagtctgag-----------------------
                                                                        

Q45T69_BCL2L2-01      tgatttggcagcccag----ctgcatgtg--------accccaggctcag
Q45T69_BCL2L2-02      tgatttggcagcccag----ctgcatgtg--------accccaggctcag
Q45T69_BCL2L2-03      tgatttggcagcccag----ctgcatgtg--------accccaggctcag
Q45T69_BCL2L2-04      --aatcggcatccgagagggctattgctg---------------------
Q45T69_BCL2L2-05      -gaactggagcctgag-gagctgctgctggagcccgagccggagcccgag
                        *   **   *  **    **     **                     

Q45T69_BCL2L2-01      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
Q45T69_BCL2L2-02      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
Q45T69_BCL2L2-03      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
Q45T69_BCL2L2-04      --cgaggc-gatc----------------------------ggaagat--
Q45T69_BCL2L2-05      ctcgaggaggatccgccccgggccccg-----cgcctcccgggaagtt--
                        *      * *                             **  *    

Q45T69_BCL2L2-01      aactggggccgtcttgtggccttctttgtctttggagctgcactgtgtgc
Q45T69_BCL2L2-02      aactggggccgtcttgtggccttctttgtctttggagctgcactgtgtgc
Q45T69_BCL2L2-03      aactggggccgtcttgtggccttctttgtctttggagctgcactgtgtgc
Q45T69_BCL2L2-04      --------tggccttgtctcc-----tcgccctag-----c---------
Q45T69_BCL2L2-05      --------cgggcccgtggcc-----tggctcgggagcccc---------
                                * *  **  **     *  *    *     *         

Q45T69_BCL2L2-01      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
Q45T69_BCL2L2-02      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
Q45T69_BCL2L2-03      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
Q45T69_BCL2L2-04      ------cagcggccaa------------------------------tcac
Q45T69_BCL2L2-05      ------cggcagccaggaggaggaggaggagccgggac--------tggt
                               *  * *                                   

Q45T69_BCL2L2-01      ggatggtggcctacctggagacacggctggccgactggatccacagcagt
Q45T69_BCL2L2-02      ggatggtggcctacctggagacacggctggccgactggatccacagcagt
Q45T69_BCL2L2-03      ggatggtggcctacctggagacacggctggccgactggatccacagcagt
Q45T69_BCL2L2-04      cgagcgtcatatactcgc------------------ggatccgcct----
Q45T69_BCL2L2-05      cgagggt----gacccgg------------------gggacggcgccatt
                       **  **     **  *                   **  *  *      

Q45T69_BCL2L2-01      gggggctgggcg------gagttcacagctctatacgggga---------
Q45T69_BCL2L2-02      gggggctgggagctggaagcgatcaaagctcgagtcagggagatggagga
Q45T69_BCL2L2-03      gggggctgggagctggaagcgatcaaagctcgagtcagggagatggagga
Q45T69_BCL2L2-04      --gga---ggagctggaagcgatcaaagctcgagtcagggagatggagga
Q45T69_BCL2L2-05      gaggacccggagctggaagcgatcaaagctcgagtcagggagatggagga
                        **    ** *      * * *** ***** *  * ****         

Q45T69_BCL2L2-01      ------cggggccctggaggaggcgcggcgtctgcgggaggggaac----
Q45T69_BCL2L2-02      agaagctgagaagttaaaggagctacagaa--cgaggtagagaaacagat
Q45T69_BCL2L2-03      agaagctgagaagttaaaggagctacagaa--cgaggtagagaaacagat
Q45T69_BCL2L2-04      agaagctgagaagttaaaggagctacagaa--cgaggtagagaaacagat
Q45T69_BCL2L2-05      agaagctgagaagttaaaggagctacagaa--cgaggtagagaaacagat
                             * *    *  *****   * *     * ** ** * ***    

Q45T69_BCL2L2-01      -----tgggcctcagtgaggacagtgctgac-------------------
Q45T69_BCL2L2-02      gaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
Q45T69_BCL2L2-03      gaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
Q45T69_BCL2L2-04      gaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
Q45T69_BCL2L2-05      gaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
                           ** * *    *   * ** ***** *                   

Q45T69_BCL2L2-01      ----------gggggccg-------------------tggcactgggggc
Q45T69_BCL2L2-02      aagagaagatggaggctgatgcccgttccatttatgttggcaatgtggac
Q45T69_BCL2L2-03      aagagaagatggaggctgatgcccgttccatttatgttggcaatgtggac
Q45T69_BCL2L2-04      aagagaagatggaggctgatgcccgttccatttatgttggcaatgtggac
Q45T69_BCL2L2-05      aagagaagatggaggctgatgcccgttccatttatgttggcaatgtggac
                                ** *** *                   ***** ** ** *

Q45T69_BCL2L2-01      cctggt--------------------------------------------
Q45T69_BCL2L2-02      tatggtgcaacagcagaagagttggaagcacactttcatggctgtggttc
Q45T69_BCL2L2-03      tatggtgcaacagcagaagagttggaagcacactttcatggctgtggttc
Q45T69_BCL2L2-04      tatggtgcaacagcagaagagttggaagcacactttcatggctgtggttc
Q45T69_BCL2L2-05      tatggtgcaacagcagaagagttggaagcacactttcatggctgtggttc
                        ****                                            

Q45T69_BCL2L2-01      ----caccg------------------------taggggcctt-------
Q45T69_BCL2L2-02      agtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
Q45T69_BCL2L2-03      agtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
Q45T69_BCL2L2-04      agtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
Q45T69_BCL2L2-05      agtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
                           ****                        *** **** *       

Q45T69_BCL2L2-01      -ttttgc----------------------gagcaagtga-----------
Q45T69_BCL2L2-02      gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttg
Q45T69_BCL2L2-03      gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttg
Q45T69_BCL2L2-04      gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttg
Q45T69_BCL2L2-05      gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttg
                       ******                      ***  *****           

Q45T69_BCL2L2-01      --------------------------------------------------
Q45T69_BCL2L2-02      gccttagatgagtcactatttagaggaagacaaatcaaggtgatcccaaa
Q45T69_BCL2L2-03      gccttagatgagtcactatttagaggaagacaaatcaaggtgatcccaaa
Q45T69_BCL2L2-04      gccttagatgagtcactatttagaggaagacaaatcaaggtgatcccaaa
Q45T69_BCL2L2-05      gccttagatgagtcactatttagaggaagacaaatcaaggtgatcccaaa
                                                                        

Q45T69_BCL2L2-01      --------------------------------------------------
Q45T69_BCL2L2-02      acgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgag
Q45T69_BCL2L2-03      acgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgag
Q45T69_BCL2L2-04      acgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgag
Q45T69_BCL2L2-05      acgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgag
                                                                        

Q45T69_BCL2L2-01      --------------------------------------------------
Q45T69_BCL2L2-02      cccgataccgtgcccggactaccaactacaacagctcccgctctcgattc
Q45T69_BCL2L2-03      cccgataccgtgcccggactaccaactacaacagctcccgctctcgattc
Q45T69_BCL2L2-04      cccgataccgtgcccggactaccaactacaacagctcccgctctcgattc
Q45T69_BCL2L2-05      cccgataccgtgcccggactaccaactacaacagctcccgctctcgattc
                                                                        

Q45T69_BCL2L2-01      --------------------------------------------------
Q45T69_BCL2L2-02      tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggc
Q45T69_BCL2L2-03      tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggc
Q45T69_BCL2L2-04      tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggc
Q45T69_BCL2L2-05      tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggc
                                                                        

Q45T69_BCL2L2-01      -------------------------------
Q45T69_BCL2L2-02      tagagcgacatcatggt------ttctgtag
Q45T69_BCL2L2-03      tagagcgacatcatggtattccccttactaa
Q45T69_BCL2L2-04      tagagcgacatcatggtattccccttactaa
Q45T69_BCL2L2-05      tagagcgacatcatggtattccccttactaa
                                                     

© 1998-2020Legal notice