Dataset for CDS BCL2L2 of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|Q45T69_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|Q45T69_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=996 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|Q45T69_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaag
agttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaa
ggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
gtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|Q45T69_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=765 residues).
atggctggaagccttgccgtccgttgcggggcaaggttcacctgtcacgaaacggatgttagcccttcgaatctcacgag
ccaatcggcatccgagagggctattgctgcgaggcgatcggaagattggccttgtctcctcgccctagccagcggccaat
caccgagcgtcatatactcgcggatccgcctggaggagctggaagcgatcaaagctcgagtcagggagatggaggaagaa
gctgagaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagt
gatcatgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcag
aagagttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcct
aaaggttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagagg
aagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgat
accgtgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtc
tacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|Q45T69_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagctcgaggaggatccgccccgggccccgcgcctc
ccgggaagttcgggcccgtggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagttaaaggagctacagaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaagatggaggctgatgcccgttccatttatgttggcaatgtggactatggtgcaacagcagaaga
gttggaagcacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcctaaag
gttttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgataccg
tgcccggactaccaactacaacagctcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2020Legal notice