Dataset for CDS MCL-1 of organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0CVU0_MCL1-01      atgctcggcctcaagagaaacacagtaatcggactcaaactctactg-gg
A0A8C0DF47_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgg
A0A8C0DF47_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgg
A0A8C0DF47_MCL1-03      atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgg
                        *** ***************** **************** ******** **

A0A8C0CVU0_MCL1-01      gggaaccggattgggacc--------------------------------
A0A8C0DF47_MCL1-02      gggggccggattggggccggatagcggcagcggcgcctccgctccaggaa
A0A8C0DF47_MCL1-01      gggggccggattggggccggatagcggcagcggcgcctccgctccaggaa
A0A8C0DF47_MCL1-03      gggggccggattggggccggatagcggcagcggcgcctccgctccaggaa
                        ***  ********** **                                

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtaggg
A0A8C0DF47_MCL1-01      ggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtaggg
A0A8C0DF47_MCL1-03      ggcggctttt----------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ggaggggaaaccggcgaggtgattggcggaagcgccggcccgagcccccc
A0A8C0DF47_MCL1-01      ggaggggaaaccggcgaggtgattggcggaagcgccggcccgagcccccc
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ggccactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattg
A0A8C0DF47_MCL1-01      ggccactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattg
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttc
A0A8C0DF47_MCL1-01      gcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttc
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggcctc
A0A8C0DF47_MCL1-01      gcgcccacccgccgcgcctcgccgcccgaagagatggaatcctcggcctc
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      cgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
A0A8C0DF47_MCL1-01      cgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgag
A0A8C0DF47_MCL1-01      ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgag
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      gccagtaacagccccggcaaggacggctcactcccctcgacgccgccccc
A0A8C0DF47_MCL1-01      gccagtaacagccccggcaaggacggctcactcccctcgacgccgccccc
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A8C0DF47_MCL1-01      agcagaggaggaggaggacgagttgtaccggcagtccctggagattatct
A0A8C0DF47_MCL1-03      --------------------------------------------------
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ctcgatacctccgggagcaggcaaccggcaccaaggacgcgaagccactg
A0A8C0DF47_MCL1-01      ctcgatacctccgggagcaggcaaccggcaccaaggacgcgaagccactg
A0A8C0DF47_MCL1-03      -------------------ggcaaccggcaccaaggacgcgaagccactg
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-02      ggcaggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A8C0DF47_MCL1-01      ggcaggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
A0A8C0DF47_MCL1-03      ggcaggtctggggccgccagccggaaggcgttagagaccctgcgacgggt
                                                                          

A0A8C0CVU0_MCL1-01      --------------------------agacggccttccaaggcatgcttc
A0A8C0DF47_MCL1-02      cggggacggtgtgcaacggaaccacgagacggccttccaa----------
A0A8C0DF47_MCL1-01      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc
A0A8C0DF47_MCL1-03      cggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttc
                                                  **************          

A0A8C0CVU0_MCL1-01      agaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
A0A8C0DF47_MCL1-03      ggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtg
                                                                          

A0A8C0CVU0_MCL1-01      atggtccatgttttcagtgacggagttacaaactggggcaggattgtgac
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
A0A8C0DF47_MCL1-03      atggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
                                                                          

A0A8C0CVU0_MCL1-01      tcttctttcttttggtgcctttgtggccaaacacttgaggagtataaacc
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
A0A8C0DF47_MCL1-03      tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaacc
                                                                          

A0A8C0CVU0_MCL1-01      aagaaatctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
A0A8C0DF47_MCL1-03      aagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgta
                                                                          

A0A8C0CVU0_MCL1-01      aggacaaaacaagactggctagtcaaacgaagaggctgggatgggttttt
A0A8C0DF47_MCL1-02      --------------------------------------ggatgggtttgt
A0A8C0DF47_MCL1-01      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
A0A8C0DF47_MCL1-03      aggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgt
                                                              ********** *

A0A8C0CVU0_MCL1-01      ggacttcttccatggagaggacctagcaaacggcctcagaaatgtgctgc
A0A8C0DF47_MCL1-02      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A8C0DF47_MCL1-01      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
A0A8C0DF47_MCL1-03      ggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgc
                        ************** *********** *  **** ***************

A0A8C0CVU0_MCL1-01      tggcttttgcaggtgttgctggagtaggagctggtttggcgtatctaata
A0A8C0DF47_MCL1-02      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
A0A8C0DF47_MCL1-01      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
A0A8C0DF47_MCL1-03      tggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaata
                        ******************* ******************************

A0A8C0CVU0_MCL1-01      cgatag--------
A0A8C0DF47_MCL1-02      agatagccttttaa
A0A8C0DF47_MCL1-01      agatag--------
A0A8C0DF47_MCL1-03      agatag--------
                         *****        

© 1998-2022Legal notice