Dataset for CDS MCL-1 of organism Balaenoptera musculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C0CVU0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=447 residues).
atgctcggcctcaagagaaacacagtaatcggactcaaactctactggggggaaccggattgggaccagacggccttcca
aggcatgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtg
acggagttacaaactggggcaggattgtgactcttctttcttttggtgcctttgtggccaaacacttgaggagtataaac
caagaaatctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacaagactggctagtcaaacg
aagaggctgggatgggtttttggacttcttccatggagaggacctagcaaacggcctcagaaatgtgctgctggcttttg
caggtgttgctggagtaggagctggtttggcgtatctaatacgatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=816 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggatgggtttgtggacttcttccatgtaga
ggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaa
taagatagccttttaa
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
© 1998-2022Legal notice