Dataset for CDS Unclassified of organism Scleropages formosus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9SKP6_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus (length=531 residues).
atgtcctgttggctgtcaaaggagaccttggtgttggcagaagattacttgcacttctgcactggcagtcagcagagccc
tcccaatgagtctgcagtggcgatgagacacttggccaaggagatggagcagcagtacaagtcaaaacttcaaccactcg
tgcaaacattccttgactcctgcggacctgaccatagtgcaagtcttagaaaagtgatggtagagcttgtaggagacgga
aagttaagctggggaagaattgtctctctctttgcttttaccggaatgctggtcaatgaactctgttcccaaggagaagg
caatgactgctgcaagagactggcggagactatagccgactaccttactgtggaaaagcgagagtggatgttgcagaatg
aaggctgggaaggattctgcaagttttcccgcagtgccagagaggtgaacaaagagtctgcaatgaagactgcacttttt
gctgctgctggtgtaggcattgcaggaataacttttctctttgtgcgttaa
>gnl|bcl2dbcds|A0A8C9TUD1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scleropages formosus (length=633 residues).
atgacgaccgggaccccctacagcagccgcctcgtcgtggacaactacatctgccagaagctgcgccggaggggcgtggc
gcgcgagctccacccacacctgtccaacggggacacgcccacccctagaaatggcttcccgccagggacccccggggcgg
cggaggcgcacgcggcgctgcgcagggtgctgcgcgaggccggggacctcatggagcgccgctacctgcacgaattcgcg
cacctgtcatcgcaggtgaacctgagcccgcggggggcgcgcggcaccttctccgccgtcgtcgaggagctcttcaggga
cgacgtcaactgggggcgcatcgtggccttcctcgagttcggcggggcgctctgcgtggagtgcgtgaaccgggacgcgc
cgcagcaggtggagtgcatcgcgagctggatgacggaatacctgaacggccccctgcagagctggatccaggagaacggc
ggatgggaggcctttgtggagctgtacgatggtcggactggctccgggtccaacggttcttggtccaacctgagggcggt
cttcagcttggcgggcttggctgcgttgggggctgtcggtgtcacggtcggggcctatttcgcccagaaatga
© 1998-2023Legal notice