Dataset for CDS BCL-2-like of organism Ictalurus punctatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5U9J4_BCL2L1-01        atgt-----------------------------------------cttac
A0A2D0RCW7_MCL1-02      --------------------------------------------------
A0A2D0RCW7_MCL1-03      atgtgcgcccaattgaatgcggaaaacgggaacctctctatgatgtttag
A0A2D0RCW7_MCL1-01      ---------------------------------------------ttggg
                                                                          

W5U9J4_BCL2L1-01        tacaacaga--------------------------gaactggtggtgtac
A0A2D0RCW7_MCL1-02      ----atgga-------------------aactgcacagctgg----ttaa
A0A2D0RCW7_MCL1-03      cccaaaggatttgtctctaaccgtgcctaacgtttcatctgg----gta-
A0A2D0RCW7_MCL1-01      cccaaaggatttgtctctaaccgtgcctaacgtttcatctgg----gta-
                            *  **                           * ****     ** 

W5U9J4_BCL2L1-01        ttcatcaagtacaagctctcgcagagaaactacccctgcaa----tcata
A0A2D0RCW7_MCL1-02      tccgctaaaaacagc-----------------cctttctaggg-------
A0A2D0RCW7_MCL1-03      ----caaagaaaagccactcgctgtcgtagctccttttcagagacccata
A0A2D0RCW7_MCL1-01      ----caaagaaaagccactcgctgtcgtagctccttttcagagacccata
                              **  * *                   **  *  *          

W5U9J4_BCL2L1-01        tcgggctcacagaagatgtgaacggaaccgaaggaggccaggcagagga-
A0A2D0RCW7_MCL1-02      --------------------caggaaacacattaaaatgtgcacga----
A0A2D0RCW7_MCL1-03      ttgaatt--taggaatttcttcggaaaaccagcgcggtttgtccgatggc
A0A2D0RCW7_MCL1-01      ttgaatt--taggaatttcttcggaaaaccagcgcggtttgtccgatggc
                                               * **   *         *   **    

W5U9J4_BCL2L1-01        --------agcgagcgctgaggga----gcggcagaattggaaacgccga
A0A2D0RCW7_MCL1-02      -----------------caaggggtactaccaggaa--------------
A0A2D0RCW7_MCL1-03      tctttaccaacttcccccgaggtggactgcgacgaagttctaggcgtcgg
A0A2D0RCW7_MCL1-01      tctttaccaacttcccccgaggtggactgcgacgaagttctaggcgtcgg
                                           ***       *     *              

W5U9J4_BCL2L1-01        cagctgtcgttaacggcgccgtaaacggaacgggtt-cagcagggactcc
A0A2D0RCW7_MCL1-02      --------------------------------------------------
A0A2D0RCW7_MCL1-03      ctgcttcc-----tggagcacaacacgcgagagattatcgccgattttct
A0A2D0RCW7_MCL1-01      ctgcttcc-----tggagcacaacacgcgagagattatcgccgattttct
                                                                          

W5U9J4_BCL2L1-01        tccgcaatcgccgactttgtcccctcggaggcaggtgaacggcggcgcga
A0A2D0RCW7_MCL1-02      -----------------------------------------------cag
A0A2D0RCW7_MCL1-03      tctgctcttcacgtcgccgtctcgcc-----ctttggggcgacatcgtaa
A0A2D0RCW7_MCL1-01      tctgctcttcacgtcgccgtctcgcc-----ctttggggcgacatcgtaa
                                                                          

W5U9J4_BCL2L1-01        g--tctggaggcagtaaaggaggcgctgcgtgactcg-------------
A0A2D0RCW7_MCL1-02      ggttt---------------------------------------------
A0A2D0RCW7_MCL1-03      ggttttacagacgatgaagtgcgttgtagacggcttgttggtgaagcacg
A0A2D0RCW7_MCL1-01      ggttttacagacgatgaagtgcgttgtagacggcttgttggtgaagcacg
                        *  *                                              

W5U9J4_BCL2L1-01        ---------gccaacgagttcgagctgcgctatgctcgcgcctttagcga
A0A2D0RCW7_MCL1-02      --------------ggaatgcttgcaaagctgtgcttggac---gagaga
A0A2D0RCW7_MCL1-03      aacttgtatataaaggaatgcttgcaaagctgtgcttggac---gagaga
A0A2D0RCW7_MCL1-01      aacttgtatataaaggaatgcttgcaaagctgtgcttggac---gagaga
                                       ** * *  **   *** **** *  *    ** **

W5U9J4_BCL2L1-01        cctgtcgtcgcagttgcatatcactccggtcacggtgtaccagagctttg
A0A2D0RCW7_MCL1-02      ggagatgacatgagtgtg-attagttcagtggcta-----cagagctc--
A0A2D0RCW7_MCL1-03      ggagatgacatgagtgtg-attagttcagtggcta-----cagagctc--
A0A2D0RCW7_MCL1-01      ggagatgacatgagtgtg-attagttcagtggcta-----cagagctc--
                           *  * *     **   ** * * * **  *       *******   

W5U9J4_BCL2L1-01        agagcgtgatggacgaggtgttccgtgatggtgtc---aactggggccgc
A0A2D0RCW7_MCL1-02      --------------------ttcagcgatggagtcacaaactggggtcgc
A0A2D0RCW7_MCL1-03      --------------------ttcagcgatggagtcacaaactggggtcgc
A0A2D0RCW7_MCL1-01      --------------------ttcagcgatggagtcacaaactggggtcgc
                                            *** * ***** ***   ******** ***

W5U9J4_BCL2L1-01        atcgtgggcttgttcgccttcgggggtgccctctgcgtcga---gtgcgt
A0A2D0RCW7_MCL1-02      attgccagcctgctggcttttggag----cagttgtgtctaaatatgaga
A0A2D0RCW7_MCL1-03      attgccagcctgctggcttttggag----cagttgtgtctaaatatgaga
A0A2D0RCW7_MCL1-01      attgccagcctgctggcttttggag----cagttgtgtctaaatatgaga
                        ** *   ** ** * ** ** ** *    *   ** *** *    ** * 

W5U9J4_BCL2L1-01        ggaaaaggagatgagtccgctggtggcgcgt-atcgccgagtggatgacc
A0A2D0RCW7_MCL1-02      tggagtctggacgagggcactgtccaagcatcgtggcagaagagatctca
A0A2D0RCW7_MCL1-03      tggagtctggacgagggcactgtccaagcatcgtggcagaagagatctca
A0A2D0RCW7_MCL1-01      tggagtctggacgagggcactgtccaagcatcgtggcagaagagatctca
                         * *     ** ***  * ***     ** *  * ** **   ***  * 

W5U9J4_BCL2L1-01        gtgta---cctggacaaccacatccagccctggatcc--aagagcaagga
A0A2D0RCW7_MCL1-02      tcatatctcctgtttaatcaaa---aggagtggcttctgaaaaacaactc
A0A2D0RCW7_MCL1-03      tcatatctcctgtttaatcaaa---aggagtggcttctgaaaaacaactc
A0A2D0RCW7_MCL1-01      tcatatctcctgtttaatcaaa---aggagtggcttctgaaaaacaactc
                           **   ****   ** ** *   **   *** * *  ** * ***   

W5U9J4_BCL2L1-01        ggatgggagcgttttgcagagatctt---cgggaaagacgcagcagcgga
A0A2D0RCW7_MCL1-02      g--tgggatggctttgtggaattttttcacgttcctgatccag-------
A0A2D0RCW7_MCL1-03      g--tgggatggctttgtggaattttttcacgttcctgatccag-------
A0A2D0RCW7_MCL1-01      g--tgggatggctttgtggaattttttcacgttcctgatccag-------
                        *  *****  * ****  **  * **   **     **  ***       

W5U9J4_BCL2L1-01        gagcagaaggtcacaggaaagcttcaagaagtggctgctggcagggatga
A0A2D0RCW7_MCL1-02      ------------------aatcttcagtgag-----gtccgcattaacga
A0A2D0RCW7_MCL1-03      ------------------aatcttcagtgag-----gtccgcattaacga
A0A2D0RCW7_MCL1-01      ------------------aatcttcagtgag-----gtccgcattaacga
                                          ** *****   **     *   ***   * **

W5U9J4_BCL2L1-01        -cgttgttcacaggggtggtgttgg----gctccttcatcgctcagaagc
A0A2D0RCW7_MCL1-02      ccattgttactgtggcaggcattggggctgttcttgcctacttgacaag-
A0A2D0RCW7_MCL1-03      ccattgttactgtggcaggcattggggctgttcttgcctacttgacaag-
A0A2D0RCW7_MCL1-01      ccattgttactgtggcaggcattggggctgttcttgcctacttgacaag-
                         * *****     **  **  ****    * ** * * *   * * *** 

W5U9J4_BCL2L1-01        gcctgtaa
A0A2D0RCW7_MCL1-02      ----atga
A0A2D0RCW7_MCL1-03      ----atga
A0A2D0RCW7_MCL1-01      ----atga
                             * *

© 1998-2020Legal notice