Dataset for CDS BCL-2-like of organism Aquila chrysaetos chrysaetos

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A663E5S6_BCL2A1-      --------------------------------atggaaactgctgagttc
A0A663FHR0_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgc--tg
A0A663ECL2_BCL2L1-      atgtc------------------cagcagtaatcgggagttagtga--tt
A0A663EQJ0_MCL1-01      -------------------------------agcggaacgccgtca--tc
A0A663EQJ0_MCL1-02      -------------------------------agcggaacgccgtca--tc
                                                          ** *     *    * 

A0A663E5S6_BCL2A1-      tattacgtttatta--------------------------cttggct---
A0A663FHR0_BCL2-01      aagtacatccactataaactctcgcagaggggatacga--ctgggctgc-
A0A663ECL2_BCL2L1-      gactttgtttcctacaagctctcacagaagggatacag--ctggagtc--
A0A663EQJ0_MCL1-01      ggcttcaacctcta----ctgcggcggcggcggcccggccctggcgcccg
A0A663EQJ0_MCL1-02      ggcttcaacctcta----ctgcggcggcggcggcccggccctggcgcccg
                           *        **                          ** *      

A0A663E5S6_BCL2A1-      -------------------------caagattatctg-------------
A0A663FHR0_BCL2-01      ---cgccgaggacaggg--------cacccctgcctccgggtctctctcc
A0A663ECL2_BCL2L1-      ---agctggaggaggaggatgagaacaggactgact-ttg----------
A0A663EQJ0_MCL1-01      cctcgccgggggggggggccggccccaccgccgcccaccg----------
A0A663EQJ0_MCL1-02      cctcgccgggggggggggccggccccaccgccgcccaccg----------
                                                 **       *               

A0A663E5S6_BCL2A1-      -----caatatgtgcttcaggaatca------------------------
A0A663FHR0_BCL2-01      tcctcctgctgctgctgctgcggttgctgctgctgctgctgctgctgctg
A0A663ECL2_BCL2L1-      -----cagcagaggaggccgagatggacggcgtcctcaacgg--------
A0A663EQJ0_MCL1-01      -----cagccgccgccgctgaggtacccgggaccctgattggctccgtgg
A0A663EQJ0_MCL1-02      -----cagccgccgccgctgaggtacccgggaccctgattggctccgtgg
                             *       *   * *   *                          

A0A663E5S6_BCL2A1-      --------------------catcttggac--------------------
A0A663FHR0_BCL2-01      ggactt------cctctgatcacactgggctggtgtctccgcacc-----
A0A663ECL2_BCL2L1-      --------------------------gagc----ccctc-----------
A0A663EQJ0_MCL1-01      gggcctgggccgccgccggtcgccctgagc----acccccgcgcgctggt
A0A663EQJ0_MCL1-02      gggcctgggccgccgccggtcgccctgagc----acccccgcgcgctggt
                                                  *  *                    

A0A663E5S6_BCL2A1-      ----------------------------cag---cccaaaccagggttgc
A0A663FHR0_BCL2-01      ----------------------------ccgagccccccggctcggctg-
A0A663ECL2_BCL2L1-      ----------------------------ctggcacccgc----ccgccag
A0A663EQJ0_MCL1-01      tggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcggccgg
A0A663EQJ0_MCL1-02      tggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcggccgg
                                                    * *   ***        *    

A0A663E5S6_BCL2A1-      tcatgtc-------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A663ECL2_BCL2L1-      ccacgtagtgaa------------------------------cggag---
A0A663EQJ0_MCL1-01      gcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggcc
A0A663EQJ0_MCL1-02      gcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggcc

A0A663E5S6_BCL2A1-      ------------------------ttgcgaaacattgcatcttcgctgca
A0A663FHR0_BCL2-01      ------------------------ctgctagccacgcgcccccggccg-a
A0A663ECL2_BCL2L1-      ----------------------------ccgccacg----------cacc
A0A663EQJ0_MCL1-01      gagcgcggcccggcgggggactcgctgcccggcacgccgcccgggccgcc
A0A663EQJ0_MCL1-02      gagcgcggcccggcgggggactcgctgcccggcacgccgcccgggccgcc

A0A663E5S6_BCL2A1-      agatcaaaccgagg---------------------aggctctcagaccat
A0A663FHR0_BCL2-01      ggggctgccccccg---------------cgccccaggtcgtccacctcg
A0A663ECL2_BCL2L1-      ggagcagcctcgaagtccat----gaaatcgttcaaa-----cagctgat
A0A663EQJ0_MCL1-01      ggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
A0A663EQJ0_MCL1-02      ggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
                         *  *   *                          *      *       

A0A663E5S6_BCL2A1-      tcttg---------------------------------------------
A0A663FHR0_BCL2-01      ccctgcgccaggcgggcgacgag----------------------ttctc
A0A663ECL2_BCL2L1-      g--tgaggcaggcgttgagagaggcagg---------ggatgagtttgag
A0A663EQJ0_MCL1-01      acctgcgggaggcggcgggcgaggcggagcccgccgtgaagaagcttttg
A0A663EQJ0_MCL1-02      acctgcgggaggcggcgggcgaggcggagcccgccgtgaagaagcttttg

A0A663E5S6_BCL2A1-      ------------gacaggattg----------------------------
A0A663FHR0_BCL2-01      ccgccgctaccagagggacttcgc--------------------------
A0A663ECL2_BCL2L1-      ttgaggtacc--ggcgggct------------------------------
A0A663EQJ0_MCL1-01      ccggggctcctgggcgggcccggccggcctggcggatcgggtgatgccgt
A0A663EQJ0_MCL1-02      ccggggctcctgggcgggcccggccggcctggcggatcgggtgatgccgt
                                    *   *                                 

A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A663ECL2_BCL2L1-      -----------------------------------------------ttc
A0A663EQJ0_MCL1-01      gatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgc
A0A663EQJ0_MCL1-02      gatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgc

A0A663E5S6_BCL2A1-      ---------------------------atattacttctgtagctgtggc-
A0A663FHR0_BCL2-01      -------ccaaatgtccggccagctgcacctgacgcccttcacggc----
A0A663ECL2_BCL2L1-      ag-----cgacctcacttcccagctccatatcacccctggcacggcgtat
A0A663EQJ0_MCL1-01      agaaacacgagctggccttccag----ggaatgcttcggaaactggaaat
A0A663EQJ0_MCL1-02      agaaacacgagctggccttccag----ggaatgcttcggaaactggaaat
                                                         *  *     * *     

A0A663E5S6_BCL2A1-      -------caagagaattttcaatggtgtcatggaagaa------------
A0A663FHR0_BCL2-01      -------caggggccgcttcgtggcggtggtggaggag------------
A0A663ECL2_BCL2L1-      c-----------agagctttgagcaggtagtgaatgaa------------
A0A663EQJ0_MCL1-01      ccagaaagaggaagatct----gcagtcggtgtgtgaagtggctgcccat
A0A663EQJ0_MCL1-02      ccagaaagaggaagatct----gcagtcggtgtgtgaagtggctgcccat
                                         *            **   **             

A0A663E5S6_BCL2A1-      aaatttgctgatggaaatactaactggggacgaattatgaccatatttac
A0A663FHR0_BCL2-01      ctcttccgagacggcgt---taactggggcaggatcgtggccttcttcga
A0A663ECL2_BCL2L1-      ctcttccgcgatggagt---gaactggggtcgcatcgtggctttcttctc
A0A663EQJ0_MCL1-01      gtgttcagtgatggagtaacaaactggggtcgagtggtgacgctcatctc
A0A663EQJ0_MCL1-02      gtgttcagtgatggagtaacaaactggggtcgagtggtgacgctcatctc
                           **    ** **       ********  *  *  ** *  *  *   

A0A663E5S6_BCL2A1-      ctttggaggtcttctcacta--agaagcttcaagagcatggagttcagct
A0A663FHR0_BCL2-01      gttcggcggcgtgatgtgcg---------tggagagcgtcaa--------
A0A663ECL2_BCL2L1-      cttcggaggagccttgtgtg---------tggagagcgttga--------
A0A663EQJ0_MCL1-01      gttt---ggtgcctttgttgcaaaacacctgaaaagcataaa--------
A0A663EQJ0_MCL1-02      gttt---ggtgcctttgttgcaaaacacctgaaaagcataaa--------
                         **    **     *              *  * *** *  *        

A0A663E5S6_BCL2A1-      cactggagaggagaa-------ggagcagatt---tcttatttcatcaca
A0A663FHR0_BCL2-01      -ccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccga-
A0A663ECL2_BCL2L1-      -caaggagatgcgggtattggtggggcgcgttgtatcttggatgaccac-
A0A663EQJ0_MCL1-01      -ccaggagaggtgcatc-------agctcgctg--gcagggatcatcaca
A0A663EQJ0_MCL1-02      -ccaggagaggtgcatc-------agctcgctg--gcagggatcatcaca
                            ***** *                         *     * * *   

A0A663E5S6_BCL2A1-      ga-gtacataataaaca---acaaagccgaatg--gatagatgcgaatgg
A0A663FHR0_BCL2-01      ---gtacctgaaccggc---acctgcacaactg--gatccaggacaacgg
A0A663ECL2_BCL2L1-      ---gtacttgaccgacc---acctagatccctg--gatccaggagaatgg
A0A663EQJ0_MCL1-01      gatgcgcttgtctcatctaagcgtgagtggctaatgagccag------gg
A0A663EQJ0_MCL1-02      gatgcgcttgtctcatctaagcgtgagtggctaatgagccag------gg
                           *  * *            *         *   **   *       **

A0A663E5S6_BCL2A1-      tggctgggaaaatggcttc-------------------------ctaaca
A0A663FHR0_BCL2-01      aggctggg---atgccttcgtggagttgtatggcaacagtat--------
A0A663ECL2_BCL2L1-      cggatggg---agcggtttgtggacctctacgggaacgatgctgctgccg
A0A663EQJ0_MCL1-01      aggctggg---agggctttgttgactt-----------------ctttcg
A0A663EQJ0_MCL1-02      aggctggg---agggctttgttgactt-----------------ctttcg
                         ** ****   *    **                                

A0A663E5S6_BCL2A1-      aagtttgaaag------aagatcactactatctttctccaaaatcacagc
A0A663FHR0_BCL2-01      -----------------gaggcctttgttcgatttctcctggatctctct
A0A663ECL2_BCL2L1-      aggtgaggaagggccaggagaccttcaacaaatggctcctga----ccgg
A0A663EQJ0_MCL1-01      agttgagga----cctagaaggcagcatcagaaatgtactga--------
A0A663EQJ0_MCL1-02      agttgagga----cctagaaggcagcatcagaaatgtactga--------
                                          *   *             * *           

A0A663E5S6_BCL2A1-      catgttcatagctgttttttccttgctcagagagtac-------------
A0A663FHR0_BCL2-01      gaagactatcctgagtctggttctggtgggagcttgcatcactcttggcg
A0A663ECL2_BCL2L1-      ggcgacggtggcaggagtgcttctgctgggatc-----------------
A0A663EQJ0_MCL1-01      --tggcgtttgcaggtgtggctggactaggagcaagctt---------gg
A0A663EQJ0_MCL1-02      --tggcgtttgcaggtgtggctggactaggagcaagctt---------gg
                           *    *        *        *  **                   

A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A663FHR0_BCL2-01      cttatcttggacat------------------------------------
A0A663ECL2_BCL2L1-      cctgc-tgagccgc------------------------------------
A0A663EQJ0_MCL1-01      cctacatgatccgg------------------------------------
A0A663EQJ0_MCL1-02      cctacatgatccgattgcaggtaccgatgaggatttattgctttgggaac

A0A663E5S6_BCL2A1-      ------------tactga
A0A663FHR0_BCL2-01      ------------aagtag
A0A663ECL2_BCL2L1-      ------------aagtga
A0A663EQJ0_MCL1-01      ---------------tga
A0A663EQJ0_MCL1-02      agaaagtggaagaattga

© 1998-2021Legal notice