Dataset for CDS BCL2L1 of organism Cyclopterus lumpus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C2ZH46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=678 residues).
atgtccaacatcaacagagagctggtggagttcttcataagctacaagctgtcgcagaagaactacccaacctctctgct
gtggccagaggaggatgccgccggtgggaggacggagggagacgaagccgacccagcatccagtaacggctcgctggtca
acggcggggacggggacggggccggcccgtcggggacgtcatcgcctccgtccggtgacgtggaggccgtgaaggcggct
ctccgggactcggcgaacgagtttgagctgctcttcacgcaagcgttcagtgacctttcctcgcagctcgacgtcacccc
cgtcacggcctaccacagctttaagagcgtgatggacgaggtgttcaaggacggagtcaactggggccgcgtggtgggcc
tgttcgccttcggcagcgtgctgtgtgtggactgcgtcgagaaggacatgagcgagctggtttcccgcatcgcggactgg
atgaccacgtacctggacgagcacatcagcgcatggatccagagccagggaggatgggactgctttgccgagatctttgg
gcgggacagcgctgcggaggcgaggatatctcaggagacgctgaggaggtggctgctcgttggagcggcgctgctaaaag
gagtgctcggcggcatggccatcagcaagaagcggtga
>gnl|bcl2dbcds|A0A8C2ZZ68_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagagctggtggtcttctacataaactataaactctcccagaggaactatcccctcacccacatggg
actcacagagcctctgaacaggactgacgggggggaggcgggggcgggcgatgccgaggaacagcgggtagcgacgcacg
ctaacgggactttcaatggcacaagtcccgggaccccaccggcatccccgctgcgaccgcaacggttgccgtcgacgacg
aacctggacgcggtaaaggaggccctccgggactcggccaacgagttcgagctgcgatacgcccgggccttcagcgatct
gcacaaccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgtttcgggacgggg
tcaactggggccgcatcgtggggcttttcgccttcggcggggccctgtgcgtggagtgtgtggagaaggagatgagtcca
ctggtgggacggatcatcgagtggatgacggtctacctggacaaccacattcagccctggatccagacccagggaggatg
ggagcgcttcgccgagatctttgggcaggacgcggcggcggagagcaggaagtctcaggagagcttcaagaagtggctgc
tggcgggggtgacgctggtgaccggcgtcgtggtggttttgctcatcggccagaagcgcctgtga
© 1998-2022Legal notice