Dataset for CDS BCL2L1 of organism Cyclopterus lumpus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2ZH46_BCL2L1-      atgtccaacatcaacagagagctggtggagttcttcataagctacaagct
A0A8C2ZZ68_BCL2L1-      atgtctca---aaacagagagctggtggtcttctacataaactataaact
                        *****  *    ****************  **** ***** *** ** **

A0A8C2ZH46_BCL2L1-      gtcgcagaagaactacccaacctctctgctgtgg-------------cca
A0A8C2ZZ68_BCL2L1-      ctcccagaggaactatcc--cctcacccacatgggactcacagagcctct
                         ** **** ****** **  **** *     ***              * 

A0A8C2ZH46_BCL2L1-      gaggaggatgccgccggtgggaggacggagggagacgaagccgacccagc
A0A8C2ZZ68_BCL2L1-      gaacagga--ctgacgggggggaggcgggggcgggcgatgccga-ggaac
                        **  ****  * * *** ***  * *** **  * *** *****   * *

A0A8C2ZH46_BCL2L1-      atccagtaacg--gctcgctgg--------tcaacgg--cggggacgggg
A0A8C2ZZ68_BCL2L1-      agcgggtagcgacgcacgctaacgggactttcaatggcacaagtcccggg
                        * *  *** **  ** ****          **** **  *  *  * ***

A0A8C2ZH46_BCL2L1-      acggggccgg----cccgtcggggacgtcatcgcctccgtccggtgacg-
A0A8C2ZZ68_BCL2L1-      accccaccggcatccccgctgcgaccgcaacggttgccgt-cgacgacga
                        **    ****    ****  * *  **  *  *   **** **  **** 

A0A8C2ZH46_BCL2L1-      ---tggaggccgtgaaggcggctctccgggactcggcgaacgagtttgag
A0A8C2ZZ68_BCL2L1-      acctggacgcggtaaaggaggccctccgggactcggccaacgagttcgag
                           **** ** ** **** *** ************** ******** ***

A0A8C2ZH46_BCL2L1-      ctgctcttcacgcaagcgttcagtgacctttcctcgcagctcgacgtcac
A0A8C2ZZ68_BCL2L1-      ctgcgatacgcccgggccttcagcgatctgcacaaccagctgcacatcac
                        ****  * * * *  ** ***** ** **   *   *****  ** ****

A0A8C2ZH46_BCL2L1-      ccccgtcacggcctaccacagctttaagagcgtgatggacgaggtgttca
A0A8C2ZZ68_BCL2L1-      gccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgtttc
                         ** * ************ *****  *** ******************  

A0A8C2ZH46_BCL2L1-      aggacggagtcaactggggccgcgtggtgggcctgttcgccttcggcagc
A0A8C2ZZ68_BCL2L1-      gggacggggtcaactggggccgcatcgtggggcttttcgccttcggcggg
                         ****** *************** * ***** ** ************ * 

A0A8C2ZH46_BCL2L1-      gtgctgtgtgtggactgcgtcgagaaggacatgagcgagctggtttcccg
A0A8C2ZZ68_BCL2L1-      gccctgtgcgtggagtgtgtggagaaggagatgagtccactggtgggacg
                        *  ***** ***** ** ** ******** *****    *****    **

A0A8C2ZH46_BCL2L1-      catcgcggactggatgaccacgtacctggacgagcacatcagcgcatgga
A0A8C2ZZ68_BCL2L1-      gatcatcgagtggatgacggtctacctggacaaccacattcagccctgga
                         ***   ** ********    ********* * *****     * ****

A0A8C2ZH46_BCL2L1-      tccagagccagggaggatgggactgctttgccgagatctttgggcgggac
A0A8C2ZZ68_BCL2L1-      tccagacccagggaggatgggagcgcttcgccgagatctttgggcaggac
                        ****** ***************  **** **************** ****

A0A8C2ZH46_BCL2L1-      agcgctgcggaggcgaggatatctcaggagacgctgaggaggtggctgct
A0A8C2ZZ68_BCL2L1-      gcggcggcggagagcaggaagtctcaggagagcttcaagaagtggctgct
                           ** ******   ****  **********   * * ** *********

A0A8C2ZH46_BCL2L1-      cgttggagcggcgctgctaaaaggagtgctcggcggcatggc-catcagc
A0A8C2ZZ68_BCL2L1-      ggcgggggtgacgctggtgaccggcgt-cgtggtggttttgctcatcggc
                         *  ** * * ***** * *  ** ** *  ** **  * ** **** **

A0A8C2ZH46_BCL2L1-      aagaagcg---gtga
A0A8C2ZZ68_BCL2L1-      cagaagcgcctgtga
                         *******   ****

© 1998-2022Legal notice