Dataset for CDS MCL-1 of organism Cebus imitator

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K5R5C4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cebus imitator GN=MCL-1 (length=1053 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggctggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgtcggcgctagccccccggccgccctcacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggctctggagaccttac
gacgggtgggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttattttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5R5C4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cebus imitator GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggctggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgtcggcgctagccccccggccgccctcacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggctctggagaccttac
gacgggtgggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttattttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggagattgcagtgatcatgccactgtgctccagcctggcaacagagcgagattccttctcaa
aaaaagaaaaaggagctga
>gnl|bcl2dbcds|A0A2K5R5C4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cebus imitator GN=MCL-1 (length=813 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggctggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgtcggcgctagccccccggccgccctcacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggctctggagaccttac
gacgggtgggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K5R5C4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cebus imitator GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggctggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggctctggagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttattttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
© 1998-2021Legal notice