Dataset for CDS MCL-1 of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5R5C4_MCL1-02      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5R5C4_MCL1-03      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5R5C4_MCL1-01      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5R5C4_MCL1-04      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K5R5C4_MCL1-02      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
A0A2K5R5C4_MCL1-03      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
A0A2K5R5C4_MCL1-01      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
A0A2K5R5C4_MCL1-04      gggggccggcttgggggctggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K5R5C4_MCL1-02      ggcttttggccacggagaaggaggcctcggcccagcgagaggtaggggga
A0A2K5R5C4_MCL1-03      ggcttttggccacggagaaggaggcctcggcccagcgagaggtaggggga
A0A2K5R5C4_MCL1-01      ggcttttggccacggagaaggaggcctcggcccagcgagaggtaggggga
A0A2K5R5C4_MCL1-04      ggctttt-------------------------------------------
                        *******                                           

A0A2K5R5C4_MCL1-02      ggggaggccggcgcggtgattggcggaagcgtcggcgctagccccccggc
A0A2K5R5C4_MCL1-03      ggggaggccggcgcggtgattggcggaagcgtcggcgctagccccccggc
A0A2K5R5C4_MCL1-01      ggggaggccggcgcggtgattggcggaagcgtcggcgctagccccccggc
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      cgccctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5C4_MCL1-03      cgccctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5C4_MCL1-01      cgccctcacgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5C4_MCL1-03      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5C4_MCL1-01      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5C4_MCL1-03      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5C4_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      cgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
A0A2K5R5C4_MCL1-03      cgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
A0A2K5R5C4_MCL1-01      cgccatcatgtctcccgaagaagagctggacgggtacgagccagagcctc
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcct
A0A2K5R5C4_MCL1-03      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcct
A0A2K5R5C4_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcct
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      ggtaatggctccagtacggacgggtcactaccctcgacgccgccgccagc
A0A2K5R5C4_MCL1-03      ggtaatggctccagtacggacgggtcactaccctcgacgccgccgccagc
A0A2K5R5C4_MCL1-01      ggtaatggctccagtacggacgggtcactaccctcgacgccgccgccagc
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5R5C4_MCL1-03      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5R5C4_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K5R5C4_MCL1-04      --------------------------------------------------
                                                                          

A0A2K5R5C4_MCL1-02      ggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
A0A2K5R5C4_MCL1-03      ggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
A0A2K5R5C4_MCL1-01      ggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
A0A2K5R5C4_MCL1-04      ----------------ggcgaccggcgccaaggacacaaagccaatgggc
                                        **********************************

A0A2K5R5C4_MCL1-02      aggtccggggccgccagcaggaaggctctggagaccttacgacgggtggg
A0A2K5R5C4_MCL1-03      aggtccggggccgccagcaggaaggctctggagaccttacgacgggtggg
A0A2K5R5C4_MCL1-01      aggtccggggccgccagcaggaaggctctggagaccttacgacgggtggg
A0A2K5R5C4_MCL1-04      aggtccggggccgccagcaggaaggctctggagaccttacgacgggtggg
                        **************************************************

A0A2K5R5C4_MCL1-02      ggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K5R5C4_MCL1-03      ggacggcgtgcagcgcaaccacgagacggccttccaa-------------
A0A2K5R5C4_MCL1-01      ggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K5R5C4_MCL1-04      ggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                        *************************************             

A0A2K5R5C4_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K5R5C4_MCL1-03      --------------------------------------------------
A0A2K5R5C4_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K5R5C4_MCL1-04      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                                                                          

A0A2K5R5C4_MCL1-02      gtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
A0A2K5R5C4_MCL1-03      --------------------------------------------------
A0A2K5R5C4_MCL1-01      gtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
A0A2K5R5C4_MCL1-04      gtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
                                                                          

A0A2K5R5C4_MCL1-02      catttattttggtgcctttgtggccaaacacttgaagaccataaaccaag
A0A2K5R5C4_MCL1-03      --------------------------------------------------
A0A2K5R5C4_MCL1-01      catttattttggtgcctttgtggccaaacacttgaagaccataaaccaag
A0A2K5R5C4_MCL1-04      catttattttggtgcctttgtggccaaacacttgaagaccataaaccaag
                                                                          

A0A2K5R5C4_MCL1-02      aaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5R5C4_MCL1-03      --------------------------------------------------
A0A2K5R5C4_MCL1-01      aaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K5R5C4_MCL1-04      aaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                          

A0A2K5R5C4_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K5R5C4_MCL1-03      -----------------------------------ggatgggtttgtgga
A0A2K5R5C4_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K5R5C4_MCL1-04      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                                                           ***************

A0A2K5R5C4_MCL1-02      gttcttccatgtagaggacctagaaggtggagattgcagtgatcatgcca
A0A2K5R5C4_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatg----tgctg
A0A2K5R5C4_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatg----tgctg
A0A2K5R5C4_MCL1-04      gttcttccatgtagaggacctagaaggtggcatcagaaatg----tgctg
                        ******************************     * * **    ***  

A0A2K5R5C4_MCL1-02      ctgtgctccagc--------ctggcaacagagcgagatt--ccttctcaa
A0A2K5R5C4_MCL1-03      ctg-gcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
A0A2K5R5C4_MCL1-01      ctg-gcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
A0A2K5R5C4_MCL1-04      ctg-gcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
                        *** ***   **        ****     ****  * **  * *    **

A0A2K5R5C4_MCL1-02      aaaaagaaaaaggagctga
A0A2K5R5C4_MCL1-03      taagatagccttgtaa---
A0A2K5R5C4_MCL1-01      taagatag-----------
A0A2K5R5C4_MCL1-04      taagatag-----------
                         ** * *            

© 1998-2021Legal notice