Dataset for CDS BCL2L1 of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3DUT7_BCL2L1-      atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttc
A0A3Q3DUT7_BCL2L1-      atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttc
A0A3Q3DUT7_BCL2L1-      atgtctcaaaatcgagaactggttttgttttacattaggtacaaactttc

A0A3Q3DUT7_BCL2L1-      ccagaaaaactacccgctcaaccacataggactcagacaggcattgaaca
A0A3Q3DUT7_BCL2L1-      ccagaaaaactacccgctcaaccacataggactcagacaggcattgaaca
A0A3Q3DUT7_BCL2L1-      ccagaaaaactacccgctcaaccacataggactcagacaggcattgaaca

A0A3Q3DUT7_BCL2L1-      ggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacag
A0A3Q3DUT7_BCL2L1-      ggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacag
A0A3Q3DUT7_BCL2L1-      ggactgatggcagggaggaagcctcaggcgaggaggagcagcgggtacag

A0A3Q3DUT7_BCL2L1-      acgcctgccaatgggacgaccaacggcaccagtcccccggcgtcgccgct
A0A3Q3DUT7_BCL2L1-      acgcctgccaatgggacgaccaacggcaccagtcccccggcgtcgccgct
A0A3Q3DUT7_BCL2L1-      acgcctgccaatgggacgaccaacggcaccagtcccccggcgtcgccgct

A0A3Q3DUT7_BCL2L1-      acgagaggcggcgagcctggacgcggtgaaggaggccctgcgggactcgg
A0A3Q3DUT7_BCL2L1-      acgagaggcggcgagcctggacgcggtgaaggaggccctgcgggactcgg
A0A3Q3DUT7_BCL2L1-      acgagaggcggcgagcctggacgcggtgaaggaggccctgcgggactcgg

A0A3Q3DUT7_BCL2L1-      ccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaa
A0A3Q3DUT7_BCL2L1-      ccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaa
A0A3Q3DUT7_BCL2L1-      ccaatgagtttgagttgcgctactcccacgccttcagcgacctggacaaa

A0A3Q3DUT7_BCL2L1-      cagctgcacattacaccggccactgcctaccaaagctttgagaacgttgt
A0A3Q3DUT7_BCL2L1-      cagctgcacattacaccggccactgcctaccaaagctttgagaacgttgt
A0A3Q3DUT7_BCL2L1-      cagctgcacattacaccggccactgcctaccaaagctttgagaacgttgt

A0A3Q3DUT7_BCL2L1-      ggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct
A0A3Q3DUT7_BCL2L1-      ggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct
A0A3Q3DUT7_BCL2L1-      ggatgaggtgttccaggacgacgtcaactggggccgcatcgtggggctct

A0A3Q3DUT7_BCL2L1-      tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatc
A0A3Q3DUT7_BCL2L1-      tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatc
A0A3Q3DUT7_BCL2L1-      tcgcgttcggcggcgcgctgtgcgtcgaatgcatggagaaggagatgatc

A0A3Q3DUT7_BCL2L1-      cccctggttgacaggatcatcgagtggatgacggtgtacctggacaacca
A0A3Q3DUT7_BCL2L1-      cccctggttgacaggatcatcgagtggatgacggtgtacctggacaacca
A0A3Q3DUT7_BCL2L1-      cccctggttgacaggatcatcgagtggatgacggtgtacctggacaacca

A0A3Q3DUT7_BCL2L1-      ccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaa
A0A3Q3DUT7_BCL2L1-      ccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaa
A0A3Q3DUT7_BCL2L1-      ccttcagccctggatagagagccaaggaggatggcaacgctttgccgaaa

A0A3Q3DUT7_BCL2L1-      tttttggccacgacgcggcagcggaggtccgccgctcccaggagagtttc
A0A3Q3DUT7_BCL2L1-      tttttggccacgacgcggcagcggaggtccgccgctcccaggagagtttc
A0A3Q3DUT7_BCL2L1-      tttttggccacgacgcggcagcggaggtccgccgctcccaggagagtttc

A0A3Q3DUT7_BCL2L1-      aagaagtggcttttggccggggtgaccttggtgaccggggtcgtggtggg
A0A3Q3DUT7_BCL2L1-      aagaagtggcttttggccggggtgaccttggtgaccggggtcgtggtggg
A0A3Q3DUT7_BCL2L1-      aagaagtggcttttggccggggtgaccttggtgaccggggtcgtggtggg

A0A3Q3DUT7_BCL2L1-      ctcgctcatcgcccagaagcgcctgtga
A0A3Q3DUT7_BCL2L1-      ctcgctcatcgcccagaagcgcctgtga
A0A3Q3DUT7_BCL2L1-      ctcgctcatcgcccagaagcgcctgtga

© 1998-2021Legal notice