Dataset for CDS BCL2A1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

88 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      atgacccagccgggaaccaggttctggagagggagcgaacattccatcag
A0A5F4CJR7_BCL2A1-      atgtcccatc----------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      ggcagattccgcaaaggctaaagtcccatatgtcatcagtgtgcccgggt
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gggaggccaggctccgtgacccagagggctccaccaggcccccgcccggc
A0A5F4CJR7_BCL2A1-      -------------------------------------------------t
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      cctcagggactcccaggcacgctaatgacaaatg-tgtccattgggaagg
A0A5F4CJR7_BCL2A1-      ctttggtggttctta-------tgatgcccaacgatgttc--tggggaga
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      agaggaagaaagactggcgtttctccctctttctgcctggtcggctggct
A0A5F4CJR7_BCL2A1-      gaagg---------------------------ctgcctg-----------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gaccctgaaggtacagctgggtgggggtggcaacagaacccccaggacct
A0A5F4CJR7_BCL2A1-      ------------------------------------------------ct
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gccagctcaaaggttcaggaaagtcaacacacagattttccagaggagga
A0A5F4CJR7_BCL2A1-      gttggctt------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gcaaagtagaacagggtcctcggctgccagacttcagacccggggtgact
A0A5F4CJR7_BCL2A1-      -----------catgttcct------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gggcagccaacacgccggaggtctgcctggaagcccagtgctgggccatg
A0A5F4CJR7_BCL2A1-      -------------------------------------gtg----------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      ggaatctggcaggagcaagcccacgcccgagagtgacgaggaggaaggag
A0A5F4CJR7_BCL2A1-      ------------------gcccacgcccgagagtgacgaggaggaaggag
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      ------------------------------------------------at
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
A0A5F4CJR7_BCL2A1-      ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
A0A452U285_BCL2A1-      -----------atgcacacagaaattccaccggcctccgcgcgtc-ccat
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      -----------atgcacacagaaattccaccggcctccgcgcgtc-ccat
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ------------------------atg-----------------------
A0A5F9CXI7_BCL2A1-      ------------------------atgttcgcctcccagggcttcggaag
A0A5F9CXI7_BCL2A1-      ------------------------atgttcgcctcccagggcttcggaag
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      ---------atgattaccccttcgttgtcaagccatctttggcttagttg
A0A3L7HT14_BCL2A1-      ---------atgattaccccttcgttgtcaagccatctttggcttagttg
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      gggtcacatcctgctcagcgccactgctggcagtctcgatctgcgcgagc
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
A0A5F4CJR7_BCL2A1-      gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
A0A452U285_BCL2A1-      gagtcaccgccccagccccgccggcgctcgcctcatttggccnnnnnnnn
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      gagtcaccgccccagccccgccggcgctcgcctcatttggccnnnnnnnn
                                                                          

A0A452J3N6_BCL2A1-      ----------------------------------------------atgg
K7G130_BCL2A1-01        ----------------------------------------------atgg
U3JTB2_BCL2A1-01        ----------------------------------------------atgg
A0A218V8Z6_BCL2A1-      ----------------------------------------------atgg
H0ZCL9_BCL2A1-01        ----------------------------------------------atgg
A0A493SSZ7_BCL2A1-      ----------------------------------------------atgg
Q9W6F2_BCL2A1-01        ----------------------------------------------atgg
G1N8C5_BCL2A1-01        ----------------------------------------------atgg
F6S8G3_BCL2A1-01        ----------------------------------------------atgg
F6SFL4_BCL2A1-01        ----------------------------------------------atgg
G3WSP8_BCL2A1-01        ----------------------------------------------atgg
A0A4X2KFL7_BCL2A1-      ----------------------------------------------atgg
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      cttccagaagaagcagtcaccggctctgctctccgagcagcagaagatga
A0A5F9CXI7_BCL2A1-      cttccagaagaagcagtcaccggctctgctctccgagcagcagaagatga
A0A3L7HT14_BCL2A1-      ----------------------------------------------atgg
A0A3L7HT14_BCL2A1-      cctctttgactggacttggcagctccagtctgctctgccaaggacaatga
A0A3L7HT14_BCL2A1-      cctctttgactggacttggcagctccagtctgctctgccaaggacaatga
G3GTB4_BCL2A1-01        ----------------------------------------------atga
G3V977_BCL2A1-01        ----------------------------------------------atga
Q925A9_BCL2A1-01        ----------------------------------------------atga
O55178_BCL2A1-01        ----------------------------------------------atgg
Q0P538_BCL2A1-01        ----------------------------------------------atgg
Q07440_BCL2A1-01        ----------------------------------------------atgg
O55179_BCL2A1-01        ----------------------------------------------atgt
Q8K164_BCL2A1-01        ----------------------------------------------atgg
Q4FK02_BCL2A1-01        ----------------------------------------------atgt
O55177_BCL2A1-02        ----------------------------------------------atgg
Q497M6_BCL2A1-01        ----------------------------------------------atgg
A0A2K6EKG1_BCL2A1-      ----------------------------------------------atga
I3MCZ7_BCL2A1-01        ----------------------------------------------atga
A0A4W2DYC0_BCL2A1-      ----------------------------------------------atga
A0A4W2DYC0_BCL2A1-      ----------------------------------------------atga
Q3C2I0_BCL2A1-01        ----------------------------------------------atga
L8IZT5_BCL2A1-01        ----------------------------------------------atga
A0A452EK63_BCL2A1-      ----------------------------------------------atga
W5Q0N6_BCL2A1-01        ----------------------------------------------atga
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        ----------------------------------------------atga
A0A4X1UP21_BCL2A1-      ----------------------------------------------atga
A0A4X1UP21_BCL2A1-      ----------------------------------------------atga
C7F841_BCL2A1-01        ----------------------------------------------atga
A0A4X1UP21_BCL2A1-      ----------------------------------------------atga
H0WZ23_BCL2A1-01        ----------------------------------------------atga
H2NNZ9_BCL2A1-01        ----------------------------------------------atga
A0A2I3HBP6_BCL2A1-      ----------------------------------------------atga
A0A2I3HBP6_BCL2A1-      ----------------------------------------------atga
A0A2K5KAA3_BCL2A1-      ----------------------------------------------atga
A0A2K6AD27_BCL2A1-      ----------------------------------------------atga
A0A0D9RRC3_BCL2A1-      ----------------------------------------------atga
A0A2K6LV19_BCL2A1-      ----------------------------------------------atga
A0A2K6PHF2_BCL2A1-      ----------------------------------------------atga
A0A2K5KHH8_BCL2A1-      ----------------------------------------------atga
A0A096NMX5_BCL2A1-      ----------------------------------------------atga
A0A2K6DS18_BCL2A1-      ----------------------------------------------atga
A0A2K5KHH8_BCL2A1-      ----------------------------------------------atga
A0A2K5TMD1_BCL2A1-      ----------------------------------------------atga
F7E8V5_BCL2A1-01        ----------------------------------------------atga
A0A2K5KAA3_BCL2A1-      ----------------------------------------------atga
A0A2K6LV19_BCL2A1-      ----------------------------------------------atga
A0A2K6PHF2_BCL2A1-      ----------------------------------------------atga
A0A2K6AD27_BCL2A1-      ----------------------------------------------atga
A0A096NMX5_BCL2A1-      ----------------------------------------------atga
A0A2K5TMD1_BCL2A1-      ----------------------------------------------atga
A0A2K6DS18_BCL2A1-      ----------------------------------------------atga
B4E1X9_BCL2A1-01        ----------------------------------------------atga
A0A2R8ZJX9_BCL2A1-      ----------------------------------------------atga
A0A2I2YML2_BCL2A1-      ----------------------------------------------atga
Q16548_BCL2A1-01        ----------------------------------------------atga
A0A2I2YML2_BCL2A1-      ----------------------------------------------atga
A0A2R8ZJX9_BCL2A1-      ----------------------------------------------atga
F7HXW0_BCL2A1-01        ----------------------------------------------atga
A0A2K6TLJ5_BCL2A1-      ----------------------------------------------atga
A0A2K6TLJ5_BCL2A1-      ----------------------------------------------atga
A0A2K5D2I1_BCL2A1-      ----------------------------------------------atga
A0A2K5D2I1_BCL2A1-      ----------------------------------------------atga
A0A2K5PYQ3_BCL2A1-      ----------------------------------------------atga
A0A2K5PYQ3_BCL2A1-      ----------------------------------------------atga
A0A286XUI2_BCL2A1-      cagcagcaggctgctgtctgcc-----------------gcccaggatga
M3WHW2_BCL2A1-01        ----------------------------------------------atgg
M3YVH4_BCL2A1-01        ----------------------------------------------atga
U6CQS8_BCL2A1-01        ----------------------------------------------atga
A0A5F4CJR7_BCL2A1-      ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatga
A0A5F4CJR7_BCL2A1-      ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatga
A0A452U285_BCL2A1-      nnnnnnnnnnnnnnnnnnnnng-----------gggcgggtggaagatga
A0A452SIR9_BCL2A1-      ----------------------------------------------atga
A0A452U285_BCL2A1-      nnnnnnnnnnnnnnnnnnnnng-----------gggcgggtggaagatga
                                                                          

A0A452J3N6_BCL2A1-      aaagctctgagtactgctatgtttactatttagtccaagattatctgaaa
K7G130_BCL2A1-01        aaagttctgagttccgctatgtttactatttagtccaggattatctgaaa
U3JTB2_BCL2A1-01        aaactgctgagttctattacgtttattacttagcccaggattatctgcag
A0A218V8Z6_BCL2A1-      aaactgctgagttctattacgtttattacttagcccaggactatctgcag
H0ZCL9_BCL2A1-01        aaactgctgagttctattacgtttattacttagcccaggattatctgcag
A0A493SSZ7_BCL2A1-      aaactgctgagttctattacgtttattatttagctcaagattatctgcaa
Q9W6F2_BCL2A1-01        aaactgctgagttctattacgtttattatttagctcaagattatctgcag
G1N8C5_BCL2A1-01        aaactgctgagttctattatgtttattatttagctcaagattatctgcaa
F6S8G3_BCL2A1-01        acgacggtgtattctggtccgtccgagccctggctctggactatctggat
F6SFL4_BCL2A1-01        atgattacgagttccattatgttcacatgttagctcgggactacttgaag
G3WSP8_BCL2A1-01        ctgattgtgaattccattatgttcacatgctagcccaggactacttgaag
A0A4X2KFL7_BCL2A1-      ctgattatgaattccattatgttcacatgttagcccaggactacttgaag
A0A5F9CXI7_BCL2A1-      gcggcggcgg---cggctgtgagc--------------------------
A0A5F9CXI7_BCL2A1-      gtgactgcgagtttggctatgtgcacacactggctcaggactatctgctg
A0A5F9CXI7_BCL2A1-      gtgactgcgagtttggctatgtgcacacactggctcaggactatctgctg
A0A3L7HT14_BCL2A1-      c---ctgtgcgccaatgctagtcca--------cagaggcc---------
A0A3L7HT14_BCL2A1-      ctgactgtgagttcatgtacatccactcgctggctgaggactatcttcag
A0A3L7HT14_BCL2A1-      ctgactgtgagttcatgtacatccactcgctggctgaggactatcttcag
G3GTB4_BCL2A1-01        ctgactgtgagttcatgtacatccactcgctggctgaggactatcttcag
G3V977_BCL2A1-01        cagactgtgagttcatgtatatccactccctggctgagaactatcttcag
Q925A9_BCL2A1-01        cagactgtgagttcatgtatatccactccctggctgagaactatcttcag
O55178_BCL2A1-01        ctgagtacgagctcatgcatatccactccctggctgagcactaccttcag
Q0P538_BCL2A1-01        ctgagtacgagctcatgcatatccactccctggctgagcactaccttcag
Q07440_BCL2A1-01        ctgagtctgagctcatgcatatccactccctggctgagcactaccttcag
O55179_BCL2A1-01        ctgagtacgagttcatgtatatccactccctggctgagcactaccttcag
Q8K164_BCL2A1-01        ctgagtacgagttcatgtatatccactccctggctgagcactatcttcag
Q4FK02_BCL2A1-01        ctgagtacgagttcatgtatatccactccctggctgagcactatcttcag
O55177_BCL2A1-02        ctgagtacgagttcatgtatatccactccctggctgagcactatcttcag
Q497M6_BCL2A1-01        ctgagtacgagttcatgtatatccactccctggctgagcactatcttcag
A0A2K6EKG1_BCL2A1-      ctgactgtgagtttggatacacccacaggctggtccaggactacctgcag
I3MCZ7_BCL2A1-01        atgactgtgagttcaggttcatccacacgctggctcaggactacctgcag
A0A4W2DYC0_BCL2A1-      ctgacactgagtttggctacgttcacgggctggctgaggactatctgaaa
A0A4W2DYC0_BCL2A1-      ctgacactgagtttggctacgttcacgggctggctgaggactatctgaaa
Q3C2I0_BCL2A1-01        ctgacactgagtttggctacgttcacgggctggctgaggactatctgaaa
L8IZT5_BCL2A1-01        ctgacactgagtttggctacgttcacgggctggctgaggactatctgaaa
A0A452EK63_BCL2A1-      ctgacactgagtttgactacgttcacaagctggctgaggactatctgaaa
W5Q0N6_BCL2A1-01        ctgacactgagtttgactacgttcacaagctggctgaggactatctgaaa
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        ctgactgtgagtttggatacatttacaagctggtccaggactatctgaag
A0A4X1UP21_BCL2A1-      ctgacgacgagtttggatatattcacatgctggcccaggactatctgaag
A0A4X1UP21_BCL2A1-      ctgacgacgagtttggatatattcacatgctggcccaggactatctgaag
C7F841_BCL2A1-01        ctgacgacgagtttggatatattcacatgctggcccaggactatctgaag
A0A4X1UP21_BCL2A1-      ctgacgacgagtttggatatattcacatgctggcccaggactatctgaag
H0WZ23_BCL2A1-01        ctgactgtgagtttggatacattcacaggctggctcaggactatctgcag
H2NNZ9_BCL2A1-01        cagactgtgaatttgggtatatttacaggctagctcaggactatctgcag
A0A2I3HBP6_BCL2A1-      cagactgcgaatttggatatatttacaggctagctcaggactatctgcag
A0A2I3HBP6_BCL2A1-      cagactgcgaatttggatatatttacaggctagctcaggactatctgcag
A0A2K5KAA3_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6AD27_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A0D9RRC3_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6LV19_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6PHF2_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K5KHH8_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A096NMX5_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6DS18_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K5KHH8_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K5TMD1_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
F7E8V5_BCL2A1-01        cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K5KAA3_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6LV19_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6PHF2_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6AD27_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A096NMX5_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K5TMD1_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
A0A2K6DS18_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatttgcag
B4E1X9_BCL2A1-01        cagactgtgaatttggatatatttacaggctggctcaggactatctgcag
A0A2R8ZJX9_BCL2A1-      cagactgtgaatttggatatatttacaggctggctcaggactatctgcag
A0A2I2YML2_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatctgcag
Q16548_BCL2A1-01        cagactgtgaatttggatatatttacaggctggctcaggactatctgcag
A0A2I2YML2_BCL2A1-      cagactgtgaatttggatatatttacaggctagctcaggactatctgcag
A0A2R8ZJX9_BCL2A1-      cagactgtgaatttggatatatttacaggctggctcaggactatctgcag
F7HXW0_BCL2A1-01        cagactctgaatttggatatattcacaatctaactcaggactatctgcag
A0A2K6TLJ5_BCL2A1-      cagaccacgaatttggatatattcacaatctaactcaggactatctgcgg
A0A2K6TLJ5_BCL2A1-      cagaccacgaatttggatatattcacaatctaactcaggactatctgcgg
A0A2K5D2I1_BCL2A1-      cagactgtgaatttggatatattcacaatctaactcaggactatctgcgg
A0A2K5D2I1_BCL2A1-      cagactgtgaatttggatatattcacaatctaactcaggactatctgcgg
A0A2K5PYQ3_BCL2A1-      cagacagtgaatttggatatattcacaatctaactcaggactatctgtgg
A0A2K5PYQ3_BCL2A1-      cagacagtgaatttggatatattcacaatctaactcaggactatctgtgg
A0A286XUI2_BCL2A1-      ttgacctggagttcaggtacacgcaggctctggcccaggactacctgctc
M3WHW2_BCL2A1-01        ccgacggcgagtttgggtacgttctcacgctggcccgggactatacggag
M3YVH4_BCL2A1-01        cagacagtgagttcgggtacacgctgtcgctggcccaggactacgtgagg
U6CQS8_BCL2A1-01        cagacggtgagttcgggtacacgctgtcgctggctcaggactacgtgagg
A0A5F4CJR7_BCL2A1-      cggactgcgagtttggctacacgctggcgctggcccaggactacgtgagg
A0A5F4CJR7_BCL2A1-      cggactgcgagtttggctacacgctggcgctggcccaggactacgtgagg
A0A452U285_BCL2A1-      cagactgcgagttcgggtacaccctgacgctggcccaggactacgtgaag
A0A452SIR9_BCL2A1-      cagactgtgagttcgggtacaccctgacgctggcccaggactacgtgaag
A0A452U285_BCL2A1-      cagactgcgagttcgggtacaccctgacgctggcccaggactacgtgaag
                                                                          

A0A452J3N6_BCL2A1-      tacgttcttcaggaaccacagcttggacca-gccccaagcagagttgctc
K7G130_BCL2A1-01        tacattcttcaggaacctgagcttggacca-gccccaagcagagttgctc
U3JTB2_BCL2A1-01        tatgtgctccaggaatcacacctcggacca-gcccagaccagggttgccc
A0A218V8Z6_BCL2A1-      tatgtgctccaggaatcacacctcggacca-gcccagacccgggttgctc
H0ZCL9_BCL2A1-01        tatgtgctccaggaatcacacctcggacca-gcccagacccgggttgctc
A0A493SSZ7_BCL2A1-      tatgtgcttcaggaatcacatcttggacca-gcgcaaaccagagttgctc
Q9W6F2_BCL2A1-01        tatgtgcttcaggaatcacatctcggacca-gcccaaaccagagttgctc
G1N8C5_BCL2A1-01        tatgtccttcaggaatcacgtcttggacca-gcccaaaccagagttgctc
F6S8G3_BCL2A1-01        gacgtcctccagacgccgcgacttgggacg-gtcccaagcagaacttctc
F6SFL4_BCL2A1-01        catgttcaacagacaccaccactgggatca-tgtctaaataagacatctc
G3WSP8_BCL2A1-01        catgttcaacaaatgccacgactgggatca-tgtctacataggacatctc
A0A4X2KFL7_BCL2A1-      tatgttcaacagatgccacaactgggatcg-tgtctaaataagacatctc
A0A5F9CXI7_BCL2A1-      -----------ggcgcca-agcggagcctgcgggccgagctgaa---gca
A0A5F9CXI7_BCL2A1-      tacatcctgaagacgccacagcctggactg-ggaccgagcaaaacgtcca
A0A5F9CXI7_BCL2A1-      tacatcctgaagacgccacagcctggactg-ggaccgagcaaaacgtcca
A0A3L7HT14_BCL2A1-      -acgccc--------cctccct----------ccccacg-----------
A0A3L7HT14_BCL2A1-      tatgtcctgaaggtacctacttttgaatct-gctccaagcaaaacatcca
A0A3L7HT14_BCL2A1-      tatgtcctgaaggtacctacttttgaatct-gctccaagcaaaacatcca
G3GTB4_BCL2A1-01        tatgtcctgaaggtacctacttttgaatct-gctccaagcaaaacatcca
G3V977_BCL2A1-01        tatgtcctgcaggtacctgcctttgaatcg-gctccaagcaaaacgtcca
Q925A9_BCL2A1-01        tatgtcctgcaggtacctgcctttgaatcg-gctccaagcaaaacgtcca
O55178_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcattca
Q0P538_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcattca
Q07440_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcatgca
O55179_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcatgca
Q8K164_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcatgca
Q4FK02_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagcaaagcatgca
O55177_BCL2A1-02        tatgtgctacaggtacccgcctttgagtcg-gctccaagccaagcatgca
Q497M6_BCL2A1-01        tatgtgctacaggtacccgcctttgagtcg-gctccaagcaaagcatgca
A0A2K6EKG1_BCL2A1-      tacgtcctgcgggttccgcagcccgggtcc-ggtccgagcaagacgtcca
I3MCZ7_BCL2A1-01        cacgtcctgcaggtaccgcaacgtgggtca-agccccagcaaaacgtcca
A0A4W2DYC0_BCL2A1-      tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaacatcca
A0A4W2DYC0_BCL2A1-      tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaacatcca
Q3C2I0_BCL2A1-01        tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaacatcca
L8IZT5_BCL2A1-01        tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaatatcca
A0A452EK63_BCL2A1-      tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaacatcca
W5Q0N6_BCL2A1-01        tatgtgttgcagatacagcaacctggatcc-aagccaagcaaaacatcca
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        tacgtcctgcagataccacaacctgcagct-ggttcaagcaaaacgtcca
A0A4X1UP21_BCL2A1-      tatgtcctgcagataccacaacctggatct-ggtccaagcaaaacatcta
A0A4X1UP21_BCL2A1-      tatgtcctgcagataccacaacctggatct-ggtccaagcaaaacatcta
C7F841_BCL2A1-01        tatgtcctgcagataccacaacctggatct-ggtccaagcaaaacatcta
A0A4X1UP21_BCL2A1-      tatgtcctgcagataccacaacctggatct-ggtccaagcaaaacatcta
H0WZ23_BCL2A1-01        tatgtcctgcaaatacagcaatgtggatca-ggtccaagcaaaacgtcca
H2NNZ9_BCL2A1-01        tacgtcctacagataccacaacctggatca-ggtccaagcaaagcgtcca
A0A2I3HBP6_BCL2A1-      tacgtcctacagataccacagcctggatca-ggtccaagcaaaacgtcca
A0A2I3HBP6_BCL2A1-      tacgtcctacagataccacagcctggatca-ggtccaagcaaaacgtcca
A0A2K5KAA3_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6AD27_BCL2A1-      tatgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A0D9RRC3_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6LV19_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6PHF2_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K5KHH8_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A096NMX5_BCL2A1-      tacgttctgcagataccacaacctggattg-ggtccaagcaaaacgtcca
A0A2K6DS18_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K5KHH8_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K5TMD1_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
F7E8V5_BCL2A1-01        tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K5KAA3_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6LV19_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6PHF2_BCL2A1-      tacgtcctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6AD27_BCL2A1-      tatgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A096NMX5_BCL2A1-      tacgttctgcagataccacaacctggattg-ggtccaagcaaaacgtcca
A0A2K5TMD1_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
A0A2K6DS18_BCL2A1-      tacgttctgcagataccacaacctggatcg-ggtccaagcaaaacgtcca
B4E1X9_BCL2A1-01        tgcgtcctacagataccacaacctggatca-ggtccaagcaaaacgtcca
A0A2R8ZJX9_BCL2A1-      tacgtcctacagataccacaacctggatca-ggtccaagccaaacgtcca
A0A2I2YML2_BCL2A1-      tacgtcctacagataccacaacctggatca-ggtccaagcaaaacgtcca
Q16548_BCL2A1-01        tgcgtcctacagataccacaacctggatca-ggtccaagcaaaacgtcca
A0A2I2YML2_BCL2A1-      tacgtcctacagataccacaacctggatca-ggtccaagcaaaacgtcca
A0A2R8ZJX9_BCL2A1-      tacgtcctacagataccacaacctggatca-ggtccaagccaaacgtcca
F7HXW0_BCL2A1-01        tacgtcctgcagataccacagtctggaatg-ggtccgagcaaaacgtcta
A0A2K6TLJ5_BCL2A1-      tatgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A2K6TLJ5_BCL2A1-      tatgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A2K5D2I1_BCL2A1-      tacgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A2K5D2I1_BCL2A1-      tacgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A2K5PYQ3_BCL2A1-      tacgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A2K5PYQ3_BCL2A1-      tacgtcctgcagataccacaatctggaacg-ggtccaagcaaaacgtcca
A0A286XUI2_BCL2A1-      cacgtcctgcaggtgcctcagtgcgagacc-agccccagcaaggcatcca
M3WHW2_BCL2A1-01        cacgttctgcaggggccccagcccgggtcc-cacccaagcagagtatccc
M3YVH4_BCL2A1-01        catgtcctgcagatcccgcagcccagcccg-gccgccagcagagtgtccc
U6CQS8_BCL2A1-01        catgtcctgcagatcccgcagcccggcccg-gccgccagcagagtgtccc
A0A5F4CJR7_BCL2A1-      cacgtcctgcagatcccgcagcccggcccg-gcccccagcagagcgtcca
A0A5F4CJR7_BCL2A1-      cacgtcctgcagatcccgcagcccggcccg-gcccccagcagagcgtcca
A0A452U285_BCL2A1-      cacgtcctgcagatcccgcagccgggctca-gccccgagcagggcgtccc
A0A452SIR9_BCL2A1-      cacgtcctgcagatcccgcagccgggctca-gccccgagcagggcgtccc
A0A452U285_BCL2A1-      cacgtcctgcagatcccgcagccgggctca-gccccgagcagggcgtccc
                                                                          

A0A452J3N6_BCL2A1-      atgtcttaagacacgctgcatcctttctgcaaaaggaaaatgaagagagt
K7G130_BCL2A1-01        atgtcttaagaaattctgcatcttttcttcaaaaagaaaacgaagagata
U3JTB2_BCL2A1-01        atgtcctgcgaaccatggcatcttccctgcaagaccaaaccgaggaggct
A0A218V8Z6_BCL2A1-      atgtcttgagaaccatggcatcctctctgcaagaccaaacggaggaggct
H0ZCL9_BCL2A1-01        atgtcctgagaaccatggcatcctctctgcaagaccaaacggaggaggct
A0A493SSZ7_BCL2A1-      atgtcttgcgaaacattgcatcttcgctgcaagatcaaacagaggaggct
Q9W6F2_BCL2A1-01        atgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggct
G1N8C5_BCL2A1-01        atgtcttgcgaaatattgcatcctcactccaagatcagacagaggaggca
F6S8G3_BCL2A1-01        gggcgctgcaaaacgtcatgttctcggtccagggggacgtggagaaggct
F6SFL4_BCL2A1-01        aaatactacaaaaggttgctttctctgtccaacaagaagtagaaaaggat
G3WSP8_BCL2A1-01        aaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggat
A0A4X2KFL7_BCL2A1-      aaatactacaaaaagttgctttctctgttcaaggagaagttgaaaaggat
A0A5F9CXI7_BCL2A1-      gcgt-ctgcgggccatcagcgc----------cgaggagcg---------
A0A5F9CXI7_BCL2A1-      gggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggct
A0A5F9CXI7_BCL2A1-      gggtgctgcagaacgtcaccttctccatccagcaagaagtggaagaggct
A0A3L7HT14_BCL2A1-      -----------------gcgtcc---------------------------
A0A3L7HT14_BCL2A1-      gggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaat
A0A3L7HT14_BCL2A1-      gggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaat
G3GTB4_BCL2A1-01        gggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaat
G3V977_BCL2A1-01        gagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaat
Q925A9_BCL2A1-01        gagtgctacagagagttgctttctctgtacaaaaggaagttgaaaagaat
O55178_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaac
Q0P538_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaac
Q07440_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
O55179_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
Q8K164_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
Q4FK02_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
O55177_BCL2A1-02        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
Q497M6_BCL2A1-01        gagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaat
A0A2K6EKG1_BCL2A1-      gagtgctgcaaaacattgccttctccgtccaaaacgaagtcgaaaagaat
I3MCZ7_BCL2A1-01        aagtgttacaaaacgtggctttctcagtccaaaaagaagttgaaaagaat
A0A4W2DYC0_BCL2A1-      gggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggact
A0A4W2DYC0_BCL2A1-      gggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggact
Q3C2I0_BCL2A1-01        gggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggact
L8IZT5_BCL2A1-01        gggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggact
A0A452EK63_BCL2A1-      gggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggact
W5Q0N6_BCL2A1-01        gggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggact
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        gagtgttacaaaatgtggctttctcagttcaaaaagaagttgaaaagaat
A0A4X1UP21_BCL2A1-      gagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaat
A0A4X1UP21_BCL2A1-      gagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaat
C7F841_BCL2A1-01        gagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaat
A0A4X1UP21_BCL2A1-      gagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaat
H0WZ23_BCL2A1-01        gagtgctgcaaaatgttgcattttcagtccaagaagaggttgaaaagagt
H2NNZ9_BCL2A1-01        gagtactacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2I3HBP6_BCL2A1-      gagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2I3HBP6_BCL2A1-      gagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2K5KAA3_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaat
A0A2K6AD27_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A0D9RRC3_BCL2A1-      gagtgctacaaaaggttgcatcctcagtccaaaaagaagtggaaaagaat
A0A2K6LV19_BCL2A1-      gagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaat
A0A2K6PHF2_BCL2A1-      gagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaat
A0A2K5KHH8_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A096NMX5_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K6DS18_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K5KHH8_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K5TMD1_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
F7E8V5_BCL2A1-01        gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K5KAA3_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaggaagaagtggaaaagaat
A0A2K6LV19_BCL2A1-      gagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaat
A0A2K6PHF2_BCL2A1-      gagtgctacaaaaggttgcattctcagtccagaaagaagtggaaaagaat
A0A2K6AD27_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A096NMX5_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K5TMD1_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
A0A2K6DS18_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaat
B4E1X9_BCL2A1-01        gagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2R8ZJX9_BCL2A1-      gagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaat
A0A2I2YML2_BCL2A1-      gagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaat
Q16548_BCL2A1-01        gagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2I2YML2_BCL2A1-      gagtgctacaaaaggttgcgttctcagtccaaaaagaagtggaaaagaat
A0A2R8ZJX9_BCL2A1-      gagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaat
F7HXW0_BCL2A1-01        gagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagt
A0A2K6TLJ5_BCL2A1-      gagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagt
A0A2K6TLJ5_BCL2A1-      gagtactacaaaaggttgcattctcagtccaaaaggaagtggaagagagt
A0A2K5D2I1_BCL2A1-      gggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagt
A0A2K5D2I1_BCL2A1-      gggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagt
A0A2K5PYQ3_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaa------------------
A0A2K5PYQ3_BCL2A1-      gagtgctacaaaaggttgcattctcagtccaa------------------
A0A286XUI2_BCL2A1-      aggtgctgcaggacatggccctttccgtccaggaagaggtggagaggcgg
M3WHW2_BCL2A1-01        aagtgctacaagacgtggccttctcggtccagggggaggtcgagaagaag
M3YVH4_BCL2A1-01        gggtcctgcgggacgtggcctcctccgtgcagggggaggtggaacagaac
U6CQS8_BCL2A1-01        gggtcctgcgggacgtggcctcctccgtgcagcgggaggtggaacagaac
A0A5F4CJR7_BCL2A1-      gggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaac
A0A5F4CJR7_BCL2A1-      gggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaac
A0A452U285_BCL2A1-      aggtgctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaac
A0A452SIR9_BCL2A1-      aggtgctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaac
A0A452U285_BCL2A1-      aggtgctgcgggacgtggcctcctccgtgcagggggaggtggaaaagaac
                                                                          

A0A452J3N6_BCL2A1-      ctgaaaccatgtttggacacatttgatattacctctgtagatgctgccag
K7G130_BCL2A1-01        ctgaaaccatgtttggacacacttgatattacctctgtagatgctgccag
U3JTB2_BCL2A1-01        ctcaggccactcctggacaggattgacatcacctcagtagctgttgccaa
A0A218V8Z6_BCL2A1-      gtcaggccactcctggacaggattgacatcagctctgtagctgttgccaa
H0ZCL9_BCL2A1-01        gtcaggccgctcctggacaggattgacatcacctctgtagcggctgccaa
A0A493SSZ7_BCL2A1-      ctcagacccttcctggacaggattgatatcagttctgtagatgttgccaa
Q9W6F2_BCL2A1-01        ctcagacccttcttggacaggatcgatattacctccgtagatgttgccaa
G1N8C5_BCL2A1-01        ctcagacccttcttggacaggatcgatatcacctctgtagatgttgccaa
F6S8G3_BCL2A1-01        ctgaagccgtgcttcgacagtctcgacgttggctcggtaggggcagccag
F6SFL4_BCL2A1-01        atggaaacatgcttgagcactttggacatcgtttctgtagagtctgccag
G3WSP8_BCL2A1-01        atggaaacattcttgagcactttggacattacttctgtagattgtgccag
A0A4X2KFL7_BCL2A1-      atggaaacatgcttgagcactttggatattgcttctgtagattctgccag
A0A5F9CXI7_BCL2A1-      ------------------actgcgccagtcccgcc---------------
A0A5F9CXI7_BCL2A1-      ctgcaaccgtacctgcacaatgtgcctgtcgcgtccgtcgagactgccag
A0A5F9CXI7_BCL2A1-      ctgcaaccgtacctgcacaatgtgcctgtcgcgtccgtcgagactgccag
A0A3L7HT14_BCL2A1-      -----------------------------gagggcgatgggcgtggccgg
A0A3L7HT14_BCL2A1-      ctgaaactatacttggatgattttgatgtgagatccatcgacactgccag
A0A3L7HT14_BCL2A1-      ctgaaactatacttggatgattttgatgtgagatccatcgacactgccag
G3GTB4_BCL2A1-01        ctgaaactatacttggatgattttgatgtgagatccatcgacactgccag
G3V977_BCL2A1-01        ctgaagccatacttggatgactttcacgtggaatccatagatactgccag
Q925A9_BCL2A1-01        ctgaagccatacttggatgactttcacgtggaatccatagatactgccag
O55178_BCL2A1-01        ctaaagtcatacttggatgactttcacgtggaatccatagataccaccag
Q0P538_BCL2A1-01        ctaaagtcatacttggatgactttcacgtggaatccatagataccaccag
Q07440_BCL2A1-01        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
O55179_BCL2A1-01        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
Q8K164_BCL2A1-01        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
Q4FK02_BCL2A1-01        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
O55177_BCL2A1-02        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
Q497M6_BCL2A1-01        ctgaagtcatacttggatgactttcacgtggaatccatagataccgccag
A0A2K6EKG1_BCL2A1-      ctgaaagcatgcttggacaatgttaatgtggcgtccatagatgccgccag
I3MCZ7_BCL2A1-01        ctgaaaccattcttggacaattttgatgtggtgtctgctgatactgccag
A0A4W2DYC0_BCL2A1-      ctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccag
A0A4W2DYC0_BCL2A1-      ctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccag
Q3C2I0_BCL2A1-01        ctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccag
L8IZT5_BCL2A1-01        ctgaagcagtgcttggataagtttgatgtggtgtccgtagacactgccag
A0A452EK63_BCL2A1-      ttgaagcagtgcttggataagtttgatgtggtgtctgtagacactgccag
W5Q0N6_BCL2A1-01        ctgaagcagtgcttggataagtttgatgtggtgtctgtagacactgccag
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        ttgaaaccctgcttggacaattttgttgtcatctccattgataccgccca
A0A4X1UP21_BCL2A1-      ttgaaaccatgcttggacaattttgatgttgtgtccatagacactgccag
A0A4X1UP21_BCL2A1-      ttgaaaccatgcttggacaattttgatgttgtgtccatagacactgccag
C7F841_BCL2A1-01        ttgaaaccatgcttggacaattttgatgttgtgtccatagacactgccag
A0A4X1UP21_BCL2A1-      ttgaaaccatgcttggacaattttgatgttgtgtccatagacactgccag
H0WZ23_BCL2A1-01        ctgaaaccatgcttagacaattttaatgttgtatccatagatactgccag
H2NNZ9_BCL2A1-01        ctgaagccatgcttggacaacgttaatgttgtgtccgtagacactgccag
A0A2I3HBP6_BCL2A1-      ctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgccag
A0A2I3HBP6_BCL2A1-      ctgaagccgtgcttggacaatgttaatgttgtgtccatagacactgccag
A0A2K5KAA3_BCL2A1-      ctgaagccgtgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6AD27_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A0D9RRC3_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6LV19_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6PHF2_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K5KHH8_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A096NMX5_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6DS18_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K5KHH8_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K5TMD1_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
F7E8V5_BCL2A1-01        ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K5KAA3_BCL2A1-      ctgaagccgtgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6LV19_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6PHF2_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6AD27_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A096NMX5_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K5TMD1_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
A0A2K6DS18_BCL2A1-      ctgaagccatgcttggacaatgttaatgttgcatccatagacactgccag
B4E1X9_BCL2A1-01        ctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgccag
A0A2R8ZJX9_BCL2A1-      ctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgccag
A0A2I2YML2_BCL2A1-      ctgaagtcatgcttggacaatgttaatgttgtgtccatagacactgccag
Q16548_BCL2A1-01        ctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgccag
A0A2I2YML2_BCL2A1-      ctgaagtcatgcttggacaatgttaatgttgtgtccatagacactgccag
A0A2R8ZJX9_BCL2A1-      ctgaagtcatgcttggacaatgttaatgttgtgtctgtagacactgccag
F7HXW0_BCL2A1-01        ctgaagtcatgcttggacaatgttgatattgcgtccatagataatgccag
A0A2K6TLJ5_BCL2A1-      ctgaagccatgcttggacaacgttcatattgtgtccatggacaatgccag
A0A2K6TLJ5_BCL2A1-      ctgaagccatgcttggacaacgttcatattgtgtccatggacaatgccag
A0A2K5D2I1_BCL2A1-      ctgaagccatgcttggacaatgttaatattgtgtccatagataatgccag
A0A2K5D2I1_BCL2A1-      ctgaagccatgcttggacaatgttaatattgtgtccatagataatgccag
A0A2K5PYQ3_BCL2A1-      ---aagccatgcttggacaatgttaatattgtgtccatagataatgccag
A0A2K5PYQ3_BCL2A1-      ---aagccatgcttggacaatgttaatattgtgtccatagataatgccag
A0A286XUI2_BCL2A1-      ctgaaaccgtggctggacagaattgacgtggagtccatcgacactgcgaa
M3WHW2_BCL2A1-01        ttgaagccgtgcctggacaagttccatgtggtgtcggtagacacggccag
M3YVH4_BCL2A1-01        ttgagaccatgcttggacagctttgatgtggggtccatcgacactgccag
U6CQS8_BCL2A1-01        ttgaaaccatgcttggacagctttgacgtggggtccatcgacactgccag
A0A5F4CJR7_BCL2A1-      ctgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccag
A0A5F4CJR7_BCL2A1-      ctgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccag
A0A452U285_BCL2A1-      ttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactccgccag
A0A452SIR9_BCL2A1-      ttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactccgccag
A0A452U285_BCL2A1-      ttgaaaccatgcctggacagtttcgatgtggtgtccgtcgactccgccag
                                                                          

A0A452J3N6_BCL2A1-      aagaattttcactcaagtcatggataaagaatttgctgatggaaacacta
K7G130_BCL2A1-01        aagaattttcattcaagtcatggataaagaatttgatgatggaaacacta
U3JTB2_BCL2A1-01        gagaattttcaatggagtcatggatgaaaagtttgctgatggaaatacta
A0A218V8Z6_BCL2A1-      gagaattttcaatggagtcatggatgaaaagtttgctgatggaaatacta
H0ZCL9_BCL2A1-01        gagaattttcaatggagtcatggatgaaaagtttgctgatggaaatacta
A0A493SSZ7_BCL2A1-      gagaattttcaatggtgtcatggatgaaaaatttgctgatggaaatacta
Q9W6F2_BCL2A1-01        gagaattttcaatggagtcatggaagaaaaatttgctgatggaaatacta
G1N8C5_BCL2A1-01        gagaattttcaatggagtcatggaagaaaaatttgctgacggaaatacta
F6S8G3_BCL2A1-01        aagaatcttcggccaaattgtggaaaaggagttcgaggacggcatcgtca
F6SFL4_BCL2A1-01        aagaattttcaatagtgttatgaagaaggaatttgaggatggcgtcatta
G3WSP8_BCL2A1-01        aagaattttcaacagtgttatggaaaaggaatttgaggatggcatcatca
A0A4X2KFL7_BCL2A1-      aagaattttcaaaagcgttatggaaaaggaatttgaggatggcattatta
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gacaattttcaaccaagtgatggagaaagagtttgaggatggtgtgatca
A0A5F9CXI7_BCL2A1-      gacaattttcaaccaagtgatggagaaagagtttgaggatggtgtgatca
A0A3L7HT14_BCL2A1-      ggcggtactt-gccacgtgatggcggcgg---tggcagcaagcagcgcca
A0A3L7HT14_BCL2A1-      aacaatattcaatcaagtgatggaaaaagaatttgaagatggcatcatta
A0A3L7HT14_BCL2A1-      aacaatattcaatcaagtgatggaaaaagaatttgaagatggcatcatta
G3GTB4_BCL2A1-01        aacaatattcaatcaagtgatggaaaaagaatttgaagatggcatcatta
G3V977_BCL2A1-01        aataatattcaaccaagtgatggaaaaagaatttgaagatggcatcatta
Q925A9_BCL2A1-01        aataatattcaaccaagtgatggaaaaagaatttgaagatggcatcatta
O55178_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
Q0P538_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaaaatggcatcatta
Q07440_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
O55179_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
Q8K164_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
Q4FK02_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
O55177_BCL2A1-02        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
Q497M6_BCL2A1-01        aataatattcaaccaagtgatggaaaaagagtttgaagatggcatcatta
A0A2K6EKG1_BCL2A1-      aacgatattcaatcaagtgatggaaaaggaatttgaagatggcatcgtta
I3MCZ7_BCL2A1-01        aacaatattcaatcaagtgatggaaaaggaatttgaagatggcatcatga
A0A4W2DYC0_BCL2A1-      aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
A0A4W2DYC0_BCL2A1-      aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
Q3C2I0_BCL2A1-01        aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
L8IZT5_BCL2A1-01        aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
A0A452EK63_BCL2A1-      aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
W5Q0N6_BCL2A1-01        aacaatattcaaccaagtgatggaaaaggaatttgaagatggcattgtta
A0A4W2DYC0_BCL2A1-      -------------------atggaaaaggaatttgaagatggcattgtta
A0A4W2DYC0_BCL2A1-      -------------------atggaaaaggaatttgaagatggcattgtta
G3T8E6_BCL2A1-01        aacaatattcaagcaagtgatggaaaaggaatttgaagatggcatcatta
A0A4X1UP21_BCL2A1-      aataatattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
A0A4X1UP21_BCL2A1-      aataatattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
C7F841_BCL2A1-01        aataatattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
A0A4X1UP21_BCL2A1-      aataatattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
H0WZ23_BCL2A1-01        aacaatattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
H2NNZ9_BCL2A1-01        aacactattcaaccaagtaatggaaaaggagtttgaagatggcatcatta
A0A2I3HBP6_BCL2A1-      aacactattcaaccaagtgatggaaaaggagtttgaagatggcatcatta
A0A2I3HBP6_BCL2A1-      aacactattcaaccaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K5KAA3_BCL2A1-      aacaatattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6AD27_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A0D9RRC3_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6LV19_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6PHF2_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K5KHH8_BCL2A1-      aacactattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
A0A096NMX5_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6DS18_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K5KHH8_BCL2A1-      aacactattcaatcaagtgatggaaaaggaatttgaagatggcatcatta
A0A2K5TMD1_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
F7E8V5_BCL2A1-01        aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K5KAA3_BCL2A1-      aacaatattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6LV19_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6PHF2_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6AD27_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A096NMX5_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K5TMD1_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
A0A2K6DS18_BCL2A1-      aacactattcaatcaagtgatggaaaaggagtttgaagatggcatcatta
B4E1X9_BCL2A1-01        aacactattcaaccaagtgatggaaaaggagtttgaagacggcatcatta
A0A2R8ZJX9_BCL2A1-      aacactattcaaccaagtgatggaaaaggagtttgaagatggcatcatta
A0A2I2YML2_BCL2A1-      aacactgttcaaccaagtgatggaaaaggagtttgaagacggcatcatta
Q16548_BCL2A1-01        aacactattcaaccaagtgatggaaaaggagtttgaagacggcatcatta
A0A2I2YML2_BCL2A1-      aacactgttcaaccaagtgatggaaaaggagtttgaagacggcatcatta
A0A2R8ZJX9_BCL2A1-      aacactattcaaccaagtgatggaaaaggagtttgaagatggcatcatta
F7HXW0_BCL2A1-01        aacgatattcagtcaagtgatggaaaaggaatttgaagatggcattatta
A0A2K6TLJ5_BCL2A1-      aacaatattcagtcaagtgatggaaaaggaatttgaagatggcattatta
A0A2K6TLJ5_BCL2A1-      aacaatattcagtcaagtgatggaaaaggaatttgaagatggcattatta
A0A2K5D2I1_BCL2A1-      aatgatattcagtcaagtgatggaaaaggaatttgaagatggcattatta
A0A2K5D2I1_BCL2A1-      aatgatattcagtcaagtgatggaaaaggaatttgaagatggcattatta
A0A2K5PYQ3_BCL2A1-      aacgatattcagtcaagtgatggaaacggaatttgaagatggcattatta
A0A2K5PYQ3_BCL2A1-      aacgatattcagtcaagtgatggaaacggaatttgaagatggcattatta
A0A286XUI2_BCL2A1-      gtcgatattcaaccaagtgatggagaaggagttcgaggatggcatcatta
M3WHW2_BCL2A1-01        gacgatattccaccaagtgatggaaaaggaatttgaagacggcatcatta
M3YVH4_BCL2A1-01        aaccatcttcaatcaagtcatggaaaaggaatttgaagacggcatcatta
U6CQS8_BCL2A1-01        aaccatcttcaatcaagtcatggaaaaggaatttgaagacggcatcatta
A0A5F4CJR7_BCL2A1-      aaccatattcaatcaggtgatggagaaggaatttgaagacggcgtcatta
A0A5F4CJR7_BCL2A1-      aaccatattcaatcaggtgatggagaaggaatttgaagacggcgtcatta
A0A452U285_BCL2A1-      aaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcatta
A0A452SIR9_BCL2A1-      aaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcatta
A0A452U285_BCL2A1-      aaccatattcaatcaggtcatggaaaaggaatttgaagacggcatcatta
                                                                          

A0A452J3N6_BCL2A1-      actgggg---acggattttgacaatatttatgtttggaggaattctttct
K7G130_BCL2A1-01        actgggg---gcggattttgacaatatttatgtttggaggaattctttct
U3JTB2_BCL2A1-01        actgggg---acgaattatgaccatatttacatttggaggtcttctcacc
A0A218V8Z6_BCL2A1-      actgggg---acgaattatgaccatctttacgtttggaggtcttctcacc
H0ZCL9_BCL2A1-01        actgggg---acgaatcatgaccatctttacatttggaggtcttctcacc
A0A493SSZ7_BCL2A1-      attgggg---aagaattacgaccatatttacttttgggggtcttctcact
Q9W6F2_BCL2A1-01        actgggg---acgaattatgaccatatttacttttggaggtcttctcacc
G1N8C5_BCL2A1-01        actgggg---acgaattatgaccatatttacttttggaggtcttctcacc
F6S8G3_BCL2A1-01        actgggg---gcggattgtgacgatatttgtcttggggggcattctcacc
F6SFL4_BCL2A1-01        actgggg---acggattgtcaccatatttgcttttgggggaattctcatc
G3WSP8_BCL2A1-01        actgggg---acggattgtcaccatatttgcttttgggggaattctcatt
A0A4X2KFL7_BCL2A1-      actgggg---acgtattgtcaccatatttgcttttgggggaattctcatc
A0A5F9CXI7_BCL2A1-      ------------------------------------------tactgacc
A0A5F9CXI7_BCL2A1-      actgggg---caggattgtgaccatatttgcattcgaaggggtcctggcc
A0A5F9CXI7_BCL2A1-      actgggg---caggattgtgaccatatttgcattcgaaggggtcctggcc
A0A3L7HT14_BCL2A1-      agcggagcctgcgggccgag-ctgaagcagcgtttgcgggcctt------
A0A3L7HT14_BCL2A1-      actgggg---gaggattgtgactgtatttgcctttgggggtgttctcctc
A0A3L7HT14_BCL2A1-      actgggg---gaggattgtgactgtatttgcctttgggggtgttctcctc
G3GTB4_BCL2A1-01        actgggg---gaggattgtgactgtatttgcctttgggggtgttctcctc
G3V977_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctg
Q925A9_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctg
O55178_BCL2A1-01        attgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
Q0P538_BCL2A1-01        attgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
Q07440_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
O55179_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
Q8K164_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
Q4FK02_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
O55177_BCL2A1-02        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
Q497M6_BCL2A1-01        actgggg---aaggattgtgactatatttgcctttgggggtgttctcctc
A0A2K6EKG1_BCL2A1-      actgggg---aaggattgtgaccgtgtttgcattcggaggtattctcatc
I3MCZ7_BCL2A1-01        actgggg---aaggattgtgaccatatttgccttcggaggagttctggtc
A0A4W2DYC0_BCL2A1-      actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
A0A4W2DYC0_BCL2A1-      actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
Q3C2I0_BCL2A1-01        actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
L8IZT5_BCL2A1-01        actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
A0A452EK63_BCL2A1-      actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
W5Q0N6_BCL2A1-01        actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
A0A4W2DYC0_BCL2A1-      actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
A0A4W2DYC0_BCL2A1-      actgggg---caggattgtaaccatattcgcctttgaaggtattcttacc
G3T8E6_BCL2A1-01        actgggg---aagaattgtgaccatatttgcatttggaggtattctcatc
A0A4X1UP21_BCL2A1-      actgggg---aaggattgtgaccatatttgcatttgaaggtattctcatg
A0A4X1UP21_BCL2A1-      actgggg---aaggattgtgaccatatttgcatttgaaggtattctcatg
C7F841_BCL2A1-01        actgggg---aaggattgtgaccatatttgcatttgaaggtattctcatg
A0A4X1UP21_BCL2A1-      actgggg---aaggattgtgaccatatttgcatttgaaggtattctcatg
H0WZ23_BCL2A1-01        actgggg---caggattgtgacaatatttgcctttggaggtattctcctc
H2NNZ9_BCL2A1-01        actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I3HBP6_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcgtc
A0A2I3HBP6_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcgtc
A0A2K5KAA3_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6AD27_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A0D9RRC3_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6LV19_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6PHF2_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5KHH8_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A096NMX5_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6DS18_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5KHH8_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5TMD1_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
F7E8V5_BCL2A1-01        actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5KAA3_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6LV19_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6PHF2_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6AD27_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A096NMX5_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5TMD1_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6DS18_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
B4E1X9_BCL2A1-01        actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2R8ZJX9_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I2YML2_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
Q16548_BCL2A1-01        actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2I2YML2_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2R8ZJX9_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
F7HXW0_BCL2A1-01        actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6TLJ5_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K6TLJ5_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5D2I1_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5D2I1_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5PYQ3_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5PYQ3_BCL2A1-      actgggg---aagaattgtaaccatatttgcatttgaaggtattctcatc
A0A286XUI2_BCL2A1-      actgggg---acggattgtgactatctttgcttttgggggggtcatcctc
M3WHW2_BCL2A1-01        actgggg---caggattgtgactatatttgcgtttgagggcatcctcatc
M3YVH4_BCL2A1-01        actgggg---gaggattgtgaccgtgtttgcctttgaaggcattctctcc
U6CQS8_BCL2A1-01        actgggg---gaggattgtgaccgtatttgcctttgaaggcattctctcc
A0A5F4CJR7_BCL2A1-      actgggg---aaggatcgtgaccgtttttgcctttgaaggaattctcacc
A0A5F4CJR7_BCL2A1-      actgggg---aaggatcgtgaccgtttttgcctttgaaggaattctcacc
A0A452U285_BCL2A1-      actgggg---aagaattgtgaccatatttgcgttcgaagggattctcacc
A0A452SIR9_BCL2A1-      actgggg---aagaattgtgaccatatttgcgttcgaagggattctcacc
A0A452U285_BCL2A1-      actgggg---aagaattgtgaccatatttgcgttcgaagggattctcacc
                                                                  *       

A0A452J3N6_BCL2A1-      -aagaagcttcaagaacacagagttcagcttacagga-gaaaataaaaag
K7G130_BCL2A1-01        -aagaggcttcaagaacacaaagttcagcttacagga-gataataaagag
U3JTB2_BCL2A1-01        -aagaagcttcaagagcatggggttcagctgactgca-gaggagaaggag
A0A218V8Z6_BCL2A1-      -aagaagcttcaagagcatggggttcagctgactgca-gaagagaaggag
H0ZCL9_BCL2A1-01        -aagaagcttcaagagcatggggttcagctgactgca-gaggagaaggag
A0A493SSZ7_BCL2A1-      -aagaagcttcaagaacatggagttcagctcactgga-gagaagaaggag
Q9W6F2_BCL2A1-01        -aagaagcttcaagagcacggagttcagctcactgga-gaggagaaggag
G1N8C5_BCL2A1-01        -aagaagcttcaagagcagggagttcagctcactgga-gaggagaaggag
F6S8G3_BCL2A1-01        -aagaagctcc-aaaggagcggagtcccgctgacgagagagactcgggag
F6SFL4_BCL2A1-01        -aagaagcttctgagacatagagctccactgactatg-ggcactcaggaa
G3WSP8_BCL2A1-01        -aagaaacttctgagacacagagctccactgactatg-gacactcatgaa
A0A4X2KFL7_BCL2A1-      -aagaaacttctgagacatagatctccactgactatg-agtactcatgaa
A0A5F9CXI7_BCL2A1-      -cagaa--------------------------------------------
A0A5F9CXI7_BCL2A1-      -aagaagctcctccaggagcaggctgttccggatgtg-gacacgttcaag
A0A5F9CXI7_BCL2A1-      -aagaagctcctccaggagcaggctgttccggatgtg-gacacgttcaag
A0A3L7HT14_BCL2A1-      --------------gagcgcgga--ggaacggctgcg-g-----------
A0A3L7HT14_BCL2A1-      -aaaaaacttgcacaagagcagattggcttggatgtg-ggtgcttacaag
A0A3L7HT14_BCL2A1-      -aaaaaacttgcacaagagcagattggcttggatgtg-ggtgcttacaag
G3GTB4_BCL2A1-01        -aaaaaacttgcacaagagcagattggcttggatgtg-ggtgcttacaag
G3V977_BCL2A1-01        -aaaaagcttccacaagagcagattgccctggatgtg-gatacttacaag
Q925A9_BCL2A1-01        -aaaaagcttccacaagagcagattggcctggatgtg-gatacttacaag
O55178_BCL2A1-01        aaaaaaacttccacaagagcagattgccctggatgta-cgtgcttacaaa
Q0P538_BCL2A1-01        aaaaaaacttccacaagagcagattgccctggatgta-cgtgcttacaaa
Q07440_BCL2A1-01        -aaaaaacttccacaagagcagattgccctggatgta-tgtgcttacaaa
O55179_BCL2A1-01        -aaaaaacttccacaagagcagattgccctggatgta-ggtgcttacaaa
Q8K164_BCL2A1-01        -aaaaaacttccgcaagagcagattgccctggatgta-ggtgcttacaaa
Q4FK02_BCL2A1-01        -aaaaaacttccgcaagagcagattgccctggatgta-ggtgcttacaaa
O55177_BCL2A1-02        -aaaaaacttccgcaagagcagattgccctggatgta-ggtgcttacaaa
Q497M6_BCL2A1-01        -aaaaaacttccgcaagagcagattgccctggatgta-ggtgcttacaaa
A0A2K6EKG1_BCL2A1-      -aagaaacttctacgagagcagattgccctggatgtg-gatacttacaag
I3MCZ7_BCL2A1-01        -aagaaacttctgcgagagcggattgcccctgctgtg-gattccgatgag
A0A4W2DYC0_BCL2A1-      -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
A0A4W2DYC0_BCL2A1-      -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
Q3C2I0_BCL2A1-01        -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
L8IZT5_BCL2A1-01        -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
A0A452EK63_BCL2A1-      -aagaaacttctgagcaagcgtattgcctcagacatg-gacatgtgcaag
W5Q0N6_BCL2A1-01        -aagaaacttctgagcaagcgtattgcctcagacatg-gacatgtgcaag
A0A4W2DYC0_BCL2A1-      -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
A0A4W2DYC0_BCL2A1-      -aagaaacttctgggcaagtgtattgcctcagacatg-gacatgtgcaag
G3T8E6_BCL2A1-01        -aagaaacttctaagggagcgaattgccccagatgtg-gatacttacaag
A0A4X1UP21_BCL2A1-      -aagaaacttctgcgaaagcgaattgccccagatgtg-gacacgtacaag
A0A4X1UP21_BCL2A1-      -aagaaacttctgcgaaagcgaattgccccagatgtg-gacacgtacaag
C7F841_BCL2A1-01        -aagaaacttctgcgaaagcgaattgccccagatgtg-gacacgtacaag
A0A4X1UP21_BCL2A1-      -aagaaacttctgcgaaagcgaattgccccagatgtg-gacacgtacaag
H0WZ23_BCL2A1-01        -aagaaacttctccaacagcgaattgccctggatgtg-gatacttataag
H2NNZ9_BCL2A1-01        -aagaaacttctacgacagcaaattgccccggatgtg-gatacttacaag
A0A2I3HBP6_BCL2A1-      -aagaaacttctacgacagcgaactgccccggatgtg-gatacttacaag
A0A2I3HBP6_BCL2A1-      -aagaaacttctacgacagcgaactgccccggatgtg-gatacttacaag
A0A2K5KAA3_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K6AD27_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A0D9RRC3_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K6LV19_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
A0A2K6PHF2_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
A0A2K5KHH8_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A096NMX5_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K6DS18_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K5KHH8_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K5TMD1_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
F7E8V5_BCL2A1-01        -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K5KAA3_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K6LV19_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
A0A2K6PHF2_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
A0A2K6AD27_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A096NMX5_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K5TMD1_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
A0A2K6DS18_BCL2A1-      -aagaaacttctacgacagcgaattgccccggatgtg-gatacttataag
B4E1X9_BCL2A1-01        -aagaaacttctacgacagcaaattgccccggatgtg-gatacctataag
A0A2R8ZJX9_BCL2A1-      -aagaaacttctacgacagcagattgccccggatgtg-gatacttataag
A0A2I2YML2_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
Q16548_BCL2A1-01        -aagaaacttctacgacagcaaattgccccggatgtg-gatacctataag
A0A2I2YML2_BCL2A1-      -aagaaacttctacgacagcaaattgccccggatgtg-gatacttataag
A0A2R8ZJX9_BCL2A1-      -aagaaacttctacgacagcagattgccccggatgtg-gatacttataag
F7HXW0_BCL2A1-01        -aagaaacttctacgagagcgaattgccccggatgtg-gatacttacaag
A0A2K6TLJ5_BCL2A1-      -aagaaacttctacgagagcgaattgccccggatgtg-gatacttacaag
A0A2K6TLJ5_BCL2A1-      -aagaaacttctacgagagcgaattgccccggatgtg-gatacttacaag
A0A2K5D2I1_BCL2A1-      -aagaaacttctacgagagcgaattgccccggatgtg-gatacttacaag
A0A2K5D2I1_BCL2A1-      -aagaaacttctacgagagcgaattgccccggatgtg-gatacttacaag
A0A2K5PYQ3_BCL2A1-      -aagaaacttctacaagagcgaattgccccggatgtg-gatacttataag
A0A2K5PYQ3_BCL2A1-      -aagaaacttctacaagagcgaattgccccggatgtg-gatacttataag
A0A286XUI2_BCL2A1-      -aagaaactcccacgagagccaatcgccccagatgtg-gacacttacaag
M3WHW2_BCL2A1-01        -aagaagcttctccaggagcggatcgtcccagacgcg-gatgcgtttaag
M3YVH4_BCL2A1-01        -aagaagctcctccgggagcgaatttccccggacgtg-gatgcttccagg
U6CQS8_BCL2A1-01        -aagaagctcctccgggagcgaatttccccggacgtg-gatgcttccagg
A0A5F4CJR7_BCL2A1-      -aagaaactcctcgagcagcgaatttcctcggatgtg-gatgccgagaag
A0A5F4CJR7_BCL2A1-      -aagaaactcctcgagcagcgaatttcctcggatgtg-gatgccgagaag
A0A452U285_BCL2A1-      -aagaaactcctccaggagcgaatctccccggatgtg-gacgcttctagg
A0A452SIR9_BCL2A1-      -aagaaactcctccaggagcgaatctccccggatgtg-gacgcttctagg
A0A452U285_BCL2A1-      -aagaaactcctccaggagcgaatctccccggatgtg-gacgcttctagg
                                                                          

A0A452J3N6_BCL2A1-      cagatttcttatttcatcacagagtacattataaacaccaaggctgagtg
K7G130_BCL2A1-01        cagatttcttatttcatcacggagtacattataaacaccaaggctgaatg
U3JTB2_BCL2A1-01        gagatctcttatttcatcacagagtacatcatcaacaacaaatccgaatg
A0A218V8Z6_BCL2A1-      gagatctcttatttcatcacagagtacatcataaacaacaaagccgaatg
H0ZCL9_BCL2A1-01        cagatttcttatttcatcacggagtacatcataaacaacaaagctgaatg
A0A493SSZ7_BCL2A1-      cagatctcttatttcatcacagagtacatcataaacaataaagccgaatg
Q9W6F2_BCL2A1-01        aagatttcttatttcatcacagagtacatcataaataacaaagccgcatg
G1N8C5_BCL2A1-01        cagatttcttatttcatcacagagtacatcataaataacaaagccgcatg
F6S8G3_BCL2A1-01        gagatttcttgtttcatcgcggagttcaccacccaccacgccggagagtg
F6SFL4_BCL2A1-01        gaaatttctcattttattgccgagttcataatgaacaatatagcagagtg
G3WSP8_BCL2A1-01        gaaatttctcattttattgctgagttcataatgaacaacatagcagaatg
A0A4X2KFL7_BCL2A1-      gaagtttcttattttattgctgagttcataatgaacaacatagcagagtg
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      tccatcccttattttgtggctgagttcataacgaggaggatgggagaatg
A0A5F9CXI7_BCL2A1-      tccatcccttattttgtggctgagttcataacgaggaggatgggagaatg
A0A3L7HT14_BCL2A1-      -cagtctc--------------acctcctcacg-----------------
A0A3L7HT14_BCL2A1-      caagtttccaattttgtggctgaattcataatgaataacacagcagagtg
A0A3L7HT14_BCL2A1-      caagtttccaattttgtggctgaattcataatgaataacacagcagagtg
G3GTB4_BCL2A1-01        caagtttccaattttgtggctgaattcataatgaataacacagcagagtg
G3V977_BCL2A1-01        caagtttccagttttgtggcggaattcataatgaataacacaggagaatg
Q925A9_BCL2A1-01        caagtttccagttttgtggcggaattcataatgaataacacaggagaatg
O55178_BCL2A1-01        caagtttccagttttggggcagaattcataatgaataa------------
Q0P538_BCL2A1-01        caagtttccagttttggggcagaattcatcatgaataa------------
Q07440_BCL2A1-01        caagtttccagttttgtggcagaattcataatgaataacacaggagaatg
O55179_BCL2A1-01        caagtttccagttttgtggcagaattcataatgaataacacaggagaatg
Q8K164_BCL2A1-01        caagtttccagttttgtggcagaattcataatcaataacacaggagaatg
Q4FK02_BCL2A1-01        caagtttccagttttgtggcagaattcataatcaataacacaggagaatg
O55177_BCL2A1-02        caagtttccagttttgtggcagaattcataatcaataacacaggagaatg
Q497M6_BCL2A1-01        caagtttccagttttgtggcagaattcataatcaataacacaggagaatg
A0A2K6EKG1_BCL2A1-      gagatttcttattttattgctgagttcataacgaataacgcaggagagtg
I3MCZ7_BCL2A1-01        gagatctcttactttgtggctgagttcattatgaataatgcaggagaatg
A0A4W2DYC0_BCL2A1-      gacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtg
A0A4W2DYC0_BCL2A1-      gacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtg
Q3C2I0_BCL2A1-01        gacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtg
L8IZT5_BCL2A1-01        gacatttcttactttgtggcggagttcatcaccgaaaatacaggagagtg
A0A452EK63_BCL2A1-      gacatttcttatttcgtggcggagtttatcaccgaaaacacaggagagtg
W5Q0N6_BCL2A1-01        gacatttcttatttcgtggcggagttcatcaccaaaaacacaggagagtg
A0A4W2DYC0_BCL2A1-      gacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtg
A0A4W2DYC0_BCL2A1-      gacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtg
G3T8E6_BCL2A1-01        aagatttcttcttttgttgctgagttcatagtggataacacagcagagtg
A0A4X1UP21_BCL2A1-      gagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtg
A0A4X1UP21_BCL2A1-      gagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtg
C7F841_BCL2A1-01        gagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtg
A0A4X1UP21_BCL2A1-      gagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtg
H0WZ23_BCL2A1-01        gagatttcttattttgttgctgagttcataatgaattacacaggagaatg
H2NNZ9_BCL2A1-01        gagatttcatattttgttgcggagttcgtcatgaataacacaggaggatg
A0A2I3HBP6_BCL2A1-      gagatttcgtattttgttgcagagttcataatgaataacacaggagaatg
A0A2I3HBP6_BCL2A1-      gagatttcgtattttgttgcagagttcataatgaataacacaggagaatg
A0A2K5KAA3_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6AD27_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacactggagaatg
A0A0D9RRC3_BCL2A1-      gagatttcgtattttgttgctgagttcataacgaataacacaggagaatg
A0A2K6LV19_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6PHF2_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5KHH8_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A096NMX5_BCL2A1-      gagatttcatattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6DS18_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5KHH8_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5TMD1_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
F7E8V5_BCL2A1-01        gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5KAA3_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6LV19_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6PHF2_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6AD27_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacactggagaatg
A0A096NMX5_BCL2A1-      gagatttcatattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5TMD1_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6DS18_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
B4E1X9_BCL2A1-01        gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
A0A2R8ZJX9_BCL2A1-      gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
A0A2I2YML2_BCL2A1-      gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
Q16548_BCL2A1-01        gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
A0A2I2YML2_BCL2A1-      gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
A0A2R8ZJX9_BCL2A1-      gagatttcatattttgttgcggagttcataatgaataacacaggagaatg
F7HXW0_BCL2A1-01        gagatctcacattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6TLJ5_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K6TLJ5_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5D2I1_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5D2I1_BCL2A1-      gagatttcgtattttgttgctgagttcataatgaataacacaggagaatg
A0A2K5PYQ3_BCL2A1-      gagatttcgtattttgttgctgagtacataatgaataacacaggagaatg
A0A2K5PYQ3_BCL2A1-      gagatttcgtattttgttgctgagtacataatgaataacacaggagaatg
A0A286XUI2_BCL2A1-      gagatttcctacttcgtggctgagttcataatgagccgcatgggaggctg
M3WHW2_BCL2A1-01        g---tttcctactttgtcgccgagttcatcacgaaacacacgggagaatg
M3YVH4_BCL2A1-01        g---tttcttactttgtggcagagttcatcacgacaaacatgagggagtg
U6CQS8_BCL2A1-01        g---tttcttactttgtggcagagttcatcacgacaaacatgagggagtg
A0A5F4CJR7_BCL2A1-      g---tttcctacttcgtggcagagttcatcacgagaaacatgagagactg
A0A5F4CJR7_BCL2A1-      g---tttcctacttcgtggcagagttcatcacgagaaacatgagagactg
A0A452U285_BCL2A1-      a---tttcttacttcgtggcggagttcatcacgacaaacatgagagagtg
A0A452SIR9_BCL2A1-      a---tttcttacttcgtggcagagttcatcacgacaaacatgagagagtg
A0A452U285_BCL2A1-      a---tttcttacttcgtggcggagttcatcacgacaaacatgagagagtg
                                                                          

A0A452J3N6_BCL2A1-      gatagaggcaaatggaggttggg---------------------------
K7G130_BCL2A1-01        gatagatgcaaatggaggctggg---------------------------
U3JTB2_BCL2A1-01        gattgatgcaaatggtggctggg---------------------------
A0A218V8Z6_BCL2A1-      gattgatgcaaatggtggctggg---------------------------
H0ZCL9_BCL2A1-01        gattgatgcgaatggtggctggg---------------------------
A0A493SSZ7_BCL2A1-      gatagatgcaaatggtggctggg---------------------------
Q9W6F2_BCL2A1-01        gatagatgcaaacggtggctggg---------------------------
G1N8C5_BCL2A1-01        gatagatgcaaacggtggctggg---------------------------
F6S8G3_BCL2A1-01        gataaggcagaacggaggctggg---------------------------
F6SFL4_BCL2A1-01        gataagacaaaatggaggatggg---------------------------
G3WSP8_BCL2A1-01        gataagacaaaatggaggatggg---------------------------
A0A4X2KFL7_BCL2A1-      gataagacaaaacggaggatggg---------------------------
A0A5F9CXI7_BCL2A1-      ----------------------ggtgattgcccaccggcagtatcagaaa
A0A5F9CXI7_BCL2A1-      gataaggcaaaacggaggct-gggtgattgcccaccggcagtatcagaaa
A0A5F9CXI7_BCL2A1-      gataaggcaaaacggaggct-gggtgattgcccaccggcagtatcagaaa
A0A3L7HT14_BCL2A1-      -------cagaa----------ggtgattgctcacagtcagtatcaaaat
A0A3L7HT14_BCL2A1-      gatacgtcagaatggaggct-gggtgattgctcacagtcagtatcaaaat
A0A3L7HT14_BCL2A1-      gatacgtcagaatggaggct-ggg--------------------------
G3GTB4_BCL2A1-01        gatacgtcagaatggaggct-ggg--------------------------
G3V977_BCL2A1-01        gatacagcagaatggaggct-ggg--------------------------
Q925A9_BCL2A1-01        gatacagcagaatggaggct-ggg--------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        gatacggcagaatggaggtt-ggg--------------------------
O55179_BCL2A1-01        gatacggcggaatggaggtt-ggg--------------------------
Q8K164_BCL2A1-01        gatacggcggaatggaggtt-ggg--------------------------
Q4FK02_BCL2A1-01        gatacggcggaatggaggtt-ggg--------------------------
O55177_BCL2A1-02        gatacggcggaatggaggtt-ggg--------------------------
Q497M6_BCL2A1-01        gatacggcggaatggaggtt-ggg--------------------------
A0A2K6EKG1_BCL2A1-      gatacggcagaacggaggct-gg---------------------------
I3MCZ7_BCL2A1-01        gataaggcaaaatggaggct-gg---------------------------
A0A4W2DYC0_BCL2A1-      gataaagcaaaatggaggct-gg---------------------------
A0A4W2DYC0_BCL2A1-      gataaagcaaaatggaggct-gg---------------------------
Q3C2I0_BCL2A1-01        gataaagcaaaatggaggct-gg---------------------------
L8IZT5_BCL2A1-01        gataaagcaaaatggaggct-gg---------------------------
A0A452EK63_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
W5Q0N6_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A4W2DYC0_BCL2A1-      gataaagcaaaatggaggct-gggtgtttacccataatgaatatcaaaag
A0A4W2DYC0_BCL2A1-      gataaagcaaaatggaggct-gggtgtttacccataatgaatatcaaaag
G3T8E6_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A4X1UP21_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A4X1UP21_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
C7F841_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A4X1UP21_BCL2A1-      gataaggcaaaacggaggct-gggtgattgcccacagtcagtatctaaag
H0WZ23_BCL2A1-01        gataaggcaaaatggaggct-gg---------------------------
H2NNZ9_BCL2A1-01        gataaagcaaaacggaggct-gg---------------------------
A0A2I3HBP6_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2I3HBP6_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K5KAA3_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K6AD27_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A0D9RRC3_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K6LV19_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K6PHF2_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K5KHH8_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A096NMX5_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K6DS18_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K5KHH8_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
A0A2K5TMD1_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
F7E8V5_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A2K5KAA3_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K6LV19_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K6PHF2_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K6AD27_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A096NMX5_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K5TMD1_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2K6DS18_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
B4E1X9_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A2R8ZJX9_BCL2A1-      gataagacaaaacggaggct-gg---------------------------
A0A2I2YML2_BCL2A1-      gataaggcaaaacggaggct-gg---------------------------
Q16548_BCL2A1-01        gataaggcaaaacggaggct-gg---------------------------
A0A2I2YML2_BCL2A1-      gataaggcaaaacggaggctggg---------------------------
A0A2R8ZJX9_BCL2A1-      gataagacaaaacggaggctggg---------------------------
F7HXW0_BCL2A1-01        gataagacaaaacggaggctggg---------------------------
A0A2K6TLJ5_BCL2A1-      gataagacgaaacggaggctggg---------------------------
A0A2K6TLJ5_BCL2A1-      gataagacgaaacggaggctggg---------------------------
A0A2K5D2I1_BCL2A1-      gataagtcaaaacggaggctggg---------------------------
A0A2K5D2I1_BCL2A1-      gataagtcaaaacggaggctggg---------------------------
A0A2K5PYQ3_BCL2A1-      gataagacaaaacggaggct-gg---------------------------
A0A2K5PYQ3_BCL2A1-      gataagacaaaacggaggctggg---------------------------
A0A286XUI2_BCL2A1-      gatacggcagaacggaggct-gg---------------------------
M3WHW2_BCL2A1-01        gatccggcaaaacggaggct-gg---------------------------
M3YVH4_BCL2A1-01        gataagacagaacggaggct-gg---------------------------
U6CQS8_BCL2A1-01        gataagacaaaacggaggct-gg---------------------------
A0A5F4CJR7_BCL2A1-      gataagacaaaacggaggct-gg---------------------------
A0A5F4CJR7_BCL2A1-      gataagacaaaacggaggct-gg---------------------------
A0A452U285_BCL2A1-      gataaggcagaacggaggct-gg---------------------------
A0A452SIR9_BCL2A1-      gataaggcagaacggaggct-gg---------------------------
A0A452U285_BCL2A1-      gataaggcagaacggaggct-gg---------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      tcccagagaatctccatcttcctgagcatgc-------------------
A0A5F9CXI7_BCL2A1-      tcccagagaatctccatcttcctgagcatgc-------------------
A0A5F9CXI7_BCL2A1-      tcccagagaatctccatcttcctgagcatgc-------------------
A0A3L7HT14_BCL2A1-      tccaaaagaatttccatctttttgagcatg--------------------
A0A3L7HT14_BCL2A1-      tccaaaagaatttccatctttttgagcatg--------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      tccaaaagagtgtccatctttctgagcatgccagatgaaattgagacaga
A0A4W2DYC0_BCL2A1-      tccaaaagagtgtccatctttctgagcatgccagatgaaattgagacaga
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      tccaaaagaatttccatctttctgagcatgccagatgaaatcgagacgga
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      ggagatcatcaaggacattttccgacaaggcaaaacctgctttatcccgc
A0A4W2DYC0_BCL2A1-      ggagatcatcaaggacattttccgacaaggcaaaacctgctttatcccgc
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      agagatcatcagggacattttccaacaaggcaagacctgttttatcccac
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -----------------------------------------------aaa
K7G130_BCL2A1-01        -----------------------------------------------aaa
U3JTB2_BCL2A1-01        -----------------------------------------------aaa
A0A218V8Z6_BCL2A1-      -----------------------------------------------aaa
H0ZCL9_BCL2A1-01        -----------------------------------------------aaa
A0A493SSZ7_BCL2A1-      -----------------------------------------------aaa
Q9W6F2_BCL2A1-01        -----------------------------------------------aaa
G1N8C5_BCL2A1-01        -----------------------------------------------aaa
F6S8G3_BCL2A1-01        -----------------------------------------------aaa
F6SFL4_BCL2A1-01        -----------------------------------------------aaa
G3WSP8_BCL2A1-01        -----------------------------------------------aaa
A0A4X2KFL7_BCL2A1-      -----------------------------------------------aaa
A0A5F9CXI7_BCL2A1-      -----------------------------------------------cgg
A0A5F9CXI7_BCL2A1-      -----------------------------------------------cgg
A0A5F9CXI7_BCL2A1-      -----------------------------------------------cgg
A0A3L7HT14_BCL2A1-      ----------------------------------c------------aag
A0A3L7HT14_BCL2A1-      ----------------------------------c------------aag
A0A3L7HT14_BCL2A1-      -----------------------------------------------aag
G3GTB4_BCL2A1-01        -----------------------------------------------aag
G3V977_BCL2A1-01        -----------------------------------------------aag
Q925A9_BCL2A1-01        -----------------------------------------------aag
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -----------------------------------------------aag
O55179_BCL2A1-01        -----------------------------------------------aag
Q8K164_BCL2A1-01        -----------------------------------------------aag
Q4FK02_BCL2A1-01        -----------------------------------------------aag
O55177_BCL2A1-02        -----------------------------------------------aag
Q497M6_BCL2A1-01        -----------------------------------------------aag
A0A2K6EKG1_BCL2A1-      ----------------------------------g------------aac
I3MCZ7_BCL2A1-01        ----------------------------------g------------aaa
A0A4W2DYC0_BCL2A1-      ----------------------------------g------------aaa
A0A4W2DYC0_BCL2A1-      ----------------------------------g------------aaa
Q3C2I0_BCL2A1-01        ----------------------------------g------------aaa
L8IZT5_BCL2A1-01        ----------------------------------g------------aaa
A0A452EK63_BCL2A1-      ----------------------------------g------------aaa
W5Q0N6_BCL2A1-01        ----------------------------------g------------aaa
A0A4W2DYC0_BCL2A1-      ggtaccagttgcagagcaatcacatggatatggtg------------aag
A0A4W2DYC0_BCL2A1-      ggtaccagttgcagagcaatcacatggatatggtg------------aag
G3T8E6_BCL2A1-01        ----------------------------------g------------aaa
A0A4X1UP21_BCL2A1-      ----------------------------------g------------aaa
A0A4X1UP21_BCL2A1-      ----------------------------------g------------aaa
C7F841_BCL2A1-01        ----------------------------------g------------aaa
A0A4X1UP21_BCL2A1-      ggtatcagttccagagcaatcacatggatatggtg------------aaa
H0WZ23_BCL2A1-01        ----------------------------------g------------aac
H2NNZ9_BCL2A1-01        ----------------------------------g------------aaa
A0A2I3HBP6_BCL2A1-      ----------------------------------g------------aaa
A0A2I3HBP6_BCL2A1-      ----------------------------------g------------gaa
A0A2K5KAA3_BCL2A1-      ----------------------------------g------------aaa
A0A2K6AD27_BCL2A1-      ----------------------------------g------------aaa
A0A0D9RRC3_BCL2A1-      ----------------------------------g------------aaa
A0A2K6LV19_BCL2A1-      ----------------------------------g------------aaa
A0A2K6PHF2_BCL2A1-      ----------------------------------g------------aaa
A0A2K5KHH8_BCL2A1-      ----------------------------------g------------aaa
A0A096NMX5_BCL2A1-      ----------------------------------g------------aaa
A0A2K6DS18_BCL2A1-      ----------------------------------g------------aaa
A0A2K5KHH8_BCL2A1-      ----------------------------------g------------aaa
A0A2K5TMD1_BCL2A1-      ----------------------------------g------------aaa
F7E8V5_BCL2A1-01        ----------------------------------g------------aaa
A0A2K5KAA3_BCL2A1-      ----------------------------------g------------gaa
A0A2K6LV19_BCL2A1-      ----------------------------------g------------gaa
A0A2K6PHF2_BCL2A1-      ----------------------------------g------------gaa
A0A2K6AD27_BCL2A1-      ----------------------------------g------------gaa
A0A096NMX5_BCL2A1-      ----------------------------------g------------gaa
A0A2K5TMD1_BCL2A1-      ----------------------------------g------------gaa
A0A2K6DS18_BCL2A1-      ----------------------------------g------------gaa
B4E1X9_BCL2A1-01        ----------------------------------g------------tat
A0A2R8ZJX9_BCL2A1-      ----------------------------------g------------aaa
A0A2I2YML2_BCL2A1-      ----------------------------------g------------aaa
Q16548_BCL2A1-01        ----------------------------------g------------aaa
A0A2I2YML2_BCL2A1-      ----------------------------------g------------gaa
A0A2R8ZJX9_BCL2A1-      ----------------------------------g------------gaa
F7HXW0_BCL2A1-01        ----------------------------------g------------gaa
A0A2K6TLJ5_BCL2A1-      ----------------------------------g------------gaa
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -----------------------------------------------aaa
A0A2K5D2I1_BCL2A1-      ----------------------------------c------------gaa
A0A2K5PYQ3_BCL2A1-      ----------------------------------g------------aaa
A0A2K5PYQ3_BCL2A1-      ----------------------------------g------------gaa
A0A286XUI2_BCL2A1-      ----------------------------------g------------aca
M3WHW2_BCL2A1-01        ----------------------------------g------------aaa
M3YVH4_BCL2A1-01        ----------------------------------g------------agg
U6CQS8_BCL2A1-01        ----------------------------------g------------agg
A0A5F4CJR7_BCL2A1-      ----------------------------------g------------aaa
A0A5F4CJR7_BCL2A1-      ----------------------------------g------------aaa
A0A452U285_BCL2A1-      ----------------------------------tccctcctcccgccct
A0A452SIR9_BCL2A1-      ----------------------------------g------------aag
A0A452U285_BCL2A1-      ----------------------------------g------------aag
                                                                          

A0A452J3N6_BCL2A1-      atgg------------------cttcc--taactatgttt----------
K7G130_BCL2A1-01        acgg------------------cttcc--tacctatgttt----------
U3JTB2_BCL2A1-01        atgg------------------cttcc--taacaaagttt----------
A0A218V8Z6_BCL2A1-      atgg------------------cttcc--taactaagttt----------
H0ZCL9_BCL2A1-01        atgg------------------cttcc--taactaagttt----------
A0A493SSZ7_BCL2A1-      atgg------------------cttcc--taacaaagttt----------
Q9W6F2_BCL2A1-01        acgg------------------tttcc--taacgaagttt----------
G1N8C5_BCL2A1-01        atgg------------------tttcc--taacaaagttt----------
F6S8G3_BCL2A1-01        atgg------------------atttt--taaataagttt----------
F6SFL4_BCL2A1-01        atgg------------------ctttg--taaagaacttt----------
G3WSP8_BCL2A1-01        atgg------------------cttca--taaagaacttt----------
A0A4X2KFL7_BCL2A1-      atgg------------------cttcg--taaagaatttt----------
A0A5F9CXI7_BCL2A1-      atgaaatcgagacagaagagatcatca--aggatatcttc----------
A0A5F9CXI7_BCL2A1-      atgaaatcgagacagaagagatcatca--aggatatcttc----------
A0A5F9CXI7_BCL2A1-      atgaaatcgagacagaagagatcatca--aggatatcttc----------
A0A3L7HT14_BCL2A1-      atgaaattgagacagaagagatcatca--aggacattttc----------
A0A3L7HT14_BCL2A1-      atgaaattgagacagaagagatcatca--aggacattttc----------
A0A3L7HT14_BCL2A1-      atgg------------------cttca--tgaagaagttt----------
G3GTB4_BCL2A1-01        atgg------------------cttca--tgaagaagttt----------
G3V977_BCL2A1-01        atgg------------------cttca--caaagaagttt----------
Q925A9_BCL2A1-01        atgg------------------cttca--caaagaagttt----------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        atgg------------------cttca--taaagaagttt----------
O55179_BCL2A1-01        atgg------------------cttca--taaagaagttt----------
Q8K164_BCL2A1-01        atgg------------------cttca--taaagaagttt----------
Q4FK02_BCL2A1-01        atgg------------------cttca--taaagaagttt----------
O55177_BCL2A1-02        atgg------------------cttca--taaagaagttt----------
Q497M6_BCL2A1-01        atgg------------------cttca--taaagaagttt----------
A0A2K6EKG1_BCL2A1-      acgg------------------cttcg--taaagaagttt----------
I3MCZ7_BCL2A1-01        atgg------------------ctttg--taaagaagttt----------
A0A4W2DYC0_BCL2A1-      atgg------------------gtttg--taaagaagttt----------
A0A4W2DYC0_BCL2A1-      atgg------------------gtttg--taaagaagttt----------
Q3C2I0_BCL2A1-01        atgg------------------gtttg--taaagaagttt----------
L8IZT5_BCL2A1-01        atgg------------------gtttg--taaagaagttt----------
A0A452EK63_BCL2A1-      atgg------------------gtttg--taaagaagttt----------
W5Q0N6_BCL2A1-01        atgg------------------ttttg--taaagaagttt----------
A0A4W2DYC0_BCL2A1-      ttag------------------catcgccagaggaaatcgctttgctgcc
A0A4W2DYC0_BCL2A1-      ttag------------------catcgccagaggaaatcgctttgctgcc
G3T8E6_BCL2A1-01        atgg------------------ctttg--tgaagaagttt----------
A0A4X1UP21_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A4X1UP21_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
C7F841_BCL2A1-01        atgg------------------ctttg--taaagaagttt----------
A0A4X1UP21_BCL2A1-      ttag------------------catcgcctgaggaaatttcttcccttcc
H0WZ23_BCL2A1-01        atgg------------------ctttg--taaagaagttt----------
H2NNZ9_BCL2A1-01        atgg------------------ctttg--taaagaagctt----------
A0A2I3HBP6_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2I3HBP6_BCL2A1-      atgg------------------cat-------------------------
A0A2K5KAA3_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K6AD27_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A0D9RRC3_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K6LV19_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K6PHF2_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K5KHH8_BCL2A1-      atgg------------------ctttg--taaagaagctt----------
A0A096NMX5_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K6DS18_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K5KHH8_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K5TMD1_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
F7E8V5_BCL2A1-01        atgg------------------ctttg--taaagaagttt----------
A0A2K5KAA3_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2K6LV19_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2K6PHF2_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2K6AD27_BCL2A1-      atgg------------------c---------acaatcac----------
A0A096NMX5_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2K5TMD1_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2K6DS18_BCL2A1-      atgg------------------c---------acaatcac----------
B4E1X9_BCL2A1-01        gtgt------------------gatgg--aaaaattcttc----------
A0A2R8ZJX9_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2I2YML2_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
Q16548_BCL2A1-01        atgg------------------ctttg--taaagaagttt----------
A0A2I2YML2_BCL2A1-      atgg------------------c---------acaatcac----------
A0A2R8ZJX9_BCL2A1-      atgg------------------c---------acaatcac----------
F7HXW0_BCL2A1-01        atgg------------------c----------acagtct----------
A0A2K6TLJ5_BCL2A1-      atgg------------------a----------acagtct----------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K5D2I1_BCL2A1-      atgg------------------c----------acagtct----------
A0A2K5PYQ3_BCL2A1-      atgg------------------ctttg--taaagaagttt----------
A0A2K5PYQ3_BCL2A1-      atgg------------------c----------acagtct----------
A0A286XUI2_BCL2A1-      acgg------------------cttcg--tgcggaagttt----------
M3WHW2_BCL2A1-01        acgg------------------ctttg--taaggaagttc----------
M3YVH4_BCL2A1-01        atgg------------------ctttg--taaagaagttc----------
U6CQS8_BCL2A1-01        acgg------------------ctttg--taaagaagttc----------
A0A5F4CJR7_BCL2A1-      acgg------------------ctttg--tgaagaagttc----------
A0A5F4CJR7_BCL2A1-      acgg------------------ctttg--tgaagaagttc----------
A0A452U285_BCL2A1-      ctgc------------------cagtg--tgaagggctgc----------
A0A452SIR9_BCL2A1-      atgg------------------ctttg--taaagaagttc----------
A0A452U285_BCL2A1-      atgg------------------ctttg--taaagaagttc----------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      cagaacttcctggaacattcagcagcccggtgaggatgaagttctggagg
A0A4W2DYC0_BCL2A1-      cagaacttcctggaacattcagcagcccggtgaggatgaagttctggagg
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      caaaacatcctggaatattcatcagcccggggagaatgagattcgagagg
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -----------------gagg-----aaaaacgatcat------------
K7G130_BCL2A1-01        -----------------gaag-----aaaaacaatcgt------------
U3JTB2_BCL2A1-01        -----------------gaaa-----gaa---gatcac------------
A0A218V8Z6_BCL2A1-      -----------------gaaa-----gaa---gatcac------------
H0ZCL9_BCL2A1-01        -----------------gaaa-----gaa---gatcac------------
A0A493SSZ7_BCL2A1-      -----------------gaaa-----gaa---gatcac------------
Q9W6F2_BCL2A1-01        -----------------gaaa-----gaa---gatcac------------
G1N8C5_BCL2A1-01        -----------------gaaa-----gaa---gatcac------------
F6S8G3_BCL2A1-01        -----------------gaac----aaaa----gaccg------------
F6SFL4_BCL2A1-01        -----------------gaac----ctaatacagtgtg------------
G3WSP8_BCL2A1-01        -----------------gaac----ccaatatggtatg------------
A0A4X2KFL7_BCL2A1-      -----------------gaac----ctaatatggtgtg------------
A0A5F9CXI7_BCL2A1-      -----------------cagcaaggcaaa----gtctg------------
A0A5F9CXI7_BCL2A1-      -----------------cagcaaggcaaa----gtctg------------
A0A5F9CXI7_BCL2A1-      -----------------cagcaaggcaaa----gtctg------------
A0A3L7HT14_BCL2A1-      -----------------aaacaaggcaaa----atctg------------
A0A3L7HT14_BCL2A1-      -----------------aaacaaggcaaa----atctg------------
A0A3L7HT14_BCL2A1-      -----------------gaac----ctaa----atctg------------
G3GTB4_BCL2A1-01        -----------------gaac----ctaa----atctg------------
G3V977_BCL2A1-01        -----------------gaac----ctaa----atctg------------
Q925A9_BCL2A1-01        -----------------gaac----ctaa----atctg------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -----------------gaac----ccaa----atctg------------
O55179_BCL2A1-01        -----------------gaac----ccaa----atctg------------
Q8K164_BCL2A1-01        -----------------gaac----ccaa----atctg------------
Q4FK02_BCL2A1-01        -----------------gaac----ccaa----atctg------------
O55177_BCL2A1-02        -----------------gaac----ccaa----atctg------------
Q497M6_BCL2A1-01        -----------------gaac----ccaa----atctg------------
A0A2K6EKG1_BCL2A1-      -----------------gaac----ctag----acctg------------
I3MCZ7_BCL2A1-01        -----------------gaac----ctaa----atctg------------
A0A4W2DYC0_BCL2A1-      -----------------gaaa----ccaa----atctg------------
A0A4W2DYC0_BCL2A1-      -----------------gaaa----ccaa----atctg------------
Q3C2I0_BCL2A1-01        -----------------gaaa----ccaa----atctg------------
L8IZT5_BCL2A1-01        -----------------gaaa----ccaa----atctg------------
A0A452EK63_BCL2A1-      -----------------gaaa----ccaa----atctg------------
W5Q0N6_BCL2A1-01        -----------------gaaa----ccaa----atctg------------
A0A4W2DYC0_BCL2A1-      aggccttgtcaacagggggac----ttgacctcatctt------------
A0A4W2DYC0_BCL2A1-      aggccttgtcaacagggggac----ttgacctcatctt------------
G3T8E6_BCL2A1-01        -----------------gaac----ctag----gtctg------------
A0A4X1UP21_BCL2A1-      -----------------gaac----ccaa----atctg------------
A0A4X1UP21_BCL2A1-      -----------------gaac----ccaa----atctg------------
C7F841_BCL2A1-01        -----------------gaac----ccaa----atctg------------
A0A4X1UP21_BCL2A1-      aggccttgtcaacagggggac----ttgatctcatctt------------
H0WZ23_BCL2A1-01        -----------------gaac----ctaa----ctctg------------
H2NNZ9_BCL2A1-01        -----------------gagc----ctaa----atctg------------
A0A2I3HBP6_BCL2A1-      -----------------gaac----ctaa----atctggctggatgactt
A0A2I3HBP6_BCL2A1-      ----------------------------a----atc--------------
A0A2K5KAA3_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K6AD27_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A0D9RRC3_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K6LV19_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K6PHF2_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K5KHH8_BCL2A1-      -----------------gagc----ctaa----atctg------------
A0A096NMX5_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K6DS18_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K5KHH8_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K5TMD1_BCL2A1-      -----------------gaac----ctaa----atctg------------
F7E8V5_BCL2A1-01        -----------------gaac----ctaa----atctg------------
A0A2K5KAA3_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A2K6LV19_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A2K6PHF2_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A2K6AD27_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A096NMX5_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A2K5TMD1_BCL2A1-      -----------------atgc----ctat----g-cta------------
A0A2K6DS18_BCL2A1-      -----------------atgc----ctat----g-cta------------
B4E1X9_BCL2A1-01        -----------------attg----ttct----ttcct------------
A0A2R8ZJX9_BCL2A1-      -----------------gaac----ataa----atctg------------
A0A2I2YML2_BCL2A1-      -----------------gaac----ctaa----atctg------------
Q16548_BCL2A1-01        -----------------gaac----ctaa----atctg------------
A0A2I2YML2_BCL2A1-      -----------------acgc----ctat----g-ctg------------
A0A2R8ZJX9_BCL2A1-      -----------------acgc----ctat----g-ctg------------
F7HXW0_BCL2A1-01        -----------------catg----ctta----tgcta------------
A0A2K6TLJ5_BCL2A1-      -----------------catg----ctta----tgcta------------
A0A2K6TLJ5_BCL2A1-      --------------------a----ccta----t----------------
A0A2K5D2I1_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K5D2I1_BCL2A1-      -----------------cctg----cttg----tgctg------------
A0A2K5PYQ3_BCL2A1-      -----------------gaac----ctaa----atctg------------
A0A2K5PYQ3_BCL2A1-      -----------------catg----ctta----tgcta------------
A0A286XUI2_BCL2A1-      -----------------gagc----ccaa----atctg------------
M3WHW2_BCL2A1-01        -----------------gaac----ccaa----gtctg------------
M3YVH4_BCL2A1-01        -----------------gagc----ccaa----gtccg------------
U6CQS8_BCL2A1-01        -----------------gagc----ccaa----gtccg------------
A0A5F4CJR7_BCL2A1-      -----------------gaac----ccaa----gtctg------------
A0A5F4CJR7_BCL2A1-      -----------------gaac----ccaa----gtctg------------
A0A452U285_BCL2A1-      -----------------aagc----ggag----ggc--------------
A0A452SIR9_BCL2A1-      -----------------gaac----ccaa----gtctg------------
A0A452U285_BCL2A1-      -----------------gaac----ccaa----gtctg------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      ttctagaagttacaggaaagatctcaatactgttgactagaaaggacact
A0A2I3HBP6_BCL2A1-      ------------------acatgcctatgctg------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      ---------------------------------------ggctgtcctt-
K7G130_BCL2A1-01        ---------------------------------------ggctgtcatt-
U3JTB2_BCL2A1-01        ---------------------------------------tactgtcctt-
A0A218V8Z6_BCL2A1-      ---------------------------------------tactgtcctt-
H0ZCL9_BCL2A1-01        ---------------------------------------tactgtcctt-
A0A493SSZ7_BCL2A1-      ---------------------------------------tactgtcttt-
Q9W6F2_BCL2A1-01        ---------------------------------------ccctatcttt-
G1N8C5_BCL2A1-01        ---------------------------------------cactatcttt-
F6S8G3_BCL2A1-01        ------------------------------------tctggtcggtgtt-
F6SFL4_BCL2A1-01        ----------------------------------------gccgaactt-
G3WSP8_BCL2A1-01        ----------------------------------------gccaaactt-
A0A4X2KFL7_BCL2A1-      ----------------------------------------gccaaactt-
A0A5F9CXI7_BCL2A1-      -----------------------------ctttatcccccgctaccggt-
A0A5F9CXI7_BCL2A1-      -----------------------------ctttatcccccgctaccggt-
A0A5F9CXI7_BCL2A1-      -----------------------------ctttatcccccgctaccggt-
A0A3L7HT14_BCL2A1-      -----------------------------cttcatccctcggtaccggt-
A0A3L7HT14_BCL2A1-      -----------------------------cttcatccctcggtaccggt-
A0A3L7HT14_BCL2A1-      ------------------------------------gctgggtgacttt-
G3GTB4_BCL2A1-01        ------------------------------------gctgggtgacttt-
G3V977_BCL2A1-01        ------------------------------------gctggctgacttt-
Q925A9_BCL2A1-01        ------------------------------------gctggctgacttt-
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ------------------------------------gctggctgacttt-
O55179_BCL2A1-01        ------------------------------------gctggctgacttt-
Q8K164_BCL2A1-01        ------------------------------------gctggctgacttt-
Q4FK02_BCL2A1-01        ------------------------------------gctggctgacttt-
O55177_BCL2A1-02        ------------------------------------gctggctgacttt-
Q497M6_BCL2A1-01        ------------------------------------gctggctgacttt-
A0A2K6EKG1_BCL2A1-      ------------------------------------cctggctgacttt-
I3MCZ7_BCL2A1-01        ------------------------------------gctggttgacttt-
A0A4W2DYC0_BCL2A1-      ------------------------------------gctggctgacttt-
A0A4W2DYC0_BCL2A1-      ------------------------------------gctggctgacttt-
Q3C2I0_BCL2A1-01        ------------------------------------gctggctgacttt-
L8IZT5_BCL2A1-01        ------------------------------------gctggctgacttt-
A0A452EK63_BCL2A1-      ------------------------------------gctggctgacttt-
W5Q0N6_BCL2A1-01        ------------------------------------gctggctgacttt-
A0A4W2DYC0_BCL2A1-      ------------cgtgccgggtctcgggttcgacaaacagagcaaccgt-
A0A4W2DYC0_BCL2A1-      ------------cgtgccgggtctcgggttcgacaaacagagcaaccgt-
G3T8E6_BCL2A1-01        ------------------------------------gctggctgacttt-
A0A4X1UP21_BCL2A1-      ------------------------------------gctggctgacctt-
A0A4X1UP21_BCL2A1-      ------------------------------------gctggctgacctt-
C7F841_BCL2A1-01        ------------------------------------gctggctgacctt-
A0A4X1UP21_BCL2A1-      ------------------------------------catgcctggtcttg
H0WZ23_BCL2A1-01        ---------------------------gctactctggctggctgacttt-
H2NNZ9_BCL2A1-01        ------------------------------------gctggatgacttt-
A0A2I3HBP6_BCL2A1-      ccatattgtgaaaccggcctaatttttctgactcttatggaaacaattg-
A0A2I3HBP6_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K5KAA3_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K6AD27_BCL2A1-      ------------------------------------gctggatgacttt-
A0A0D9RRC3_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K6LV19_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K6PHF2_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K5KHH8_BCL2A1-      ------------------------------------gctggatgacttt-
A0A096NMX5_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K6DS18_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K5KHH8_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K5TMD1_BCL2A1-      ------------------------------------gctggatgacttt-
F7E8V5_BCL2A1-01        ------------------------------------gctggatgacttt-
A0A2K5KAA3_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K6LV19_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K6PHF2_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K6AD27_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A096NMX5_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K5TMD1_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2K6DS18_BCL2A1-      ------------------------------------gtagagtcagtgg-
B4E1X9_BCL2A1-01        ------------------------------------gtgaaat-------
A0A2R8ZJX9_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2I2YML2_BCL2A1-      ------------------------------------gctggatgacttt-
Q16548_BCL2A1-01        ------------------------------------gctggatgacttt-
A0A2I2YML2_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A2R8ZJX9_BCL2A1-      ------------------------------------gtagagtcagtgg-
F7HXW0_BCL2A1-01        ------------------------------------gt---atcagtgg-
A0A2K6TLJ5_BCL2A1-      ------------------------------------gtggagtcagcg--
A0A2K6TLJ5_BCL2A1-      ----------------------------------------------cg--
A0A2K5D2I1_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K5D2I1_BCL2A1-      ------------------------------------gtggagtcagtgg-
A0A2K5PYQ3_BCL2A1-      ------------------------------------gctggatgacttt-
A0A2K5PYQ3_BCL2A1-      ------------------------------------gtagagtcagtgg-
A0A286XUI2_BCL2A1-      ------------------------------------gctggctgacttt-
M3WHW2_BCL2A1-01        ------------------------------------gctggctgacctt-
M3YVH4_BCL2A1-01        ------------------------------------gctggctgacctt-
U6CQS8_BCL2A1-01        ------------------------------------gctggctgacctt-
A0A5F4CJR7_BCL2A1-      ------------------------------------gatggctgacttt-
A0A5F4CJR7_BCL2A1-      ------------------------------------gatggctgacttt-
A0A452U285_BCL2A1-      ------------------------------------------------c-
A0A452SIR9_BCL2A1-      ------------------------------------gctggctgacttt-
A0A452U285_BCL2A1-      ------------------------------------gctggctgacttt-
                                                                          

A0A452J3N6_BCL2A1-      -----------at-------------tcaata------------------
K7G130_BCL2A1-01        -----------at-------------tcaaca------------------
U3JTB2_BCL2A1-01        -----------ct-------------ccaaaa------------------
A0A218V8Z6_BCL2A1-      -----------ct-------------ccagaa------------------
H0ZCL9_BCL2A1-01        -----------ct-------------ccaaaa------------------
A0A493SSZ7_BCL2A1-      -----------ct-------------ccaaaa------------------
Q9W6F2_BCL2A1-01        -----------ct-------------ctacaa------------------
G1N8C5_BCL2A1-01        -----------ct-------------ctacaa------------------
F6S8G3_BCL2A1-01        -----------ag-------------cggata------------------
F6SFL4_BCL2A1-01        -----------ca-------------cagata------------------
G3WSP8_BCL2A1-01        -----------ca-------------cagata------------------
A0A4X2KFL7_BCL2A1-      -----------ca-------------cggata------------------
A0A5F9CXI7_BCL2A1-      -----------tgcagagcaatcacatggata------------------
A0A5F9CXI7_BCL2A1-      -----------tgcagagcaatcacatggata------------------
A0A5F9CXI7_BCL2A1-      -----------tgcagagcaatcacatggata------------------
A0A3L7HT14_BCL2A1-      -----------tccagagcaatcacatggaca------------------
A0A3L7HT14_BCL2A1-      -----------tccagagcaatcacatggaca------------------
A0A3L7HT14_BCL2A1-      -----------tc-------------tggaaa------------------
G3GTB4_BCL2A1-01        -----------tc-------------tggaaa------------------
G3V977_BCL2A1-01        -----------tc-------------tgcaga------------------
Q925A9_BCL2A1-01        -----------tc-------------tgcaga------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -----------tc-------------tgcaga------------------
O55179_BCL2A1-01        -----------tc-------------tgcaga------------------
Q8K164_BCL2A1-01        -----------tc-------------tgcaga------------------
Q4FK02_BCL2A1-01        -----------tc-------------tgcaga------------------
O55177_BCL2A1-02        -----------tc-------------tgcaga------------------
Q497M6_BCL2A1-01        -----------tc-------------tgcaga------------------
A0A2K6EKG1_BCL2A1-      -----------tc-------------tggaag------------------
I3MCZ7_BCL2A1-01        -----------tc-------------tgggag------------------
A0A4W2DYC0_BCL2A1-      -----------tc-------------tggaag------------------
A0A4W2DYC0_BCL2A1-      -----------tc-------------tggaag------------------
Q3C2I0_BCL2A1-01        -----------tc-------------tggaag------------------
L8IZT5_BCL2A1-01        -----------tc-------------tggaag------------------
A0A452EK63_BCL2A1-      -----------tc-------------tggaag------------------
W5Q0N6_BCL2A1-01        -----------tc-------------tggaag------------------
A0A4W2DYC0_BCL2A1-      -----------tt-------------gggacg------------gggcaa
A0A4W2DYC0_BCL2A1-      -----------tt-------------gggacg------------gggcaa
G3T8E6_BCL2A1-01        -----------tc-------------tggaag------------------
A0A4X1UP21_BCL2A1-      -----------tg-------------tggaag------------------
A0A4X1UP21_BCL2A1-      -----------tg-------------tggaag------------------
C7F841_BCL2A1-01        -----------tg-------------tggaag------------------
A0A4X1UP21_BCL2A1-      ggtttgacaactg-------------tggcaaccgtctggggcggggcaa
H0WZ23_BCL2A1-01        -----------tc-------------tggaag------------------
H2NNZ9_BCL2A1-01        -----------t----------------gaag------------------
A0A2I3HBP6_BCL2A1-      -----------cc-------------aacaca------------------
A0A2I3HBP6_BCL2A1-      -----------cc-------------cacaag------------------
A0A2K5KAA3_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K6AD27_BCL2A1-      -----------tc-------------tagaag------------------
A0A0D9RRC3_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K6LV19_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K6PHF2_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K5KHH8_BCL2A1-      -----------tc-------------tagaag------------------
A0A096NMX5_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K6DS18_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K5KHH8_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K5TMD1_BCL2A1-      -----------tc-------------tagaag------------------
F7E8V5_BCL2A1-01        -----------tc-------------tagaag------------------
A0A2K5KAA3_BCL2A1-      -----------cc-------------cacaag------------------
A0A2K6LV19_BCL2A1-      -----------cc-------------catagg------------------
A0A2K6PHF2_BCL2A1-      -----------cc-------------cacaag------------------
A0A2K6AD27_BCL2A1-      -----------cc-------------cacagg------------------
A0A096NMX5_BCL2A1-      -----------cc-------------cacaag------------------
A0A2K5TMD1_BCL2A1-      -----------cc-------------cac---------------------
A0A2K6DS18_BCL2A1-      -----------cc-------------cacaag------------------
B4E1X9_BCL2A1-01        ------------------------------ag------------------
A0A2R8ZJX9_BCL2A1-      -----------tc-------------tagaag------------------
A0A2I2YML2_BCL2A1-      -----------tc-------------tagaag------------------
Q16548_BCL2A1-01        -----------tc-------------tagaag------------------
A0A2I2YML2_BCL2A1-      -----------cc-------------cacaag------------------
A0A2R8ZJX9_BCL2A1-      -----------cc-------------cacaag------------------
F7HXW0_BCL2A1-01        -----------cc-------------cagaag------------------
A0A2K6TLJ5_BCL2A1-      --------------------------cagaag------------------
A0A2K6TLJ5_BCL2A1-      --------------------------caatag------------------
A0A2K5D2I1_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K5D2I1_BCL2A1-      -----------cc-------------cagaag------------------
A0A2K5PYQ3_BCL2A1-      -----------tc-------------tagaag------------------
A0A2K5PYQ3_BCL2A1-      -----------cc-------------cagaag------------------
A0A286XUI2_BCL2A1-      -----------tg-------------tgggag------------------
M3WHW2_BCL2A1-01        -----------tc-------------tggaag------------------
M3YVH4_BCL2A1-01        -----------tc-------------tggaag------------------
U6CQS8_BCL2A1-01        -----------tc-------------tggaag------------------
A0A5F4CJR7_BCL2A1-      -----------tc-------------tggaag------------------
A0A5F4CJR7_BCL2A1-      -----------tc-------------tggaag------------------
A0A452U285_BCL2A1-      -----------cc-------------cggcag------------------
A0A452SIR9_BCL2A1-      -----------tc-------------tggaag------------------
A0A452U285_BCL2A1-      -----------tc-------------tggaag------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3GTB4_BCL2A1-01        --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      gggctactatgacgcctacctgaagcgttgtctgcagtcccaggacgtga
A0A4W2DYC0_BCL2A1-      gggctactatgacgcctacctgaagcgttgtctgcagtcccaggacgtga
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      gggctactacgacgcctacctgaagcgctgtctgcagtcccaggatgtga
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      ------------------------tt----------aaa-gcaaaaatca
K7G130_BCL2A1-01        ------------------------tt----------aaa-gcaaaaatca
U3JTB2_BCL2A1-01        ------------------------tt----------aca-gccctgttca
A0A218V8Z6_BCL2A1-      ------------------------tt----------aca-gccctgttca
H0ZCL9_BCL2A1-01        ------------------------tt----------aca-gccctgttca
A0A493SSZ7_BCL2A1-      ------------------------tt----------aca-gacttattcg
Q9W6F2_BCL2A1-01        ------------------------tt----------aca-gacatatttg
G1N8C5_BCL2A1-01        ------------------------tt----------aca-gacatatttg
F6S8G3_BCL2A1-01        ------------------------tt----------tcg-atgaag----
F6SFL4_BCL2A1-01        ------------------------tt----------tca-acaaag----
G3WSP8_BCL2A1-01        ------------------------tt----------tca-acaaag----
A0A4X2KFL7_BCL2A1-      ------------------------tt----------tca-acaaag----
A0A5F9CXI7_BCL2A1-      ------------------------tg--------------gtgaaattag
A0A5F9CXI7_BCL2A1-      ------------------------tg--------------gtgaaattag
A0A5F9CXI7_BCL2A1-      ------------------------tg--------------gtgaaattag
A0A3L7HT14_BCL2A1-      ------------------------tg----------gtg-agattagcat
A0A3L7HT14_BCL2A1-      ------------------------tg----------gtg-agattagcat
A0A3L7HT14_BCL2A1-      ------------------------cg----------ata-gggcag----
G3GTB4_BCL2A1-01        ------------------------cg----------ata-gggcag----
G3V977_BCL2A1-01        ------------------------tg----------aca-gggaag----
Q925A9_BCL2A1-01        ------------------------tg----------aca-gggaag----
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ------------------------tg----------aca-ggacag----
O55179_BCL2A1-01        ------------------------tg----------aca-ggacag----
Q8K164_BCL2A1-01        ------------------------tg----------aca-ggacag----
Q4FK02_BCL2A1-01        ------------------------tg----------aca-ggacag----
O55177_BCL2A1-02        ------------------------tg----------aca-ggacag----
Q497M6_BCL2A1-01        ------------------------tg----------aca-ggacag----
A0A2K6EKG1_BCL2A1-      ------------------------tt----------acg-gggaag----
I3MCZ7_BCL2A1-01        ------------------------tt----------aca-gggcag----
A0A4W2DYC0_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A4W2DYC0_BCL2A1-      ------------------------tt----------aca-ggaaag----
Q3C2I0_BCL2A1-01        ------------------------tt----------aca-ggaaag----
L8IZT5_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A452EK63_BCL2A1-      ------------------------tt----------aca-ggaaag----
W5Q0N6_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A4W2DYC0_BCL2A1-      aaccctacaccctggccttggctttc----------aaa-gagcag----
A0A4W2DYC0_BCL2A1-      aaccctacaccctggccttggctttc----------aaa-gagcag----
G3T8E6_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A4X1UP21_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A4X1UP21_BCL2A1-      ------------------------tt----------aca-ggaaag----
C7F841_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A4X1UP21_BCL2A1-      agccctacaccctggccttggctttc----------aaa-gaacag----
H0WZ23_BCL2A1-01        ------------------------tt----------aca-agaaag----
H2NNZ9_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A2I3HBP6_BCL2A1-      ------------------------tacttctactttaaa-ataaac----
A0A2I3HBP6_BCL2A1-      ------------------------aa----------gag-gaaaat----
A0A2K5KAA3_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K6AD27_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A0D9RRC3_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K6LV19_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K6PHF2_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K5KHH8_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A096NMX5_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K6DS18_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K5KHH8_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K5TMD1_BCL2A1-      ------------------------tt----------aca-ggaaag----
F7E8V5_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A2K5KAA3_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K6LV19_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K6PHF2_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K6AD27_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A096NMX5_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K5TMD1_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K6DS18_BCL2A1-      ------------------------aa----------gaa-gaaaat----
B4E1X9_BCL2A1-01        ------------------------aa----------att-gagaat----
A0A2R8ZJX9_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2I2YML2_BCL2A1-      ------------------------tt----------acg-ggaaag----
Q16548_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A2I2YML2_BCL2A1-      ------------------------aa----------gag-gaaaat----
A0A2R8ZJX9_BCL2A1-      ------------------------aa----------gag-gaaaat----
F7HXW0_BCL2A1-01        ------------------------aa----------gag-gaaaat----
A0A2K6TLJ5_BCL2A1-      ------------------------aa----------gaa-gaaaat----
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ------------------------tt----------aca-ggaaag----
A0A2K5D2I1_BCL2A1-      ------------------------ga----------gag-gaaaat----
A0A2K5PYQ3_BCL2A1-      ------------------------tc----------aca-ggaaag----
A0A2K5PYQ3_BCL2A1-      ------------------------aa----------gag-gaaaat----
A0A286XUI2_BCL2A1-      ------------------------tt----------atg-ggacag----
M3WHW2_BCL2A1-01        ------------------------tt----------aca-ggaaag----
M3YVH4_BCL2A1-01        ------------------------tt----------ata-ggaaag----
U6CQS8_BCL2A1-01        ------------------------tt----------aca-ggaaag----
A0A5F4CJR7_BCL2A1-      ------------------------tt----------ctg-ggaaca----
A0A5F4CJR7_BCL2A1-      ------------------------tt----------ctg-ggaaca----
A0A452U285_BCL2A1-      ------------------------gt----------ctgagaggag----
A0A452SIR9_BCL2A1-      ------------------------tt----------acg-gggaag----
A0A452U285_BCL2A1-      ------------------------tt----------atg-gggaag----
                                                                          

A0A452J3N6_BCL2A1-      tggatg-----------------------------------ctttttcct
K7G130_BCL2A1-01        tggatg-----------------------------------ctttttcct
U3JTB2_BCL2A1-01        tagctg-----------------------------------ttgtttcct
A0A218V8Z6_BCL2A1-      tagccc-----------------------------------ttgtttcct
H0ZCL9_BCL2A1-01        tagctc-----------------------------------ttgtgtcct
A0A493SSZ7_BCL2A1-      tggctg-----------------------------------ttttttcct
Q9W6F2_BCL2A1-01        cagctg-----------------------------------ttctttcct
G1N8C5_BCL2A1-01        cagctg-----------------------------------ttttttcct
F6S8G3_BCL2A1-01        -atctt------------------------ggg----cgtactctc--cc
F6SFL4_BCL2A1-01        -atctg------------------------ggg----catattttc--ct
G3WSP8_BCL2A1-01        -atctg------------------------gaa----tgtattttc--ct
A0A4X2KFL7_BCL2A1-      -atctg------------------------ggg----tgtattttc--ct
A0A5F9CXI7_BCL2A1-      cgtcag------------------------cagacgaaatttcttc--ac
A0A5F9CXI7_BCL2A1-      cgtcag------------------------cagacgaaatttcttc--ac
A0A5F9CXI7_BCL2A1-      cgtcag------------------------cagacgaaatttcttc--ac
A0A3L7HT14_BCL2A1-      cacctg------------------------aag----agatctctt-tac
A0A3L7HT14_BCL2A1-      cacctg------------------------aag----agatctctt-tac
A0A3L7HT14_BCL2A1-      -atctg------------------------gga----aatgctctt-ttc
G3GTB4_BCL2A1-01        -atctg------------------------gga----aatgctctt-ttc
G3V977_BCL2A1-01        -atctg------------------------gga----aatgctctt-t-c
Q925A9_BCL2A1-01        -atctg------------------------gga----aatgctctt-t-c
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -atctg------------------------gga----aatgctctt-t-c
O55179_BCL2A1-01        -atctg------------------------gga----aatgctctt-t-c
Q8K164_BCL2A1-01        -atctg------------------------gga----aatgctctt-t-c
Q4FK02_BCL2A1-01        -ttctg------------------------gga----aatgctctt-t-c
O55177_BCL2A1-02        -ttctg------------------------gga----aatgctctt-t-c
Q497M6_BCL2A1-01        -ttctg------------------------gga----aatgctctt-t-c
A0A2K6EKG1_BCL2A1-      -atctg------------------------tga----catgctgtccctc
I3MCZ7_BCL2A1-01        -atctg------------------------tga----gatgctgtc--tc
A0A4W2DYC0_BCL2A1-      -atctg------------------------tga----aacattatg--tc
A0A4W2DYC0_BCL2A1-      -atctg------------------------tga----aacattatg--tc
Q3C2I0_BCL2A1-01        -atctg------------------------tga----aacattatg--tc
L8IZT5_BCL2A1-01        -atctg------------------------tga----aacattatg--tc
A0A452EK63_BCL2A1-      -atctg------------------------tga----aacattatg--tc
W5Q0N6_BCL2A1-01        -atctg------------------------tga----aacattatg--tc
A0A4W2DYC0_BCL2A1-      -atctgcctccaggtcccggtgaatgagaatgatgtgaaggtagacgagg
A0A4W2DYC0_BCL2A1-      -atctgcctccaggtcccggtgaatgagaatgatgtgaaggtagacgagg
G3T8E6_BCL2A1-01        -atttg------------------------tga----aatgttatt--tc
A0A4X1UP21_BCL2A1-      -atctg------------------------tga----aatgttatg--tc
A0A4X1UP21_BCL2A1-      -atctg------------------------tga----aatgttatg--tc
C7F841_BCL2A1-01        -atctg------------------------tga----aatgttatg--tc
A0A4X1UP21_BCL2A1-      -atttgcctccaggtccccatggatgaacatgacatgaaggtcatc--tg
H0WZ23_BCL2A1-01        -atctg------------------------tga----aatgctgcc--tc
H2NNZ9_BCL2A1-01        -atctg------------------------tga----aatgctctc--tc
A0A2I3HBP6_BCL2A1-      -aactt------------------------tga----tgatgtaac----
A0A2I3HBP6_BCL2A1-      -ggctt------------------------tg------------------
A0A2K5KAA3_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K6AD27_BCL2A1-      -atctg------------------------tga----aatgctctc--tc
A0A0D9RRC3_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K6LV19_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K6PHF2_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K5KHH8_BCL2A1-      -atctg------------------------tga----aatgctctc--tc
A0A096NMX5_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K6DS18_BCL2A1-      -atctg------------------------tga----aatgctctc--tc
A0A2K5KHH8_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K5TMD1_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
F7E8V5_BCL2A1-01        -atctg------------------------tga----aatgctatc--tc
A0A2K5KAA3_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K6LV19_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K6PHF2_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K6AD27_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A096NMX5_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K5TMD1_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K6DS18_BCL2A1-      -ggctt------------------------tgt----aa-----------
B4E1X9_BCL2A1-01        -ttcct------------------------tgc----ta-----------
A0A2R8ZJX9_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2I2YML2_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
Q16548_BCL2A1-01        -atctg------------------------tga----aatgctatc--tc
A0A2I2YML2_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2R8ZJX9_BCL2A1-      -ggctt------------------------tgt----aa-----------
F7HXW0_BCL2A1-01        -ggctt------------------------tgt----aa-----------
A0A2K6TLJ5_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -atctg------------------------cga----aatgctatc--tc
A0A2K5D2I1_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A2K5PYQ3_BCL2A1-      -atctg------------------------tga----aatgctatc--tc
A0A2K5PYQ3_BCL2A1-      -ggctt------------------------tgt----aa-----------
A0A286XUI2_BCL2A1-      -ctctg------------------------tga----gatgctctc--tc
M3WHW2_BCL2A1-01        -atctg------------------------taa----ggtattgtc--tc
M3YVH4_BCL2A1-01        -atctg------------------------tga----aatgttctc--tc
U6CQS8_BCL2A1-01        -atctg------------------------tga----aatgttctc--tc
A0A5F4CJR7_BCL2A1-      -gtgtg------------------------tga----aatgtggtc--ac
A0A5F4CJR7_BCL2A1-      -gtgtg------------------------tga----aatgtggtc--ac
A0A452U285_BCL2A1-      -agctg------------------------c--------tgccacc--tt
A0A452SIR9_BCL2A1-      -atctg------------------------tga----aatgttctc--tc
A0A452U285_BCL2A1-      -atctg------------------------tga----aatgttctc--tc
                                                                          

A0A452J3N6_BCL2A1-      tcttcagt----cagtactattga--------------------------
K7G130_BCL2A1-01        tcttcagt----cagtattattga--------------------------
U3JTB2_BCL2A1-01        tgttcaga----gagtactactga--------------------------
A0A218V8Z6_BCL2A1-      tgttcaga----gagtactactga--------------------------
H0ZCL9_BCL2A1-01        tgttcaga----gagtactactga--------------------------
A0A493SSZ7_BCL2A1-      tgttcaga----gagtag--------------------------------
Q9W6F2_BCL2A1-01        tgttcaga----gagtaccactga--------------------------
G1N8C5_BCL2A1-01        tgttcaga----gactactactga--------------------------
F6S8G3_BCL2A1-01        acctgaag----caattttactga--------------------------
F6SFL4_BCL2A1-01        ttctgaag----taa-----------------------------------
G3WSP8_BCL2A1-01        ttctgaag----taa-----------------------------------
A0A4X2KFL7_BCL2A1-      ttctgaag----taa-----------------------------------
A0A5F9CXI7_BCL2A1-      ttcctaaa------acctcctggaacattcatcagccgagtgagagtgac
A0A5F9CXI7_BCL2A1-      ttcctaaa------acctcctggaacattcatcagccgagtgagagtgac
A0A5F9CXI7_BCL2A1-      ttcctaaa------acctcctggaacattcatcagccgagtgagagtgac
A0A3L7HT14_BCL2A1-      ttcccaa------aacatcctggaatattcatcagcccgctgagggagat
A0A3L7HT14_BCL2A1-      ttcccaa------aacatcctggaatattcatcagcccgctgagggagat
A0A3L7HT14_BCL2A1-      tcctcaag----caaca-------------------ctactg--------
G3GTB4_BCL2A1-01        tcctcaag----caaca-------------------ctactg--------
G3V977_BCL2A1-01        tcctcaag----caacactactga--------------------------
Q925A9_BCL2A1-01        tcctcaag----caacactactga--------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        tcctcaag----taa-----------------------------------
O55179_BCL2A1-01        tcctcaag----taa-----------------------------------
Q8K164_BCL2A1-01        tcctcaag----taa-----------------------------------
Q4FK02_BCL2A1-01        tcctcaag----tag-----------------------------------
O55177_BCL2A1-02        tcctcaag----taa-----------------------------------
Q497M6_BCL2A1-01        tcctcaag----taa-----------------------------------
A0A2K6EKG1_BCL2A1-      ctct------------actcctga--------------------------
I3MCZ7_BCL2A1-01        tcctgaag----caatactattga--------------------------
A0A4W2DYC0_BCL2A1-      gcctgaag----caatactattga--------------------------
A0A4W2DYC0_BCL2A1-      gcctgaag----caatactattga--------------------------
Q3C2I0_BCL2A1-01        gcctgaag----caatactattga--------------------------
L8IZT5_BCL2A1-01        gcctgaag----caatactattga--------------------------
A0A452EK63_BCL2A1-      gtctgaag----caatactattga--------------------------
W5Q0N6_BCL2A1-01        gtctgaag----caatactattga--------------------------
A0A4W2DYC0_BCL2A1-      tgctttac----gaagactcctga--------------------------
A0A4W2DYC0_BCL2A1-      tgctttac----gaagactcctga--------------------------
G3T8E6_BCL2A1-01        tcctgaag----caatactattga--------------------------
A0A4X1UP21_BCL2A1-      tcctgaag----caatactattga--------------------------
A0A4X1UP21_BCL2A1-      tcctgaag----caatactattga--------------------------
C7F841_BCL2A1-01        tcctgaag----caatactattga--------------------------
A0A4X1UP21_BCL2A1-      ctttccaa----cactgcaagtgaacctgtag------------------
H0WZ23_BCL2A1-01        tcctg---------------------------------------------
H2NNZ9_BCL2A1-01        ttctgaag----caatactgt-----------------------------
A0A2I3HBP6_BCL2A1-      --------------------ttga--------------------------
A0A2I3HBP6_BCL2A1-      ---------------------taa--------------------------
A0A2K5KAA3_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K6AD27_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A0D9RRC3_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K6LV19_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K6PHF2_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K5KHH8_BCL2A1-      ttctgaag----caatactgttga--------------------------
A0A096NMX5_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K6DS18_BCL2A1-      ttctgaag----caatactgttga--------------------------
A0A2K5KHH8_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2K5TMD1_BCL2A1-      tcctgaag----caatactgttga--------------------------
F7E8V5_BCL2A1-01        tcctgaag----caatactgttga--------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        -------------------gttaa--------------------------
A0A2R8ZJX9_BCL2A1-      tcctgaag----caatactgttga--------------------------
A0A2I2YML2_BCL2A1-      tcctgaag----caatactgttga--------------------------
Q16548_BCL2A1-01        tcctgaag----caatactgttga--------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      tcttgaag----caatactattga--------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      tcttgaag----caatactattga--------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      tcctgaag----caattctactga--------------------------
M3WHW2_BCL2A1-01        tcctgaag----aactactactga--------------------------
M3YVH4_BCL2A1-01        tcctgaag----caatactactga--------------------------
U6CQS8_BCL2A1-01        tcctgaag----caatactactga--------------------------
A0A5F4CJR7_BCL2A1-      acctaaag----caatactactga--------------------------
A0A5F4CJR7_BCL2A1-      acctaaag----caatactactga--------------------------
A0A452U285_BCL2A1-      ttcagctggctccagcgttcgtgagtag----------------------
A0A452SIR9_BCL2A1-      tcctgaag----caatactactga--------------------------
A0A452U285_BCL2A1-      tcctgaag----caatactactga--------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      acgcgggaggaggccttggccaccgggggcctcgacctcatcttcatgcc
A0A5F9CXI7_BCL2A1-      acgcgggaggaggccttggccaccgggggcctcgacctcatcttcatgcc
A0A5F9CXI7_BCL2A1-      acgcgggaggaggccttggccaccgatg--------caca----catgca
A0A3L7HT14_BCL2A1-      gctcgagaggaggccttatccactggtggacttgacctcatcttcttgcc
A0A3L7HT14_BCL2A1-      gctcgagaggaggccttatccactggtggacttgacctcatcttcttgcc
A0A3L7HT14_BCL2A1-      gccagagag------------------------gaccctggctcc-----
G3GTB4_BCL2A1-01        gccagagag------------------------gaccctggctcc-----
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gggcctcgggctttgcc--------------ccctgctgctgcttttgct
A0A5F9CXI7_BCL2A1-      gggcctcgggttcgacagggacggcaaccggctggggaggggcaggggct
A0A5F9CXI7_BCL2A1-      ga---------tgagcagaga-------aggctatggaagagaagaacc-
A0A3L7HT14_BCL2A1-      aggccttgggtttgacaaagatggcaaccggctagggcggggcaagggct
A0A3L7HT14_BCL2A1-      aggccttgggtttgacaaagatggcaaccggctagggcggggcaagggct
A0A3L7HT14_BCL2A1-      ----------ttcgacaatggtgaccatcacttag---------------
G3GTB4_BCL2A1-01        ----------ttcgacaatggtgaccatcacttag---------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      actccgacatccgtt--cttcgcttgctgc----tcaggtgcggagttta
A0A5F9CXI7_BCL2A1-      actacgacacctacctgcagcgctgcctgcagcagcagggggcaaagccc
A0A5F9CXI7_BCL2A1-      -----------------cagcgc-----------acaggg---aaggctg
A0A3L7HT14_BCL2A1-      actatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccc
A0A3L7HT14_BCL2A1-      actatgacacctacttgaagcgctgtgtgcagcaccaggaagtgaagccc
A0A3L7HT14_BCL2A1-      -----------tactt------ccatttgcaa------------------
G3GTB4_BCL2A1-01        -----------tactt------ccatttgcaa------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      cgcttcctcttcttgctctcggaacgccagcatggtc------------t
A0A5F9CXI7_BCL2A1-      tacaccatcgccctggccttcagagagcagatctgcccccaggtgcccgt
A0A5F9CXI7_BCL2A1-      ttc-------------tctctggagggcgg--------------------
A0A3L7HT14_BCL2A1-      tacaccttggctttggctttcaaagagcagatctgcccccaggtcccagt
A0A3L7HT14_BCL2A1-      tacaccttggctttggctttcaaagagcagatctgcccccaggtcccagt
A0A3L7HT14_BCL2A1-      -acaactcagc---------------------------------------
G3GTB4_BCL2A1-01        -acaactcagc---------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ggagaccagcggctgatactcctaagagcttctctttgttga--------
A0A5F9CXI7_BCL2A1-      ggacgacacagacatgagcgtcgacgaggtgctgtacgtggacgcggccg
A0A5F9CXI7_BCL2A1-      --------taggcagaaatgttaa--------------------------
A0A3L7HT14_BCL2A1-      ggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      ggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccag
A0A3L7HT14_BCL2A1-      ---------tgacagga---------------------------------
G3GTB4_BCL2A1-01        ---------tgacagga---------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
A0A4W2DYC0_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A5F4CJR7_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -----------------
K7G130_BCL2A1-01        -----------------
U3JTB2_BCL2A1-01        -----------------
A0A218V8Z6_BCL2A1-      -----------------
H0ZCL9_BCL2A1-01        -----------------
A0A493SSZ7_BCL2A1-      -----------------
Q9W6F2_BCL2A1-01        -----------------
G1N8C5_BCL2A1-01        -----------------
F6S8G3_BCL2A1-01        -----------------
F6SFL4_BCL2A1-01        -----------------
G3WSP8_BCL2A1-01        -----------------
A0A4X2KFL7_BCL2A1-      -----------------
A0A5F9CXI7_BCL2A1-      -----------------
A0A5F9CXI7_BCL2A1-      cttccctcgcgccctga
A0A5F9CXI7_BCL2A1-      -----------------
A0A3L7HT14_BCL2A1-      catcttaa---------
A0A3L7HT14_BCL2A1-      catcttaa---------
A0A3L7HT14_BCL2A1-      ---cttaa---------
G3GTB4_BCL2A1-01        ---cttaa---------
G3V977_BCL2A1-01        -----------------
Q925A9_BCL2A1-01        -----------------
O55178_BCL2A1-01        -----------------
Q0P538_BCL2A1-01        -----------------
Q07440_BCL2A1-01        -----------------
O55179_BCL2A1-01        -----------------
Q8K164_BCL2A1-01        -----------------
Q4FK02_BCL2A1-01        -----------------
O55177_BCL2A1-02        -----------------
Q497M6_BCL2A1-01        -----------------
A0A2K6EKG1_BCL2A1-      -----------------
I3MCZ7_BCL2A1-01        -----------------
A0A4W2DYC0_BCL2A1-      -----------------
A0A4W2DYC0_BCL2A1-      -----------------
Q3C2I0_BCL2A1-01        -----------------
L8IZT5_BCL2A1-01        -----------------
A0A452EK63_BCL2A1-      -----------------
W5Q0N6_BCL2A1-01        -----------------
A0A4W2DYC0_BCL2A1-      -----------------
A0A4W2DYC0_BCL2A1-      -----------------
G3T8E6_BCL2A1-01        -----------------
A0A4X1UP21_BCL2A1-      -----------------
A0A4X1UP21_BCL2A1-      -----------------
C7F841_BCL2A1-01        -----------------
A0A4X1UP21_BCL2A1-      -----------------
H0WZ23_BCL2A1-01        -----------------
H2NNZ9_BCL2A1-01        -----------------
A0A2I3HBP6_BCL2A1-      -----------------
A0A2I3HBP6_BCL2A1-      -----------------
A0A2K5KAA3_BCL2A1-      -----------------
A0A2K6AD27_BCL2A1-      -----------------
A0A0D9RRC3_BCL2A1-      -----------------
A0A2K6LV19_BCL2A1-      -----------------
A0A2K6PHF2_BCL2A1-      -----------------
A0A2K5KHH8_BCL2A1-      -----------------
A0A096NMX5_BCL2A1-      -----------------
A0A2K6DS18_BCL2A1-      -----------------
A0A2K5KHH8_BCL2A1-      -----------------
A0A2K5TMD1_BCL2A1-      -----------------
F7E8V5_BCL2A1-01        -----------------
A0A2K5KAA3_BCL2A1-      -----------------
A0A2K6LV19_BCL2A1-      -----------------
A0A2K6PHF2_BCL2A1-      -----------------
A0A2K6AD27_BCL2A1-      -----------------
A0A096NMX5_BCL2A1-      -----------------
A0A2K5TMD1_BCL2A1-      -----------------
A0A2K6DS18_BCL2A1-      -----------------
B4E1X9_BCL2A1-01        -----------------
A0A2R8ZJX9_BCL2A1-      -----------------
A0A2I2YML2_BCL2A1-      -----------------
Q16548_BCL2A1-01        -----------------
A0A2I2YML2_BCL2A1-      -----------------
A0A2R8ZJX9_BCL2A1-      -----------------
F7HXW0_BCL2A1-01        -----------------
A0A2K6TLJ5_BCL2A1-      -----------------
A0A2K6TLJ5_BCL2A1-      -----------------
A0A2K5D2I1_BCL2A1-      -----------------
A0A2K5D2I1_BCL2A1-      -----------------
A0A2K5PYQ3_BCL2A1-      -----------------
A0A2K5PYQ3_BCL2A1-      -----------------
A0A286XUI2_BCL2A1-      -----------------
M3WHW2_BCL2A1-01        -----------------
M3YVH4_BCL2A1-01        -----------------
U6CQS8_BCL2A1-01        -----------------
A0A5F4CJR7_BCL2A1-      -----------------
A0A5F4CJR7_BCL2A1-      -----------------
A0A452U285_BCL2A1-      -----------------
A0A452SIR9_BCL2A1-      -----------------
A0A452U285_BCL2A1-      -----------------
                                         

© 1998-2020Legal notice