Dataset for CDS BCL2A1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

79 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        atgtcccatc----------------------------------------
E2RS00_BCL2A1-01        atgacccagccgggaaccaggttctggagagggagcgaacattccatcag
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        ggcagattccgcaaaggctaaagtcccatatgtcatcagtgtgcccgggt
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        -------------------------------------------------t
E2RS00_BCL2A1-01        gggaggccaggctccgtgacccagagggctccaccaggcccccgcccggc
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        ctttggtggttctta-------tgatgcccaacgatgttc--tggggaga
E2RS00_BCL2A1-01        cctcagggactcccaggcacgctaatgacaaatg-tgtccattgggaagg
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        gaagg---------------------------ctgcctg-----------
E2RS00_BCL2A1-01        agaggaagaaagactggcgtttctccctctttctgcctggtcggctggct
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        ------------------------------------------------ct
E2RS00_BCL2A1-01        gaccctgaaggtacagctgggtgggggtggcaacagaacccccaggacct
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        gttggctt------------------------------------------
E2RS00_BCL2A1-01        gccagctcaaaggttcaggaaagtcaacacacagattttccagaggagga
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        -----------catgttcct------------------------------
E2RS00_BCL2A1-01        gcaaagtagaacagggtcctcggctgccagacttcagacccggggtgact
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        -------------------------------------gtg----------
E2RS00_BCL2A1-01        gggcagccaacacgccggaggtctgcctggaagcccagtgctgggccatg
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        ------------------gcccacgcccgagagtgacgaggaggaaggag
E2RS00_BCL2A1-01        ggaatctggcaggagcaagcccacgcccgagagtgacgaggaggaaggag
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
E2RS00_BCL2A1-01        ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
A0A452U285_BCL2A1-      -----------atgcacacagaaattccaccggcctccgcgcgtc-ccat
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      -----------atgcacacagaaattccaccggcctccgcgcgtc-ccat
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      ---------------atgggtcacatcctgctcagcgccactgctggcag
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
E2RS00_BCL2A1-01        gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
A0A452U285_BCL2A1-      gagtcaccgccccagccccgccggcgctcgcctcatttggccnnnnnnnn
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      gagtcaccgccccagccccgccggcgctcgcctcatttggccnnnnnnnn
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      ----------------------------------------------atg-
K7G130_BCL2A1-01        ----------------------------------------------atg-
U3JTB2_BCL2A1-01        ----------------------------------------------atg-
A0A218V8Z6_BCL2A1-      ----------------------------------------------atg-
H0ZCL9_BCL2A1-01        ----------------------------------------------atg-
A0A493SSZ7_BCL2A1-      ----------------------------------------------atg-
Q9W6F2_BCL2A1-01        ----------------------------------------------atg-
G1N8C5_BCL2A1-01        ----------------------------------------------atg-
F6SFL4_BCL2A1-01        ----------------------------------------------atg-
G3WSP8_BCL2A1-01        ----------------------------------------------atg-
F6S8G3_BCL2A1-01        ----------------------------------------------atg-
A0A286XUI2_BCL2A1-      tctcgatctgcgcgagccagcagcaggctgctgtctgccgcccaggatg-
M3YVH4_BCL2A1-01        ----------------------------------------------atg-
U6CQS8_BCL2A1-01        ----------------------------------------------atg-
E2RS00_BCL2A1-02        ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatg-
E2RS00_BCL2A1-01        ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatg-
A0A452U285_BCL2A1-      nnnnnnnnnnnnnnnnnnnnng-----------gggcgggtggaagatg-
A0A452SIR9_BCL2A1-      ----------------------------------------------atg-
A0A452U285_BCL2A1-      nnnnnnnnnnnnnnnnnnnnng-----------gggcgggtggaagatg-
A0A2K6EKG1_BCL2A1-      ----------------------------------------------atg-
I3MCZ7_BCL2A1-01        ----------------------------------------------atg-
L8IZT5_BCL2A1-01        ----------------------------------------------atg-
Q3C2I0_BCL2A1-01        ----------------------------------------------atg-
A0A452EK63_BCL2A1-      ----------------------------------------------atg-
W5Q0N6_BCL2A1-01        ----------------------------------------------atg-
A0A3L7HT14_BCL2A1-      ----------------------------------------------atg-
A0A3L7HT14_BCL2A1-      ----------------------------------------------atga
A0A3L7HT14_BCL2A1-      ----------------------------------------------atga
G3V977_BCL2A1-01        ----------------------------------------------atg-
Q925A9_BCL2A1-01        ----------------------------------------------atg-
O55178_BCL2A1-01        ----------------------------------------------atg-
Q0P538_BCL2A1-01        ----------------------------------------------atg-
Q07440_BCL2A1-01        ----------------------------------------------atg-
O55179_BCL2A1-01        ----------------------------------------------atg-
Q8K164_BCL2A1-01        ----------------------------------------------atg-
Q4FK02_BCL2A1-01        ----------------------------------------------atg-
O55177_BCL2A1-02        ----------------------------------------------atg-
Q497M6_BCL2A1-01        ----------------------------------------------atg-
H0WZ23_BCL2A1-01        ----------------------------------------------atg-
H2NNZ9_BCL2A1-01        ----------------------------------------------atg-
A0A2I3HBP6_BCL2A1-      ----------------------------------------------atg-
A0A2I3HBP6_BCL2A1-      ----------------------------------------------atg-
A0A2K5KAA3_BCL2A1-      ----------------------------------------------atg-
A0A2K6AD27_BCL2A1-      ----------------------------------------------atg-
A0A0D9RRC3_BCL2A1-      ----------------------------------------------atg-
A0A2K6LV19_BCL2A1-      ----------------------------------------------atg-
A0A2K6PHF2_BCL2A1-      ----------------------------------------------atg-
A0A2K5KHH8_BCL2A1-      ----------------------------------------------atg-
A0A096NMX5_BCL2A1-      ----------------------------------------------atg-
A0A2K6DS18_BCL2A1-      ----------------------------------------------atg-
A0A2K5KHH8_BCL2A1-      ----------------------------------------------atg-
A0A2K5TMD1_BCL2A1-      ----------------------------------------------atg-
F7E8V5_BCL2A1-01        ----------------------------------------------atg-
A0A2K5KAA3_BCL2A1-      ----------------------------------------------atg-
A0A2K6LV19_BCL2A1-      ----------------------------------------------atg-
A0A2K6PHF2_BCL2A1-      ----------------------------------------------atg-
A0A2K6AD27_BCL2A1-      ----------------------------------------------atg-
A0A096NMX5_BCL2A1-      ----------------------------------------------atg-
A0A2K5TMD1_BCL2A1-      ----------------------------------------------atg-
A0A2K6DS18_BCL2A1-      ----------------------------------------------atg-
B4E1X9_BCL2A1-01        ----------------------------------------------atg-
A0A2R8ZJX9_BCL2A1-      ----------------------------------------------atg-
A0A2I2YML2_BCL2A1-      ----------------------------------------------atg-
Q16548_BCL2A1-01        ----------------------------------------------atg-
A0A2I2YML2_BCL2A1-      ----------------------------------------------atg-
A0A2R8ZJX9_BCL2A1-      ----------------------------------------------atg-
F7HXW0_BCL2A1-01        ----------------------------------------------atg-
A0A2K6TLJ5_BCL2A1-      ----------------------------------------------atg-
A0A2K6TLJ5_BCL2A1-      ----------------------------------------------atg-
A0A2K5D2I1_BCL2A1-      ----------------------------------------------atg-
A0A2K5D2I1_BCL2A1-      ----------------------------------------------atg-
A0A2K5PYQ3_BCL2A1-      ----------------------------------------------atg-
A0A2K5PYQ3_BCL2A1-      ----------------------------------------------atg-
G3T8E6_BCL2A1-01        ----------------------------------------------atg-
C7F841_BCL2A1-01        ----------------------------------------------atg-
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        ----------------------------------------------atg-
F7CP56_BCL2A1-04        ----------------------------------------------atg-
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      ------------------------------------gcctgt--------
A0A3L7HT14_BCL2A1-      ttaccccttcgttgtcaagccatctttggcttagttgcctctttgactgg
A0A3L7HT14_BCL2A1-      ttaccccttcgttgtcaagccatctttggcttagttgcctctttgactgg
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -------------------------------------gaaagctctgagt
K7G130_BCL2A1-01        -------------------------------------gaaagttctgagt
U3JTB2_BCL2A1-01        -------------------------------------gaaactgctgagt
A0A218V8Z6_BCL2A1-      -------------------------------------gaaactgctgagt
H0ZCL9_BCL2A1-01        -------------------------------------gaaactgctgagt
A0A493SSZ7_BCL2A1-      -------------------------------------gaaactgctgagt
Q9W6F2_BCL2A1-01        -------------------------------------gaaactgctgagt
G1N8C5_BCL2A1-01        -------------------------------------gaaactgctgagt
F6SFL4_BCL2A1-01        -------------------------------------gatgattacgagt
G3WSP8_BCL2A1-01        -------------------------------------gctgattgtgaat
F6S8G3_BCL2A1-01        -------------------------------------gacgacggtgtat
A0A286XUI2_BCL2A1-      -------------------------------------attgacctggagt
M3YVH4_BCL2A1-01        -------------------------------------acagacagtgagt
U6CQS8_BCL2A1-01        -------------------------------------acagacggtgagt
E2RS00_BCL2A1-02        -------------------------------------acggactgcgagt
E2RS00_BCL2A1-01        -------------------------------------acggactgcgagt
A0A452U285_BCL2A1-      -------------------------------------acagactgcgagt
A0A452SIR9_BCL2A1-      -------------------------------------acagactgtgagt
A0A452U285_BCL2A1-      -------------------------------------acagactgcgagt
A0A2K6EKG1_BCL2A1-      -------------------------------------actgactgtgagt
I3MCZ7_BCL2A1-01        -------------------------------------aatgactgtgagt
L8IZT5_BCL2A1-01        -------------------------------------actgacactgagt
Q3C2I0_BCL2A1-01        -------------------------------------actgacactgagt
A0A452EK63_BCL2A1-      -------------------------------------actgacactgagt
W5Q0N6_BCL2A1-01        -------------------------------------actgacactgagt
A0A3L7HT14_BCL2A1-      --------gcgccaatgctagtccacagaggcc-----------------
A0A3L7HT14_BCL2A1-      acttggcagctccagt-ctgctctgccaaggacaatgactgactgtgagt
A0A3L7HT14_BCL2A1-      acttggcagctccagt-ctgctctgccaaggacaatgactgactgtgagt
G3V977_BCL2A1-01        -------------------------------------acagactgtgagt
Q925A9_BCL2A1-01        -------------------------------------acagactgtgagt
O55178_BCL2A1-01        -------------------------------------gctgagtacgagc
Q0P538_BCL2A1-01        -------------------------------------gctgagtacgagc
Q07440_BCL2A1-01        -------------------------------------gctgagtctgagc
O55179_BCL2A1-01        -------------------------------------tctgagtacgagt
Q8K164_BCL2A1-01        -------------------------------------gctgagtacgagt
Q4FK02_BCL2A1-01        -------------------------------------tctgagtacgagt
O55177_BCL2A1-02        -------------------------------------gctgagtacgagt
Q497M6_BCL2A1-01        -------------------------------------gctgagtacgagt
H0WZ23_BCL2A1-01        -------------------------------------actgactgtgagt
H2NNZ9_BCL2A1-01        -------------------------------------acagactgtgaat
A0A2I3HBP6_BCL2A1-      -------------------------------------acagactgcgaat
A0A2I3HBP6_BCL2A1-      -------------------------------------acagactgcgaat
A0A2K5KAA3_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6AD27_BCL2A1-      -------------------------------------acagactgtgaat
A0A0D9RRC3_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6LV19_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6PHF2_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5KHH8_BCL2A1-      -------------------------------------acagactgtgaat
A0A096NMX5_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6DS18_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5KHH8_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5TMD1_BCL2A1-      -------------------------------------acagactgtgaat
F7E8V5_BCL2A1-01        -------------------------------------acagactgtgaat
A0A2K5KAA3_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6LV19_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6PHF2_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6AD27_BCL2A1-      -------------------------------------acagactgtgaat
A0A096NMX5_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5TMD1_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K6DS18_BCL2A1-      -------------------------------------acagactgtgaat
B4E1X9_BCL2A1-01        -------------------------------------acagactgtgaat
A0A2R8ZJX9_BCL2A1-      -------------------------------------acagactgtgaat
A0A2I2YML2_BCL2A1-      -------------------------------------acagactgtgaat
Q16548_BCL2A1-01        -------------------------------------acagactgtgaat
A0A2I2YML2_BCL2A1-      -------------------------------------acagactgtgaat
A0A2R8ZJX9_BCL2A1-      -------------------------------------acagactgtgaat
F7HXW0_BCL2A1-01        -------------------------------------acagactctgaat
A0A2K6TLJ5_BCL2A1-      -------------------------------------acagaccacgaat
A0A2K6TLJ5_BCL2A1-      -------------------------------------acagaccacgaat
A0A2K5D2I1_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5D2I1_BCL2A1-      -------------------------------------acagactgtgaat
A0A2K5PYQ3_BCL2A1-      -------------------------------------acagacagtgaat
A0A2K5PYQ3_BCL2A1-      -------------------------------------acagacagtgaat
G3T8E6_BCL2A1-01        -------------------------------------actgactgtgagt
C7F841_BCL2A1-01        -------------------------------------actgacgacgagt
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        -------------------------------------accgactgtgagt
F7CP56_BCL2A1-04        -------------------------------------accgactgtgagt
                                                                          

A0A452J3N6_BCL2A1-      actgctatgtttactatttagtccaagattatctgaaatacgttcttcag
K7G130_BCL2A1-01        tccgctatgtttactatttagtccaggattatctgaaatacattcttcag
U3JTB2_BCL2A1-01        tctattacgtttattacttagcccaggattatctgcagtatgtgctccag
A0A218V8Z6_BCL2A1-      tctattacgtttattacttagcccaggactatctgcagtatgtgctccag
H0ZCL9_BCL2A1-01        tctattacgtttattacttagcccaggattatctgcagtatgtgctccag
A0A493SSZ7_BCL2A1-      tctattacgtttattatttagctcaagattatctgcaatatgtgcttcag
Q9W6F2_BCL2A1-01        tctattacgtttattatttagctcaagattatctgcagtatgtgcttcag
G1N8C5_BCL2A1-01        tctattatgtttattatttagctcaagattatctgcaatatgtccttcag
F6SFL4_BCL2A1-01        tccattatgttcacatgttagctcgggactacttgaagcatgttcaacag
G3WSP8_BCL2A1-01        tccattatgttcacatgctagcccaggactacttgaagcatgttcaacaa
F6S8G3_BCL2A1-01        tctggtccgtccgagccctggctctggactatctggatgacgtcctccag
A0A286XUI2_BCL2A1-      tcaggtacacgcaggctctggcccaggactacctgctccacgtcctgcag
M3YVH4_BCL2A1-01        tcgggtacacgctgtcgctggcccaggactacgtgaggcatgtcctgcag
U6CQS8_BCL2A1-01        tcgggtacacgctgtcgctggctcaggactacgtgaggcatgtcctgcag
E2RS00_BCL2A1-02        ttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcag
E2RS00_BCL2A1-01        ttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcag
A0A452U285_BCL2A1-      tcgggtacaccctgacgctggcccaggactacgtgaagcacgtcctgcag
A0A452SIR9_BCL2A1-      tcgggtacaccctgacgctggcccaggactacgtgaagcacgtcctgcag
A0A452U285_BCL2A1-      tcgggtacaccctgacgctggcccaggactacgtgaagcacgtcctgcag
A0A2K6EKG1_BCL2A1-      ttggatacacccacaggctggtccaggactacctgcagtacgtcctgcgg
I3MCZ7_BCL2A1-01        tcaggttcatccacacgctggctcaggactacctgcagcacgtcctgcag
L8IZT5_BCL2A1-01        ttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcag
Q3C2I0_BCL2A1-01        ttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcag
A0A452EK63_BCL2A1-      ttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcag
W5Q0N6_BCL2A1-01        ttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcag
A0A3L7HT14_BCL2A1-      ------acgccccctccct-------------------------------
A0A3L7HT14_BCL2A1-      tcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaag
A0A3L7HT14_BCL2A1-      tcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaag
G3V977_BCL2A1-01        tcatgtatatccactccctggctgagaactatcttcagtatgtcctgcag
Q925A9_BCL2A1-01        tcatgtatatccactccctggctgagaactatcttcagtatgtcctgcag
O55178_BCL2A1-01        tcatgcatatccactccctggctgagcactaccttcagtatgtgctacag
Q0P538_BCL2A1-01        tcatgcatatccactccctggctgagcactaccttcagtatgtgctacag
Q07440_BCL2A1-01        tcatgcatatccactccctggctgagcactaccttcagtatgtgctacag
O55179_BCL2A1-01        tcatgtatatccactccctggctgagcactaccttcagtatgtgctacag
Q8K164_BCL2A1-01        tcatgtatatccactccctggctgagcactatcttcagtatgtgctacag
Q4FK02_BCL2A1-01        tcatgtatatccactccctggctgagcactatcttcagtatgtgctacag
O55177_BCL2A1-02        tcatgtatatccactccctggctgagcactatcttcagtatgtgctacag
Q497M6_BCL2A1-01        tcatgtatatccactccctggctgagcactatcttcagtatgtgctacag
H0WZ23_BCL2A1-01        ttggatacattcacaggctggctcaggactatctgcagtatgtcctgcaa
H2NNZ9_BCL2A1-01        ttgggtatatttacaggctagctcaggactatctgcagtacgtcctacag
A0A2I3HBP6_BCL2A1-      ttggatatatttacaggctagctcaggactatctgcagtacgtcctacag
A0A2I3HBP6_BCL2A1-      ttggatatatttacaggctagctcaggactatctgcagtacgtcctacag
A0A2K5KAA3_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6AD27_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtatgttctgcag
A0A0D9RRC3_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6LV19_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6PHF2_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K5KHH8_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A096NMX5_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K6DS18_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K5KHH8_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K5TMD1_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
F7E8V5_BCL2A1-01        ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K5KAA3_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6LV19_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6PHF2_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgtcctgcag
A0A2K6AD27_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtatgttctgcag
A0A096NMX5_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K5TMD1_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
A0A2K6DS18_BCL2A1-      ttggatatatttacaggctagctcaggactatttgcagtacgttctgcag
B4E1X9_BCL2A1-01        ttggatatatttacaggctggctcaggactatctgcagtgcgtcctacag
A0A2R8ZJX9_BCL2A1-      ttggatatatttacaggctggctcaggactatctgcagtacgtcctacag
A0A2I2YML2_BCL2A1-      ttggatatatttacaggctagctcaggactatctgcagtacgtcctacag
Q16548_BCL2A1-01        ttggatatatttacaggctggctcaggactatctgcagtgcgtcctacag
A0A2I2YML2_BCL2A1-      ttggatatatttacaggctagctcaggactatctgcagtacgtcctacag
A0A2R8ZJX9_BCL2A1-      ttggatatatttacaggctggctcaggactatctgcagtacgtcctacag
F7HXW0_BCL2A1-01        ttggatatattcacaatctaactcaggactatctgcagtacgtcctgcag
A0A2K6TLJ5_BCL2A1-      ttggatatattcacaatctaactcaggactatctgcggtatgtcctgcag
A0A2K6TLJ5_BCL2A1-      ttggatatattcacaatctaactcaggactatctgcggtatgtcctgcag
A0A2K5D2I1_BCL2A1-      ttggatatattcacaatctaactcaggactatctgcggtacgtcctgcag
A0A2K5D2I1_BCL2A1-      ttggatatattcacaatctaactcaggactatctgcggtacgtcctgcag
A0A2K5PYQ3_BCL2A1-      ttggatatattcacaatctaactcaggactatctgtggtacgtcctgcag
A0A2K5PYQ3_BCL2A1-      ttggatatattcacaatctaactcaggactatctgtggtacgtcctgcag
G3T8E6_BCL2A1-01        ttggatacatttacaagctggtccaggactatctgaagtacgtcctgcag
C7F841_BCL2A1-01        ttggatatattcacatgctggcccaggactatctgaagtatgtcctgcag
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        ttggatatattcacatgctggcccaggactacctgaagtacgtcctgcag
F7CP56_BCL2A1-04        ttggatatattcacatgctggcccaggactacctgaagtacgtcctgcag
                                                                          

A0A452J3N6_BCL2A1-      gaaccacagcttggaccagccccaagcagagttgctcatgtcttaagaca
K7G130_BCL2A1-01        gaacctgagcttggaccagccccaagcagagttgctcatgtcttaagaaa
U3JTB2_BCL2A1-01        gaatcacacctcggaccagcccagaccagggttgcccatgtcctgcgaac
A0A218V8Z6_BCL2A1-      gaatcacacctcggaccagcccagacccgggttgctcatgtcttgagaac
H0ZCL9_BCL2A1-01        gaatcacacctcggaccagcccagacccgggttgctcatgtcctgagaac
A0A493SSZ7_BCL2A1-      gaatcacatcttggaccagcgcaaaccagagttgctcatgtcttgcgaaa
Q9W6F2_BCL2A1-01        gaatcacatctcggaccagcccaaaccagagttgctcatgtcttgcgaaa
G1N8C5_BCL2A1-01        gaatcacgtcttggaccagcccaaaccagagttgctcatgtcttgcgaaa
F6SFL4_BCL2A1-01        acaccaccactgggatcatgtctaaataagacatctcaaatactacaaaa
G3WSP8_BCL2A1-01        atgccacgactgggatcatgtctacataggacatctcaaatacttcaaaa
F6S8G3_BCL2A1-01        acgccgcgacttgggacggtcccaagcagaacttctcgggcgctgcaaaa
A0A286XUI2_BCL2A1-      gtgcctcagtgcgagaccagccccagcaaggcatccaaggtgctgcagga
M3YVH4_BCL2A1-01        atcccgcagcccagcccggccgccagcagagtgtcccgggtcctgcggga
U6CQS8_BCL2A1-01        atcccgcagcccggcccggccgccagcagagtgtcccgggtcctgcggga
E2RS00_BCL2A1-02        atcccgcagcccggcccggcccccagcagagcgtccagggtgctccagga
E2RS00_BCL2A1-01        atcccgcagcccggcccggcccccagcagagcgtccagggtgctccagga
A0A452U285_BCL2A1-      atcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcggga
A0A452SIR9_BCL2A1-      atcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcggga
A0A452U285_BCL2A1-      atcccgcagccgggctcagccccgagcagggcgtcccaggtgctgcggga
A0A2K6EKG1_BCL2A1-      gttccgcagcccgggtccggtccgagcaagacgtccagagtgctgcaaaa
I3MCZ7_BCL2A1-01        gtaccgcaacgtgggtcaagccccagcaaaacgtccaaagtgttacaaaa
L8IZT5_BCL2A1-01        atacagcaacctggatccaagccaagcaaaatatccagggtgttacaaga
Q3C2I0_BCL2A1-01        atacagcaacctggatccaagccaagcaaaacatccagggtgttacaaga
A0A452EK63_BCL2A1-      atacagcaacctggatccaagccaagcaaaacatccagggtgttacaaga
W5Q0N6_BCL2A1-01        atacagcaacctggatccaagccaagcaaaacatccagggtgttacaaga
A0A3L7HT14_BCL2A1-      -------------------ccccacg------------------------
A0A3L7HT14_BCL2A1-      gtacctacttttgaatctgctccaagcaaaacatccagggtgctacaaag
A0A3L7HT14_BCL2A1-      gtacctacttttgaatctgctccaagcaaaacatccagggtgctacaaag
G3V977_BCL2A1-01        gtacctgcctttgaatcggctccaagcaaaacgtccagagtgctacagag
Q925A9_BCL2A1-01        gtacctgcctttgaatcggctccaagcaaaacgtccagagtgctacagag
O55178_BCL2A1-01        gtacccgcctttgagtcggctccaagccaagcattcagagtgctacaaag
Q0P538_BCL2A1-01        gtacccgcctttgagtcggctccaagccaagcattcagagtgctacaaag
Q07440_BCL2A1-01        gtacccgcctttgagtcggctccaagccaagcatgcagagtgctacaaag
O55179_BCL2A1-01        gtacccgcctttgagtcggctccaagccaagcatgcagagtgctacaaag
Q8K164_BCL2A1-01        gtacccgcctttgagtcggctccaagccaagcatgcagagtgctacaaag
Q4FK02_BCL2A1-01        gtacccgcctttgagtcggctccaagcaaagcatgcagagtgctacaaag
O55177_BCL2A1-02        gtacccgcctttgagtcggctccaagccaagcatgcagagtgctacaaag
Q497M6_BCL2A1-01        gtacccgcctttgagtcggctccaagcaaagcatgcagagtgctacaaag
H0WZ23_BCL2A1-01        atacagcaatgtggatcaggtccaagcaaaacgtccagagtgctgcaaaa
H2NNZ9_BCL2A1-01        ataccacaacctggatcaggtccaagcaaagcgtccagagtactacaaaa
A0A2I3HBP6_BCL2A1-      ataccacagcctggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I3HBP6_BCL2A1-      ataccacagcctggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5KAA3_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6AD27_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A0D9RRC3_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6LV19_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6PHF2_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5KHH8_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A096NMX5_BCL2A1-      ataccacaacctggattgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6DS18_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5KHH8_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5TMD1_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
F7E8V5_BCL2A1-01        ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5KAA3_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6LV19_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6PHF2_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6AD27_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A096NMX5_BCL2A1-      ataccacaacctggattgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5TMD1_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K6DS18_BCL2A1-      ataccacaacctggatcgggtccaagcaaaacgtccagagtgctacaaaa
B4E1X9_BCL2A1-01        ataccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2R8ZJX9_BCL2A1-      ataccacaacctggatcaggtccaagccaaacgtccagagtgctacaaaa
A0A2I2YML2_BCL2A1-      ataccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaa
Q16548_BCL2A1-01        ataccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2I2YML2_BCL2A1-      ataccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaa
A0A2R8ZJX9_BCL2A1-      ataccacaacctggatcaggtccaagccaaacgtccagagtgctacaaaa
F7HXW0_BCL2A1-01        ataccacagtctggaatgggtccgagcaaaacgtctagagtgctacaaca
A0A2K6TLJ5_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagagtactacaaaa
A0A2K6TLJ5_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagagtactacaaaa
A0A2K5D2I1_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagggtgctacaaaa
A0A2K5D2I1_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagggtgctacaaaa
A0A2K5PYQ3_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagagtgctacaaaa
A0A2K5PYQ3_BCL2A1-      ataccacaatctggaacgggtccaagcaaaacgtccagagtgctacaaaa
G3T8E6_BCL2A1-01        ataccacaacctgcagctggttcaagcaaaacgtccagagtgttacaaaa
C7F841_BCL2A1-01        ataccacaacctggatctggtccaagcaaaacatctagagtgttacgaga
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        ataccacaacctggatctggtccaagcaaaacatccagagtgttacaaga
F7CP56_BCL2A1-04        ataccacaacctggatctggtccaagcaaaacatccagagtgttacaaga
                                                                          

A0A452J3N6_BCL2A1-      cgctgcatcctttctgcaaaaggaaaatgaagagagtctgaaaccatgtt
K7G130_BCL2A1-01        ttctgcatcttttcttcaaaaagaaaacgaagagatactgaaaccatgtt
U3JTB2_BCL2A1-01        catggcatcttccctgcaagaccaaaccgaggaggctctcaggccactcc
A0A218V8Z6_BCL2A1-      catggcatcctctctgcaagaccaaacggaggaggctgtcaggccactcc
H0ZCL9_BCL2A1-01        catggcatcctctctgcaagaccaaacggaggaggctgtcaggccgctcc
A0A493SSZ7_BCL2A1-      cattgcatcttcgctgcaagatcaaacagaggaggctctcagacccttcc
Q9W6F2_BCL2A1-01        cattgcatcttcactccaagatcagacagaggaggctctcagacccttct
G1N8C5_BCL2A1-01        tattgcatcctcactccaagatcagacagaggaggcactcagacccttct
F6SFL4_BCL2A1-01        ggttgctttctctgtccaacaagaagtagaaaaggatatggaaacatgct
G3WSP8_BCL2A1-01        agttgctttctctgtccaagaagaagttgaaaaggatatggaaacattct
F6S8G3_BCL2A1-01        cgtcatgttctcggtccagggggacgtggagaaggctctgaagccgtgct
A0A286XUI2_BCL2A1-      catggccctttccgtccaggaagaggtggagaggcggctgaaaccgtggc
M3YVH4_BCL2A1-01        cgtggcctcctccgtgcagggggaggtggaacagaacttgagaccatgct
U6CQS8_BCL2A1-01        cgtggcctcctccgtgcagcgggaggtggaacagaacttgaaaccatgct
E2RS00_BCL2A1-02        cgtggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgct
E2RS00_BCL2A1-01        cgtggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgct
A0A452U285_BCL2A1-      cgtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcc
A0A452SIR9_BCL2A1-      cgtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcc
A0A452U285_BCL2A1-      cgtggcctcctccgtgcagggggaggtggaaaagaacttgaaaccatgcc
A0A2K6EKG1_BCL2A1-      cattgccttctccgtccaaaacgaagtcgaaaagaatctgaaagcatgct
I3MCZ7_BCL2A1-01        cgtggctttctcagtccaaaaagaagttgaaaagaatctgaaaccattct
L8IZT5_BCL2A1-01        tgtggcttcctctgtccaggacgaagtggaaaggactctgaagcagtgct
Q3C2I0_BCL2A1-01        tgtggcttcctctgtccaggacgaagtggaaaggactctgaagcagtgct
A0A452EK63_BCL2A1-      cgtggcttcctctgtccaggacgaagtggaaaggactttgaagcagtgct
W5Q0N6_BCL2A1-01        cgtggcttcctctgtccaggacgaagtggaaaggactctgaagcagtgct
A0A3L7HT14_BCL2A1-      ----gcgtcc----------------------------------------
A0A3L7HT14_BCL2A1-      agttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaactatact
A0A3L7HT14_BCL2A1-      agttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaactatact
G3V977_BCL2A1-01        agttgctttctctgtacaaaaggaagttgaaaagaatctgaagccatact
Q925A9_BCL2A1-01        agttgctttctctgtacaaaaggaagttgaaaagaatctgaagccatact
O55178_BCL2A1-01        agttgctttctccgttcagaaggaagttggaaagaacctaaagtcatact
Q0P538_BCL2A1-01        agttgctttctccgttcagaaggaagttggaaagaacctaaagtcatact
Q07440_BCL2A1-01        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
O55179_BCL2A1-01        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
Q8K164_BCL2A1-01        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
Q4FK02_BCL2A1-01        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
O55177_BCL2A1-02        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
Q497M6_BCL2A1-01        agttgctttctccgttcagaaggaagttgaaaagaatctgaagtcatact
H0WZ23_BCL2A1-01        tgttgcattttcagtccaagaagaggttgaaaagagtctgaaaccatgct
H2NNZ9_BCL2A1-01        ggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2I3HBP6_BCL2A1-      cgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagccgtgct
A0A2I3HBP6_BCL2A1-      cgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagccgtgct
A0A2K5KAA3_BCL2A1-      ggttgcattctcagtccaggaagaagtggaaaagaatctgaagccgtgct
A0A2K6AD27_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A0D9RRC3_BCL2A1-      ggttgcatcctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K6LV19_BCL2A1-      ggttgcattctcagtccagaaagaagtggaaaagaatctgaagccatgct
A0A2K6PHF2_BCL2A1-      ggttgcattctcagtccagaaagaagtggaaaagaatctgaagccatgct
A0A2K5KHH8_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A096NMX5_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K6DS18_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K5KHH8_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K5TMD1_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
F7E8V5_BCL2A1-01        ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K5KAA3_BCL2A1-      ggttgcattctcagtccaggaagaagtggaaaagaatctgaagccgtgct
A0A2K6LV19_BCL2A1-      ggttgcattctcagtccagaaagaagtggaaaagaatctgaagccatgct
A0A2K6PHF2_BCL2A1-      ggttgcattctcagtccagaaagaagtggaaaagaatctgaagccatgct
A0A2K6AD27_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A096NMX5_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K5TMD1_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
A0A2K6DS18_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagaatctgaagccatgct
B4E1X9_BCL2A1-01        tgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
A0A2R8ZJX9_BCL2A1-      tgttgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
A0A2I2YML2_BCL2A1-      ggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
Q16548_BCL2A1-01        tgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
A0A2I2YML2_BCL2A1-      ggttgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
A0A2R8ZJX9_BCL2A1-      tgttgcattctcagtccaaaaagaagtggaaaagaatctgaagtcatgct
F7HXW0_BCL2A1-01        ggttgcattctcagtccaaaaagaagtggaaaagagtctgaagtcatgct
A0A2K6TLJ5_BCL2A1-      ggttgcattctcagtccaaaaggaagtggaagagagtctgaagccatgct
A0A2K6TLJ5_BCL2A1-      ggttgcattctcagtccaaaaggaagtggaagagagtctgaagccatgct
A0A2K5D2I1_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagagtctgaagccatgct
A0A2K5D2I1_BCL2A1-      ggttgcattctcagtccaaaaagaagtggaaaagagtctgaagccatgct
A0A2K5PYQ3_BCL2A1-      ggttgcattctcagtccaa---------------------aagccatgct
A0A2K5PYQ3_BCL2A1-      ggttgcattctcagtccaa---------------------aagccatgct
G3T8E6_BCL2A1-01        tgtggctttctcagttcaaaaagaagttgaaaagaatttgaaaccctgct
C7F841_BCL2A1-01        cgtggctttctccgtccaaaacgaagttgaaaagaatttgaaaccatgct
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        cattgctttctcagttcaaaatgaagtagagaagaatttgaaaccatgct
F7CP56_BCL2A1-04        cattgctttctcagttcaaaatgaagtagagaagaatttgaaaccatgct
                                                                          

A0A452J3N6_BCL2A1-      tggacacatttgatattacctctgtagatgctgccagaagaattttcact
K7G130_BCL2A1-01        tggacacacttgatattacctctgtagatgctgccagaagaattttcatt
U3JTB2_BCL2A1-01        tggacaggattgacatcacctcagtagctgttgccaagagaattttcaat
A0A218V8Z6_BCL2A1-      tggacaggattgacatcagctctgtagctgttgccaagagaattttcaat
H0ZCL9_BCL2A1-01        tggacaggattgacatcacctctgtagcggctgccaagagaattttcaat
A0A493SSZ7_BCL2A1-      tggacaggattgatatcagttctgtagatgttgccaagagaattttcaat
Q9W6F2_BCL2A1-01        tggacaggatcgatattacctccgtagatgttgccaagagaattttcaat
G1N8C5_BCL2A1-01        tggacaggatcgatatcacctctgtagatgttgccaagagaattttcaat
F6SFL4_BCL2A1-01        tgagcactttggacatcgtttctgtagagtctgccagaagaattttcaat
G3WSP8_BCL2A1-01        tgagcactttggacattacttctgtagattgtgccagaagaattttcaac
F6S8G3_BCL2A1-01        tcgacagtctcgacgttggctcggtaggggcagccagaagaatcttcggc
A0A286XUI2_BCL2A1-      tggacagaattgacgtggagtccatcgacactgcgaagtcgatattcaac
M3YVH4_BCL2A1-01        tggacagctttgatgtggggtccatcgacactgccagaaccatcttcaat
U6CQS8_BCL2A1-01        tggacagctttgacgtggggtccatcgacactgccagaaccatcttcaat
E2RS00_BCL2A1-02        tggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaat
E2RS00_BCL2A1-01        tggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaat
A0A452U285_BCL2A1-      tggacagtttcgatgtggtgtccgtcgactccgccagaaccatattcaat
A0A452SIR9_BCL2A1-      tggacagtttcgatgtggtgtccgtcgactccgccagaaccatattcaat
A0A452U285_BCL2A1-      tggacagtttcgatgtggtgtccgtcgactccgccagaaccatattcaat
A0A2K6EKG1_BCL2A1-      tggacaatgttaatgtggcgtccatagatgccgccagaacgatattcaat
I3MCZ7_BCL2A1-01        tggacaattttgatgtggtgtctgctgatactgccagaacaatattcaat
L8IZT5_BCL2A1-01        tggataagtttgatgtggtgtccgtagacactgccagaacaatattcaac
Q3C2I0_BCL2A1-01        tggataagtttgatgtggtgtccgtagacactgccagaacaatattcaac
A0A452EK63_BCL2A1-      tggataagtttgatgtggtgtctgtagacactgccagaacaatattcaac
W5Q0N6_BCL2A1-01        tggataagtttgatgtggtgtctgtagacactgccagaacaatattcaac
A0A3L7HT14_BCL2A1-      ----------------gagggcgatgggcgtggccggggcggtactt-gc
A0A3L7HT14_BCL2A1-      tggatgattttgatgtgagatccatcgacactgccagaacaatattcaat
A0A3L7HT14_BCL2A1-      tggatgattttgatgtgagatccatcgacactgccagaacaatattcaat
G3V977_BCL2A1-01        tggatgactttcacgtggaatccatagatactgccagaataatattcaac
Q925A9_BCL2A1-01        tggatgactttcacgtggaatccatagatactgccagaataatattcaac
O55178_BCL2A1-01        tggatgactttcacgtggaatccatagataccaccagaataatattcaac
Q0P538_BCL2A1-01        tggatgactttcacgtggaatccatagataccaccagaataatattcaac
Q07440_BCL2A1-01        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
O55179_BCL2A1-01        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
Q8K164_BCL2A1-01        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
Q4FK02_BCL2A1-01        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
O55177_BCL2A1-02        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
Q497M6_BCL2A1-01        tggatgactttcacgtggaatccatagataccgccagaataatattcaac
H0WZ23_BCL2A1-01        tagacaattttaatgttgtatccatagatactgccagaacaatattcaat
H2NNZ9_BCL2A1-01        tggacaacgttaatgttgtgtccgtagacactgccagaacactattcaac
A0A2I3HBP6_BCL2A1-      tggacaatgttaatgttgtgtccatagacactgccagaacactattcaac
A0A2I3HBP6_BCL2A1-      tggacaatgttaatgttgtgtccatagacactgccagaacactattcaac
A0A2K5KAA3_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacaatattcaat
A0A2K6AD27_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A0D9RRC3_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6LV19_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6PHF2_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K5KHH8_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A096NMX5_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6DS18_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K5KHH8_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K5TMD1_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
F7E8V5_BCL2A1-01        tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K5KAA3_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacaatattcaat
A0A2K6LV19_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6PHF2_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6AD27_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A096NMX5_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K5TMD1_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
A0A2K6DS18_BCL2A1-      tggacaatgttaatgttgcatccatagacactgccagaacactattcaat
B4E1X9_BCL2A1-01        tggacaatgttaatgttgtgtccgtagacactgccagaacactattcaac
A0A2R8ZJX9_BCL2A1-      tggacaatgttaatgttgtgtctgtagacactgccagaacactattcaac
A0A2I2YML2_BCL2A1-      tggacaatgttaatgttgtgtccatagacactgccagaacactgttcaac
Q16548_BCL2A1-01        tggacaatgttaatgttgtgtccgtagacactgccagaacactattcaac
A0A2I2YML2_BCL2A1-      tggacaatgttaatgttgtgtccatagacactgccagaacactgttcaac
A0A2R8ZJX9_BCL2A1-      tggacaatgttaatgttgtgtctgtagacactgccagaacactattcaac
F7HXW0_BCL2A1-01        tggacaatgttgatattgcgtccatagataatgccagaacgatattcagt
A0A2K6TLJ5_BCL2A1-      tggacaacgttcatattgtgtccatggacaatgccagaacaatattcagt
A0A2K6TLJ5_BCL2A1-      tggacaacgttcatattgtgtccatggacaatgccagaacaatattcagt
A0A2K5D2I1_BCL2A1-      tggacaatgttaatattgtgtccatagataatgccagaatgatattcagt
A0A2K5D2I1_BCL2A1-      tggacaatgttaatattgtgtccatagataatgccagaatgatattcagt
A0A2K5PYQ3_BCL2A1-      tggacaatgttaatattgtgtccatagataatgccagaacgatattcagt
A0A2K5PYQ3_BCL2A1-      tggacaatgttaatattgtgtccatagataatgccagaacgatattcagt
G3T8E6_BCL2A1-01        tggacaattttgttgtcatctccattgataccgcccaaacaatattcaag
C7F841_BCL2A1-01        tggacaattttgatgttgtgtccatagacactgccagaataatattcaat
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        tggacaattttcatgttgtgtccatagatgctgccagaacaatattcaat
F7CP56_BCL2A1-04        tggacaattttcatgttgtgtccatagatgctgccagaacaatattcaat
                                                                          

A0A452J3N6_BCL2A1-      caagtcatggataaagaatttgctgatggaaacactaactgggg---acg
K7G130_BCL2A1-01        caagtcatggataaagaatttgatgatggaaacactaactgggg---gcg
U3JTB2_BCL2A1-01        ggagtcatggatgaaaagtttgctgatggaaatactaactgggg---acg
A0A218V8Z6_BCL2A1-      ggagtcatggatgaaaagtttgctgatggaaatactaactgggg---acg
H0ZCL9_BCL2A1-01        ggagtcatggatgaaaagtttgctgatggaaatactaactgggg---acg
A0A493SSZ7_BCL2A1-      ggtgtcatggatgaaaaatttgctgatggaaatactaattgggg---aag
Q9W6F2_BCL2A1-01        ggagtcatggaagaaaaatttgctgatggaaatactaactgggg---acg
G1N8C5_BCL2A1-01        ggagtcatggaagaaaaatttgctgacggaaatactaactgggg---acg
F6SFL4_BCL2A1-01        agtgttatgaagaaggaatttgaggatggcgtcattaactgggg---acg
G3WSP8_BCL2A1-01        agtgttatggaaaaggaatttgaggatggcatcatcaactgggg---acg
F6S8G3_BCL2A1-01        caaattgtggaaaaggagttcgaggacggcatcgtcaactgggg---gcg
A0A286XUI2_BCL2A1-      caagtgatggagaaggagttcgaggatggcatcattaactgggg---acg
M3YVH4_BCL2A1-01        caagtcatggaaaaggaatttgaagacggcatcattaactgggg---gag
U6CQS8_BCL2A1-01        caagtcatggaaaaggaatttgaagacggcatcattaactgggg---gag
E2RS00_BCL2A1-02        caggtgatggagaaggaatttgaagacggcgtcattaactgggg---aag
E2RS00_BCL2A1-01        caggtgatggagaaggaatttgaagacggcgtcattaactgggg---aag
A0A452U285_BCL2A1-      caggtcatggaaaaggaatttgaagacggcatcattaactgggg---aag
A0A452SIR9_BCL2A1-      caggtcatggaaaaggaatttgaagacggcatcattaactgggg---aag
A0A452U285_BCL2A1-      caggtcatggaaaaggaatttgaagacggcatcattaactgggg---aag
A0A2K6EKG1_BCL2A1-      caagtgatggaaaaggaatttgaagatggcatcgttaactgggg---aag
I3MCZ7_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcatcatgaactgggg---aag
L8IZT5_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcattgttaactgggg---cag
Q3C2I0_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcattgttaactgggg---cag
A0A452EK63_BCL2A1-      caagtgatggaaaaggaatttgaagatggcattgttaactgggg---cag
W5Q0N6_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcattgttaactgggg---cag
A0A3L7HT14_BCL2A1-      cacgtgatggcggcgg---tggcagcaagcagcgccaagcggagcctgcg
A0A3L7HT14_BCL2A1-      caagtgatggaaaaagaatttgaagatggcatcattaactgggg---gag
A0A3L7HT14_BCL2A1-      caagtgatggaaaaagaatttgaagatggcatcattaactgggg---gag
G3V977_BCL2A1-01        caagtgatggaaaaagaatttgaagatggcatcattaactgggg---aag
Q925A9_BCL2A1-01        caagtgatggaaaaagaatttgaagatggcatcattaactgggg---aag
O55178_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaattgggg---aag
Q0P538_BCL2A1-01        caagtgatggaaaaagagtttgaaaatggcatcattaattgggg---aag
Q07440_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
O55179_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
Q8K164_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
Q4FK02_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
O55177_BCL2A1-02        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
Q497M6_BCL2A1-01        caagtgatggaaaaagagtttgaagatggcatcattaactgggg---aag
H0WZ23_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcatcattaactgggg---cag
H2NNZ9_BCL2A1-01        caagtaatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2I3HBP6_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2I3HBP6_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K5KAA3_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6AD27_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A0D9RRC3_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6LV19_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6PHF2_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K5KHH8_BCL2A1-      caagtgatggaaaaggaatttgaagatggcatcattaactgggg---aag
A0A096NMX5_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6DS18_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K5KHH8_BCL2A1-      caagtgatggaaaaggaatttgaagatggcatcattaactgggg---aag
A0A2K5TMD1_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
F7E8V5_BCL2A1-01        caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K5KAA3_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6LV19_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6PHF2_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6AD27_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A096NMX5_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K5TMD1_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2K6DS18_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
B4E1X9_BCL2A1-01        caagtgatggaaaaggagtttgaagacggcatcattaactgggg---aag
A0A2R8ZJX9_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
A0A2I2YML2_BCL2A1-      caagtgatggaaaaggagtttgaagacggcatcattaactgggg---aag
Q16548_BCL2A1-01        caagtgatggaaaaggagtttgaagacggcatcattaactgggg---aag
A0A2I2YML2_BCL2A1-      caagtgatggaaaaggagtttgaagacggcatcattaactgggg---aag
A0A2R8ZJX9_BCL2A1-      caagtgatggaaaaggagtttgaagatggcatcattaactgggg---aag
F7HXW0_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcattattaactgggg---aag
A0A2K6TLJ5_BCL2A1-      caagtgatggaaaaggaatttgaagatggcattattaactgggg---aag
A0A2K6TLJ5_BCL2A1-      caagtgatggaaaaggaatttgaagatggcattattaactgggg---aag
A0A2K5D2I1_BCL2A1-      caagtgatggaaaaggaatttgaagatggcattattaactgggg---aag
A0A2K5D2I1_BCL2A1-      caagtgatggaaaaggaatttgaagatggcattattaactgggg---aag
A0A2K5PYQ3_BCL2A1-      caagtgatggaaacggaatttgaagatggcattattaactgggg---aag
A0A2K5PYQ3_BCL2A1-      caagtgatggaaacggaatttgaagatggcattattaactgggg---aag
G3T8E6_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcatcattaactgggg---aag
C7F841_BCL2A1-01        caagtgatggaaaaggaatttgaagatggcatcattaactgggg---aag
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        ------atggaaaagcaatttgaagatggcatcattaactgggg---aag
F7CP56_BCL2A1-01        caagtgatggaaaagcaatttgaagatggcatcattaactgggg---aag
F7CP56_BCL2A1-04        caagtgatggaaaagcaatttgaagatggcatcattaactgggg---aag
                                                                          

A0A452J3N6_BCL2A1-      gattttgacaatatttatgtttggaggaattctttct-aagaagcttcaa
K7G130_BCL2A1-01        gattttgacaatatttatgtttggaggaattctttct-aagaggcttcaa
U3JTB2_BCL2A1-01        aattatgaccatatttacatttggaggtcttctcacc-aagaagcttcaa
A0A218V8Z6_BCL2A1-      aattatgaccatctttacgtttggaggtcttctcacc-aagaagcttcaa
H0ZCL9_BCL2A1-01        aatcatgaccatctttacatttggaggtcttctcacc-aagaagcttcaa
A0A493SSZ7_BCL2A1-      aattacgaccatatttacttttgggggtcttctcact-aagaagcttcaa
Q9W6F2_BCL2A1-01        aattatgaccatatttacttttggaggtcttctcacc-aagaagcttcaa
G1N8C5_BCL2A1-01        aattatgaccatatttacttttggaggtcttctcacc-aagaagcttcaa
F6SFL4_BCL2A1-01        gattgtcaccatatttgcttttgggggaattctcatc-aagaagcttctg
G3WSP8_BCL2A1-01        gattgtcaccatatttgcttttgggggaattctcatt-aagaaacttctg
F6S8G3_BCL2A1-01        gattgtgacgatatttgtcttggggggcattctcacc-aagaagctcc-a
A0A286XUI2_BCL2A1-      gattgtgactatctttgcttttgggggggtcatcctc-aagaaactccca
M3YVH4_BCL2A1-01        gattgtgaccgtgtttgcctttgaaggcattctctcc-aagaagctcctc
U6CQS8_BCL2A1-01        gattgtgaccgtatttgcctttgaaggcattctctcc-aagaagctcctc
E2RS00_BCL2A1-02        gatcgtgaccgtttttgcctttgaaggaattctcacc-aagaaactcctc
E2RS00_BCL2A1-01        gatcgtgaccgtttttgcctttgaaggaattctcacc-aagaaactcctc
A0A452U285_BCL2A1-      aattgtgaccatatttgcgttcgaagggattctcacc-aagaaactcctc
A0A452SIR9_BCL2A1-      aattgtgaccatatttgcgttcgaagggattctcacc-aagaaactcctc
A0A452U285_BCL2A1-      aattgtgaccatatttgcgttcgaagggattctcacc-aagaaactcctc
A0A2K6EKG1_BCL2A1-      gattgtgaccgtgtttgcattcggaggtattctcatc-aagaaacttcta
I3MCZ7_BCL2A1-01        gattgtgaccatatttgccttcggaggagttctggtc-aagaaacttctg
L8IZT5_BCL2A1-01        gattgtaaccatattcgcctttgaaggtattcttacc-aagaaacttctg
Q3C2I0_BCL2A1-01        gattgtaaccatattcgcctttgaaggtattcttacc-aagaaacttctg
A0A452EK63_BCL2A1-      gattgtaaccatattcgcctttgaaggtattcttacc-aagaaacttctg
W5Q0N6_BCL2A1-01        gattgtaaccatattcgcctttgaaggtattcttacc-aagaaacttctg
A0A3L7HT14_BCL2A1-      ggccgag-ctgaagcagcgtttgcgggcctt-------------------
A0A3L7HT14_BCL2A1-      gattgtgactgtatttgcctttgggggtgttctcctc-aaaaaacttgca
A0A3L7HT14_BCL2A1-      gattgtgactgtatttgcctttgggggtgttctcctc-aaaaaacttgca
G3V977_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctg-aaaaagcttcca
Q925A9_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctg-aaaaagcttcca
O55178_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttcca
Q0P538_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttcca
Q07440_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttcca
O55179_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttcca
Q8K164_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttccg
Q4FK02_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttccg
O55177_BCL2A1-02        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttccg
Q497M6_BCL2A1-01        gattgtgactatatttgcctttgggggtgttctcctc-aaaaaacttccg
H0WZ23_BCL2A1-01        gattgtgacaatatttgcctttggaggtattctcctc-aagaaacttctc
H2NNZ9_BCL2A1-01        aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2I3HBP6_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcgtc-aagaaacttcta
A0A2I3HBP6_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcgtc-aagaaacttcta
A0A2K5KAA3_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6AD27_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A0D9RRC3_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6LV19_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6PHF2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5KHH8_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A096NMX5_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6DS18_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5KHH8_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5TMD1_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
F7E8V5_BCL2A1-01        aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5KAA3_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6LV19_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6PHF2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6AD27_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A096NMX5_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5TMD1_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6DS18_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
B4E1X9_BCL2A1-01        aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2R8ZJX9_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2I2YML2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
Q16548_BCL2A1-01        aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2I2YML2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2R8ZJX9_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
F7HXW0_BCL2A1-01        aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6TLJ5_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K6TLJ5_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5D2I1_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5D2I1_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5PYQ3_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
A0A2K5PYQ3_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcatc-aagaaacttcta
G3T8E6_BCL2A1-01        aattgtgaccatatttgcatttggaggtattctcatc-aagaaacttcta
C7F841_BCL2A1-01        gattgtgaccatatttgcatttgaaggtattctcatg-aagaaacttctg
F7CP56_BCL2A1-03        ----atgacc------------gactgtattctcatc-aagaaacttcta
F7CP56_BCL2A1-02        aattatgaccatatttgcatttgaaggtattctcatc-aagaaacttcta
F7CP56_BCL2A1-01        aattatgaccatatttgcatttgaaggtattctcatc-aagaaacttcta
F7CP56_BCL2A1-04        aattatgaccatatttgcatttgaaggtattctcatc-aagaaacttcta
                                *             *   *  *                    

A0A452J3N6_BCL2A1-      gaacacagagttcagcttacagga-gaaaataaaaagcagatttcttatt
K7G130_BCL2A1-01        gaacacaaagttcagcttacagga-gataataaagagcagatttcttatt
U3JTB2_BCL2A1-01        gagcatggggttcagctgactgca-gaggagaaggaggagatctcttatt
A0A218V8Z6_BCL2A1-      gagcatggggttcagctgactgca-gaagagaaggaggagatctcttatt
H0ZCL9_BCL2A1-01        gagcatggggttcagctgactgca-gaggagaaggagcagatttcttatt
A0A493SSZ7_BCL2A1-      gaacatggagttcagctcactgga-gagaagaaggagcagatctcttatt
Q9W6F2_BCL2A1-01        gagcacggagttcagctcactgga-gaggagaaggagaagatttcttatt
G1N8C5_BCL2A1-01        gagcagggagttcagctcactgga-gaggagaaggagcagatttcttatt
F6SFL4_BCL2A1-01        agacatagagctccactgactatg-ggcactcaggaagaaatttctcatt
G3WSP8_BCL2A1-01        agacacagagctccactgactatg-gacactcatgaagaaatttctcatt
F6S8G3_BCL2A1-01        aaggagcggagtcccgctgacgagagagactcgggaggagatttcttgtt
A0A286XUI2_BCL2A1-      cgagagccaatcgccccagatgtg-gacacttacaaggagatttcctact
M3YVH4_BCL2A1-01        cgggagcgaatttccccggacgtg-gatgcttccagg---gtttcttact
U6CQS8_BCL2A1-01        cgggagcgaatttccccggacgtg-gatgcttccagg---gtttcttact
E2RS00_BCL2A1-02        gagcagcgaatttcctcggatgtg-gatgccgagaag---gtttcctact
E2RS00_BCL2A1-01        gagcagcgaatttcctcggatgtg-gatgccgagaag---gtttcctact
A0A452U285_BCL2A1-      caggagcgaatctccccggatgtg-gacgcttctagg---atttcttact
A0A452SIR9_BCL2A1-      caggagcgaatctccccggatgtg-gacgcttctagg---atttcttact
A0A452U285_BCL2A1-      caggagcgaatctccccggatgtg-gacgcttctagg---atttcttact
A0A2K6EKG1_BCL2A1-      cgagagcagattgccctggatgtg-gatacttacaaggagatttcttatt
I3MCZ7_BCL2A1-01        cgagagcggattgcccctgctgtg-gattccgatgaggagatctcttact
L8IZT5_BCL2A1-01        ggcaagtgtattgcctcagacatg-gacatgtgcaaggacatttcttact
Q3C2I0_BCL2A1-01        ggcaagtgtattgcctcagacatg-gacatgtgcaaggacatttctttct
A0A452EK63_BCL2A1-      agcaagcgtattgcctcagacatg-gacatgtgcaaggacatttcttatt
W5Q0N6_BCL2A1-01        agcaagcgtattgcctcagacatg-gacatgtgcaaggacatttcttatt
A0A3L7HT14_BCL2A1-      -gagcgcgga--ggaacggctgcg-g------------cagtctc-----
A0A3L7HT14_BCL2A1-      caagagcagattggcttggatgtg-ggtgcttacaagcaagtttccaatt
A0A3L7HT14_BCL2A1-      caagagcagattggcttggatgtg-ggtgcttacaagcaagtttccaatt
G3V977_BCL2A1-01        caagagcagattgccctggatgtg-gatacttacaagcaagtttccagtt
Q925A9_BCL2A1-01        caagagcagattggcctggatgtg-gatacttacaagcaagtttccagtt
O55178_BCL2A1-01        caagagcagattgccctggatgta-cgtgcttacaaacaagtttccagtt
Q0P538_BCL2A1-01        caagagcagattgccctggatgta-cgtgcttacaaacaagtttccagtt
Q07440_BCL2A1-01        caagagcagattgccctggatgta-tgtgcttacaaacaagtttccagtt
O55179_BCL2A1-01        caagagcagattgccctggatgta-ggtgcttacaaacaagtttccagtt
Q8K164_BCL2A1-01        caagagcagattgccctggatgta-ggtgcttacaaacaagtttccagtt
Q4FK02_BCL2A1-01        caagagcagattgccctggatgta-ggtgcttacaaacaagtttccagtt
O55177_BCL2A1-02        caagagcagattgccctggatgta-ggtgcttacaaacaagtttccagtt
Q497M6_BCL2A1-01        caagagcagattgccctggatgta-ggtgcttacaaacaagtttccagtt
H0WZ23_BCL2A1-01        caacagcgaattgccctggatgtg-gatacttataaggagatttcttatt
H2NNZ9_BCL2A1-01        cgacagcaaattgccccggatgtg-gatacttacaaggagatttcatatt
A0A2I3HBP6_BCL2A1-      cgacagcgaactgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2I3HBP6_BCL2A1-      cgacagcgaactgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2K5KAA3_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6AD27_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A0D9RRC3_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6LV19_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6PHF2_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K5KHH8_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A096NMX5_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcatatt
A0A2K6DS18_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K5KHH8_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K5TMD1_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
F7E8V5_BCL2A1-01        cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K5KAA3_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6LV19_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6PHF2_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6AD27_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A096NMX5_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcatatt
A0A2K5TMD1_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K6DS18_BCL2A1-      cgacagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
B4E1X9_BCL2A1-01        cgacagcaaattgccccggatgtg-gatacctataaggagatttcatatt
A0A2R8ZJX9_BCL2A1-      cgacagcagattgccccggatgtg-gatacttataaggagatttcatatt
A0A2I2YML2_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcatatt
Q16548_BCL2A1-01        cgacagcaaattgccccggatgtg-gatacctataaggagatttcatatt
A0A2I2YML2_BCL2A1-      cgacagcaaattgccccggatgtg-gatacttataaggagatttcatatt
A0A2R8ZJX9_BCL2A1-      cgacagcagattgccccggatgtg-gatacttataaggagatttcatatt
F7HXW0_BCL2A1-01        cgagagcgaattgccccggatgtg-gatacttacaaggagatctcacatt
A0A2K6TLJ5_BCL2A1-      cgagagcgaattgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2K6TLJ5_BCL2A1-      cgagagcgaattgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2K5D2I1_BCL2A1-      cgagagcgaattgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2K5D2I1_BCL2A1-      cgagagcgaattgccccggatgtg-gatacttacaaggagatttcgtatt
A0A2K5PYQ3_BCL2A1-      caagagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
A0A2K5PYQ3_BCL2A1-      caagagcgaattgccccggatgtg-gatacttataaggagatttcgtatt
G3T8E6_BCL2A1-01        agggagcgaattgccccagatgtg-gatacttacaagaagatttcttctt
C7F841_BCL2A1-01        cgaaagcgaattgccccagatgtg-gacacgtacaaggagatttcttact
F7CP56_BCL2A1-03        ccagagcgaattgccccagatgtg-gatacttacaaggagatttcttact
F7CP56_BCL2A1-02        ccagagcgaattgccccagatgtg-gatacttacaaggagatttcttact
F7CP56_BCL2A1-01        ccagagcgaattgccccagatgtg-gatacttacaaggagatttcttact
F7CP56_BCL2A1-04        ccagagcgaattgccccagatgtg-gatacttacaaggagatttcttact
                                                                 * **     

A0A452J3N6_BCL2A1-      tcatcacagagtacattataaacaccaaggctgagtggatagaggcaaat
K7G130_BCL2A1-01        tcatcacggagtacattataaacaccaaggctgaatggatagatgcaaat
U3JTB2_BCL2A1-01        tcatcacagagtacatcatcaacaacaaatccgaatggattgatgcaaat
A0A218V8Z6_BCL2A1-      tcatcacagagtacatcataaacaacaaagccgaatggattgatgcaaat
H0ZCL9_BCL2A1-01        tcatcacggagtacatcataaacaacaaagctgaatggattgatgcgaat
A0A493SSZ7_BCL2A1-      tcatcacagagtacatcataaacaataaagccgaatggatagatgcaaat
Q9W6F2_BCL2A1-01        tcatcacagagtacatcataaataacaaagccgcatggatagatgcaaac
G1N8C5_BCL2A1-01        tcatcacagagtacatcataaataacaaagccgcatggatagatgcaaac
F6SFL4_BCL2A1-01        ttattgccgagttcataatgaacaatatagcagagtggataagacaaaat
G3WSP8_BCL2A1-01        ttattgctgagttcataatgaacaacatagcagaatggataagacaaaat
F6S8G3_BCL2A1-01        tcatcgcggagttcaccacccaccacgccggagagtggataaggcagaac
A0A286XUI2_BCL2A1-      tcgtggctgagttcataatgagccgcatgggaggctggatacggcagaac
M3YVH4_BCL2A1-01        ttgtggcagagttcatcacgacaaacatgagggagtggataagacagaac
U6CQS8_BCL2A1-01        ttgtggcagagttcatcacgacaaacatgagggagtggataagacaaaac
E2RS00_BCL2A1-02        tcgtggcagagttcatcacgagaaacatgagagactggataagacaaaac
E2RS00_BCL2A1-01        tcgtggcagagttcatcacgagaaacatgagagactggataagacaaaac
A0A452U285_BCL2A1-      tcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaac
A0A452SIR9_BCL2A1-      tcgtggcagagttcatcacgacaaacatgagagagtggataaggcagaac
A0A452U285_BCL2A1-      tcgtggcggagttcatcacgacaaacatgagagagtggataaggcagaac
A0A2K6EKG1_BCL2A1-      ttattgctgagttcataacgaataacgcaggagagtggatacggcagaac
I3MCZ7_BCL2A1-01        ttgtggctgagttcattatgaataatgcaggagaatggataaggcaaaat
L8IZT5_BCL2A1-01        ttgtggcggagttcatcaccgaaaatacaggagagtggataaagcaaaat
Q3C2I0_BCL2A1-01        ttgtggcggagttcatcaccgaaaatacaggagagtggataaagcaaaat
A0A452EK63_BCL2A1-      tcgtggcggagtttatcaccgaaaacacaggagagtggataaggcaaaac
W5Q0N6_BCL2A1-01        tcgtggcggagttcatcaccaaaaacacaggagagtggataaggcaaaac
A0A3L7HT14_BCL2A1-      ---------acctcctcacg------------------------cagaa-
A0A3L7HT14_BCL2A1-      ttgtggctgaattcataatgaataacacagcagagtggatacgtcagaat
A0A3L7HT14_BCL2A1-      ttgtggctgaattcataatgaataacacagcagagtggatacgtcagaat
G3V977_BCL2A1-01        ttgtggcggaattcataatgaataacacaggagaatggatacagcagaat
Q925A9_BCL2A1-01        ttgtggcggaattcataatgaataacacaggagaatggatacagcagaat
O55178_BCL2A1-01        ttggggcagaattcataatgaataa-------------------------
Q0P538_BCL2A1-01        ttggggcagaattcatcatgaataa-------------------------
Q07440_BCL2A1-01        ttgtggcagaattcataatgaataacacaggagaatggatacggcagaat
O55179_BCL2A1-01        ttgtggcagaattcataatgaataacacaggagaatggatacggcggaat
Q8K164_BCL2A1-01        ttgtggcagaattcataatcaataacacaggagaatggatacggcggaat
Q4FK02_BCL2A1-01        ttgtggcagaattcataatcaataacacaggagaatggatacggcggaat
O55177_BCL2A1-02        ttgtggcagaattcataatcaataacacaggagaatggatacggcggaat
Q497M6_BCL2A1-01        ttgtggcagaattcataatcaataacacaggagaatggatacggcggaat
H0WZ23_BCL2A1-01        ttgttgctgagttcataatgaattacacaggagaatggataaggcaaaat
H2NNZ9_BCL2A1-01        ttgttgcggagttcgtcatgaataacacaggaggatggataaagcaaaac
A0A2I3HBP6_BCL2A1-      ttgttgcagagttcataatgaataacacaggagaatggataaggcaaaac
A0A2I3HBP6_BCL2A1-      ttgttgcagagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5KAA3_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6AD27_BCL2A1-      ttgttgctgagttcataatgaataacactggagaatggataaggcaaaac
A0A0D9RRC3_BCL2A1-      ttgttgctgagttcataacgaataacacaggagaatggataaggcaaaac
A0A2K6LV19_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6PHF2_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5KHH8_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A096NMX5_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6DS18_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5KHH8_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5TMD1_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
F7E8V5_BCL2A1-01        ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5KAA3_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6LV19_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6PHF2_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6AD27_BCL2A1-      ttgttgctgagttcataatgaataacactggagaatggataaggcaaaac
A0A096NMX5_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K5TMD1_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
A0A2K6DS18_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataaggcaaaac
B4E1X9_BCL2A1-01        ttgttgcggagttcataatgaataacacaggagaatggataaggcaaaac
A0A2R8ZJX9_BCL2A1-      ttgttgcggagttcataatgaataacacaggagaatggataagacaaaac
A0A2I2YML2_BCL2A1-      ttgttgcggagttcataatgaataacacaggagaatggataaggcaaaac
Q16548_BCL2A1-01        ttgttgcggagttcataatgaataacacaggagaatggataaggcaaaac
A0A2I2YML2_BCL2A1-      ttgttgcggagttcataatgaataacacaggagaatggataaggcaaaac
A0A2R8ZJX9_BCL2A1-      ttgttgcggagttcataatgaataacacaggagaatggataagacaaaac
F7HXW0_BCL2A1-01        ttgttgctgagttcataatgaataacacaggagaatggataagacaaaac
A0A2K6TLJ5_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataagacgaaac
A0A2K6TLJ5_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataagacgaaac
A0A2K5D2I1_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataagtcaaaac
A0A2K5D2I1_BCL2A1-      ttgttgctgagttcataatgaataacacaggagaatggataagtcaaaac
A0A2K5PYQ3_BCL2A1-      ttgttgctgagtacataatgaataacacaggagaatggataagacaaaac
A0A2K5PYQ3_BCL2A1-      ttgttgctgagtacataatgaataacacaggagaatggataagacaaaac
G3T8E6_BCL2A1-01        ttgttgctgagttcatagtggataacacagcagagtggataaggcaaaac
C7F841_BCL2A1-01        ttgtcgccgagttcatcaccaaaaacacaggacagtggataaggcaaaac
F7CP56_BCL2A1-03        ttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaat
F7CP56_BCL2A1-02        ttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaat
F7CP56_BCL2A1-01        ttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaat
F7CP56_BCL2A1-04        ttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaat
                                 *                                        

A0A452J3N6_BCL2A1-      ggaggtt-ggg---------------------------------------
K7G130_BCL2A1-01        ggaggct-ggg---------------------------------------
U3JTB2_BCL2A1-01        ggtggct-ggg---------------------------------------
A0A218V8Z6_BCL2A1-      ggtggct-ggg---------------------------------------
H0ZCL9_BCL2A1-01        ggtggct-ggg---------------------------------------
A0A493SSZ7_BCL2A1-      ggtggct-ggg---------------------------------------
Q9W6F2_BCL2A1-01        ggtggct-ggg---------------------------------------
G1N8C5_BCL2A1-01        ggtggct-ggg---------------------------------------
F6SFL4_BCL2A1-01        ggaggat-ggg---------------------------------------
G3WSP8_BCL2A1-01        ggaggat-ggg---------------------------------------
F6S8G3_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A286XUI2_BCL2A1-      ggaggct-ggg---------------------------------------
M3YVH4_BCL2A1-01        ggaggct-ggg---------------------------------------
U6CQS8_BCL2A1-01        ggaggct-ggg---------------------------------------
E2RS00_BCL2A1-02        ggaggct-ggg---------------------------------------
E2RS00_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A452U285_BCL2A1-      ggaggct-ggt---------------------------------------
A0A452SIR9_BCL2A1-      ggaggct-ggg---------------------------------------
A0A452U285_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K6EKG1_BCL2A1-      ggaggct-ggg---------------------------------------
I3MCZ7_BCL2A1-01        ggaggct-ggg---------------------------------------
L8IZT5_BCL2A1-01        ggaggct-ggg---------------------------------------
Q3C2I0_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A452EK63_BCL2A1-      ggaggct-ggg---------------------------------------
W5Q0N6_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A3L7HT14_BCL2A1-      ---------ggtgattgctcacagtcagtatcaaaattccaaaagaattt
A0A3L7HT14_BCL2A1-      ggaggct-gggtgattgctcacagtcagtatcaaaattccaaaagaattt
A0A3L7HT14_BCL2A1-      ggaggct-ggg---------------------------------------
G3V977_BCL2A1-01        ggaggct-ggg---------------------------------------
Q925A9_BCL2A1-01        ggaggct-ggg---------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ggaggtt-ggg---------------------------------------
O55179_BCL2A1-01        ggaggtt-ggg---------------------------------------
Q8K164_BCL2A1-01        ggaggtt-ggg---------------------------------------
Q4FK02_BCL2A1-01        ggaggtt-ggg---------------------------------------
O55177_BCL2A1-02        ggaggtt-ggg---------------------------------------
Q497M6_BCL2A1-01        ggaggtt-ggg---------------------------------------
H0WZ23_BCL2A1-01        ggaggct-ggg---------------------------------------
H2NNZ9_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A2I3HBP6_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2I3HBP6_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K5KAA3_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K6AD27_BCL2A1-      ggaggct-ggg---------------------------------------
A0A0D9RRC3_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K6LV19_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K6PHF2_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K5KHH8_BCL2A1-      ggaggct-ggg---------------------------------------
A0A096NMX5_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K6DS18_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K5KHH8_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K5TMD1_BCL2A1-      ggaggct-ggg---------------------------------------
F7E8V5_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A2K5KAA3_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K6LV19_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K6PHF2_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K6AD27_BCL2A1-      ggaggctgggg---------------------------------------
A0A096NMX5_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K5TMD1_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K6DS18_BCL2A1-      ggaggctgggg---------------------------------------
B4E1X9_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A2R8ZJX9_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2I2YML2_BCL2A1-      ggaggct-ggg---------------------------------------
Q16548_BCL2A1-01        ggaggct-ggg---------------------------------------
A0A2I2YML2_BCL2A1-      ggaggctgggg---------------------------------------
A0A2R8ZJX9_BCL2A1-      ggaggctgggg---------------------------------------
F7HXW0_BCL2A1-01        ggaggctgggg---------------------------------------
A0A2K6TLJ5_BCL2A1-      ggaggctgggg---------------------------------------
A0A2K6TLJ5_BCL2A1-      ggaggctggg----------------------------------------
A0A2K5D2I1_BCL2A1-      ggaggctggg----------------------------------------
A0A2K5D2I1_BCL2A1-      ggaggctgggc---------------------------------------
A0A2K5PYQ3_BCL2A1-      ggaggct-ggg---------------------------------------
A0A2K5PYQ3_BCL2A1-      ggaggctgggg---------------------------------------
G3T8E6_BCL2A1-01        ggaggct-ggg---------------------------------------
C7F841_BCL2A1-01        ggaggct-ggg---------------------------------------
F7CP56_BCL2A1-03        ggaggct-ggg---------------------------------------
F7CP56_BCL2A1-02        ggaggct-ggg---------------------------------------
F7CP56_BCL2A1-01        ggaggct-ggg---------------------------------------
F7CP56_BCL2A1-04        ggaggct-ggg---------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      ------------------aaaatgg------------------cttccta
K7G130_BCL2A1-01        ------------------aaaacgg------------------cttccta
U3JTB2_BCL2A1-01        ------------------aaaatgg------------------cttccta
A0A218V8Z6_BCL2A1-      ------------------aaaatgg------------------cttccta
H0ZCL9_BCL2A1-01        ------------------aaaatgg------------------cttccta
A0A493SSZ7_BCL2A1-      ------------------aaaatgg------------------cttccta
Q9W6F2_BCL2A1-01        ------------------aaaacgg------------------tttccta
G1N8C5_BCL2A1-01        ------------------aaaatgg------------------tttccta
F6SFL4_BCL2A1-01        ------------------aaaatgg------------------ctttgta
G3WSP8_BCL2A1-01        ------------------aaaatgg------------------cttcata
F6S8G3_BCL2A1-01        ------------------aaaatgg------------------attttta
A0A286XUI2_BCL2A1-      ------------------acaacgg------------------cttcgtg
M3YVH4_BCL2A1-01        ------------------aggatgg------------------ctttgta
U6CQS8_BCL2A1-01        ------------------aggacgg------------------ctttgta
E2RS00_BCL2A1-02        ------------------aaaacgg------------------ctttgtg
E2RS00_BCL2A1-01        ------------------aaaacgg------------------ctttgtg
A0A452U285_BCL2A1-      ------ccctcctcccgccctctgc------------------cagtgtg
A0A452SIR9_BCL2A1-      ------------------aagatgg------------------ctttgta
A0A452U285_BCL2A1-      ------------------aagatgg------------------ctttgta
A0A2K6EKG1_BCL2A1-      ------------------aacacgg------------------cttcgta
I3MCZ7_BCL2A1-01        ------------------aaaatgg------------------ctttgta
L8IZT5_BCL2A1-01        ------------------aaaatgg------------------gtttgta
Q3C2I0_BCL2A1-01        ------------------aaaatgg------------------gtttgta
A0A452EK63_BCL2A1-      ------------------aaaatgg------------------gtttgta
W5Q0N6_BCL2A1-01        ------------------aaaatgg------------------ttttgta
A0A3L7HT14_BCL2A1-      ccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaag
A0A3L7HT14_BCL2A1-      ccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaag
A0A3L7HT14_BCL2A1-      ------------------aagatgg------------------cttcatg
G3V977_BCL2A1-01        ------------------aagatgg------------------cttcaca
Q925A9_BCL2A1-01        ------------------aagatgg------------------cttcaca
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ------------------aagatgg------------------cttcata
O55179_BCL2A1-01        ------------------aagatgg------------------cttcata
Q8K164_BCL2A1-01        ------------------aagatgg------------------cttcata
Q4FK02_BCL2A1-01        ------------------aagatgg------------------cttcata
O55177_BCL2A1-02        ------------------aagatgg------------------cttcata
Q497M6_BCL2A1-01        ------------------aagatgg------------------cttcata
H0WZ23_BCL2A1-01        ------------------aacatgg------------------ctttgta
H2NNZ9_BCL2A1-01        ------------------aaaatgg------------------ctttgta
A0A2I3HBP6_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2I3HBP6_BCL2A1-      ------------------gaaatgg------------------cat----
A0A2K5KAA3_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K6AD27_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A0D9RRC3_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K6LV19_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K6PHF2_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K5KHH8_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A096NMX5_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K6DS18_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K5KHH8_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K5TMD1_BCL2A1-      ------------------aaaatgg------------------ctttgta
F7E8V5_BCL2A1-01        ------------------aaaatgg------------------ctttgta
A0A2K5KAA3_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K6LV19_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K6PHF2_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K6AD27_BCL2A1-      ------------------gaaatgg------------------c------
A0A096NMX5_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K5TMD1_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K6DS18_BCL2A1-      ------------------gaaatgg------------------c------
B4E1X9_BCL2A1-01        ------------------tatgtgt------------------gatggaa
A0A2R8ZJX9_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2I2YML2_BCL2A1-      ------------------aaaatgg------------------ctttgta
Q16548_BCL2A1-01        ------------------aaaatgg------------------ctttgta
A0A2I2YML2_BCL2A1-      ------------------gaaatgg------------------c------
A0A2R8ZJX9_BCL2A1-      ------------------gaaatgg------------------c------
F7HXW0_BCL2A1-01        ------------------gaaatgg------------------c------
A0A2K6TLJ5_BCL2A1-      ------------------gaaatgg------------------a------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K5D2I1_BCL2A1-      ------------------gaaatgg------------------c------
A0A2K5PYQ3_BCL2A1-      ------------------aaaatgg------------------ctttgta
A0A2K5PYQ3_BCL2A1-      ------------------gaaatgg------------------c------
G3T8E6_BCL2A1-01        ------------------aaaatgg------------------ctttgtg
C7F841_BCL2A1-01        ------------------aaaatgg------------------ctttgta
F7CP56_BCL2A1-03        ------------------tgattgc------------------ccacagt
F7CP56_BCL2A1-02        ------------------tgattgc------------------ccacagt
F7CP56_BCL2A1-01        ------------------tgattgc------------------ccacagt
F7CP56_BCL2A1-04        ------------------aaaatgg------------------ctttgta
                                                                          

A0A452J3N6_BCL2A1-      actatgtttgaggaaaaacgat----------------------------
K7G130_BCL2A1-01        cctatgtttgaagaaaaacaat----------------------------
U3JTB2_BCL2A1-01        acaaagtttgaaagaa---gat----------------------------
A0A218V8Z6_BCL2A1-      actaagtttgaaagaa---gat----------------------------
H0ZCL9_BCL2A1-01        actaagtttgaaagaa---gat----------------------------
A0A493SSZ7_BCL2A1-      acaaagtttgaaagaa---gat----------------------------
Q9W6F2_BCL2A1-01        acgaagtttgaaagaa---gat----------------------------
G1N8C5_BCL2A1-01        acaaagtttgaaagaa---gat----------------------------
F6SFL4_BCL2A1-01        aagaactttgaac----ctaat------acag------------------
G3WSP8_BCL2A1-01        aagaactttgaac----ccaat------atgg------------------
F6S8G3_BCL2A1-01        aataagtttgaac----aaaag------accg------------------
A0A286XUI2_BCL2A1-      cggaagtttgagc----ccaaa------tctg------------------
M3YVH4_BCL2A1-01        aagaagttcgagc----ccaag------tccg------------------
U6CQS8_BCL2A1-01        aagaagttcgagc----ccaag------tccg------------------
E2RS00_BCL2A1-02        aagaagttcgaac----ccaag------tctg------------------
E2RS00_BCL2A1-01        aagaagttcgaac----ccaag------tctg------------------
A0A452U285_BCL2A1-      aagggctgcaagc----ggagg------gc--------------------
A0A452SIR9_BCL2A1-      aagaagttcgaac----ccaag------tctg------------------
A0A452U285_BCL2A1-      aagaagttcgaac----ccaag------tctg------------------
A0A2K6EKG1_BCL2A1-      aagaagtttgaac----ctaga------cctg------------------
I3MCZ7_BCL2A1-01        aagaagtttgaac----ctaaa------tctg------------------
L8IZT5_BCL2A1-01        aagaagtttgaaa----ccaaa------tctg------------------
Q3C2I0_BCL2A1-01        aagaagtttgaaa----ccaaa------tctg------------------
A0A452EK63_BCL2A1-      aagaagtttgaaa----ccaaa------tctg------------------
W5Q0N6_BCL2A1-01        aagaagtttgaaa----ccaaa------tctg------------------
A0A3L7HT14_BCL2A1-      gacattttcaaacaaggcaaaa------tctg------------------
A0A3L7HT14_BCL2A1-      gacattttcaaacaaggcaaaa------tctg------------------
A0A3L7HT14_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
G3V977_BCL2A1-01        aagaagtttgaac----ctaaa------tctg------------------
Q925A9_BCL2A1-01        aagaagtttgaac----ctaaa------tctg------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
O55179_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
Q8K164_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
Q4FK02_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
O55177_BCL2A1-02        aagaagtttgaac----ccaaa------tctg------------------
Q497M6_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
H0WZ23_BCL2A1-01        aagaagtttgaac----ctaac------tctg------------------
H2NNZ9_BCL2A1-01        aagaagcttgagc----ctaaa------tctg------------------
A0A2I3HBP6_BCL2A1-      aagaagtttgaac----ctaaa------tctggctggatgacttttctag
A0A2I3HBP6_BCL2A1-      --------------------aa------tc--------------------
A0A2K5KAA3_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K6AD27_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A0D9RRC3_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K6LV19_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K6PHF2_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K5KHH8_BCL2A1-      aagaagcttgagc----ctaaa------tctg------------------
A0A096NMX5_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K6DS18_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K5KHH8_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K5TMD1_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
F7E8V5_BCL2A1-01        aagaagtttgaac----ctaaa------tctg------------------
A0A2K5KAA3_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A2K6LV19_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A2K6PHF2_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A2K6AD27_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A096NMX5_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A2K5TMD1_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
A0A2K6DS18_BCL2A1-      -acaatcacatgc----ctatg-------cta------------------
B4E1X9_BCL2A1-01        aaattcttcattg----ttctt------tcct------------------
A0A2R8ZJX9_BCL2A1-      aagaagtttgaac----ataaa------tctg------------------
A0A2I2YML2_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
Q16548_BCL2A1-01        aagaagtttgaac----ctaaa------tctg------------------
A0A2I2YML2_BCL2A1-      -acaatcacacgc----ctatg-------ctg------------------
A0A2R8ZJX9_BCL2A1-      -acaatcacacgc----ctatg-------ctg------------------
F7HXW0_BCL2A1-01        --acagtctcatg----cttat------gcta------------------
A0A2K6TLJ5_BCL2A1-      --acagtctcatg----cttat------gcta------------------
A0A2K6TLJ5_BCL2A1-      ------------a----cctat----------------------------
A0A2K5D2I1_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K5D2I1_BCL2A1-      --acagtctcctg----cttgt------gctg------------------
A0A2K5PYQ3_BCL2A1-      aagaagtttgaac----ctaaa------tctg------------------
A0A2K5PYQ3_BCL2A1-      --acagtctcatg----cttat------gcta------------------
G3T8E6_BCL2A1-01        aagaagtttgaac----ctagg------tctg------------------
C7F841_BCL2A1-01        aagaagtttgaac----ccaaa------tctg------------------
F7CP56_BCL2A1-03        cagtatcaaaaat----ccaaaaggatttcca------------------
F7CP56_BCL2A1-02        cagtatcaaaaat----ccaaaaggatttcca------------------
F7CP56_BCL2A1-01        cagtatcaaaaat----ccaaaaggatttcca------------------
F7CP56_BCL2A1-04        aagaagtttgaac----ccaaa------tctg------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      aagttacaggaaagatctcaatactgttgactagaaaggacactccatat
A0A2I3HBP6_BCL2A1-      ------------acatgcctatgctg------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        --------------------------------------------------
F7CP56_BCL2A1-02        --------------------------------------------------
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      ------------------------------catggctgtccttat-----
K7G130_BCL2A1-01        ------------------------------cgtggctgtcattat-----
U3JTB2_BCL2A1-01        ------------------------------cactactgtccttct-----
A0A218V8Z6_BCL2A1-      ------------------------------cactactgtccttct-----
H0ZCL9_BCL2A1-01        ------------------------------cactactgtccttct-----
A0A493SSZ7_BCL2A1-      ------------------------------cactactgtctttct-----
Q9W6F2_BCL2A1-01        ------------------------------cacccctatctttct-----
G1N8C5_BCL2A1-01        ------------------------------caccactatctttct-----
F6SFL4_BCL2A1-01        ------------------------------tgtggccgaacttca-----
G3WSP8_BCL2A1-01        ------------------------------tatggccaaacttca-----
F6S8G3_BCL2A1-01        ------------------------------tctggtcggtgttag-----
A0A286XUI2_BCL2A1-      ------------------------------gctggctgacttttg-----
M3YVH4_BCL2A1-01        ------------------------------gctggctgacctttc-----
U6CQS8_BCL2A1-01        ------------------------------gctggctgacctttc-----
E2RS00_BCL2A1-02        ------------------------------gatggctgacttttc-----
E2RS00_BCL2A1-01        ------------------------------gatggctgacttttc-----
A0A452U285_BCL2A1-      ------------------------------------------ccc-----
A0A452SIR9_BCL2A1-      ------------------------------gctggctgacttttc-----
A0A452U285_BCL2A1-      ------------------------------gctggctgacttttc-----
A0A2K6EKG1_BCL2A1-      ------------------------------cctggctgacttttc-----
I3MCZ7_BCL2A1-01        ------------------------------gctggttgacttttc-----
L8IZT5_BCL2A1-01        ------------------------------gctggctgacttttc-----
Q3C2I0_BCL2A1-01        ------------------------------gctggctgacttttc-----
A0A452EK63_BCL2A1-      ------------------------------gctggctgacttttc-----
W5Q0N6_BCL2A1-01        ------------------------------gctggctgacttttc-----
A0A3L7HT14_BCL2A1-      -----------------------cttcatccctcggtaccggttccagag
A0A3L7HT14_BCL2A1-      -----------------------cttcatccctcggtaccggttccagag
A0A3L7HT14_BCL2A1-      ------------------------------gctgggtgacttttc-----
G3V977_BCL2A1-01        ------------------------------gctggctgacttttc-----
Q925A9_BCL2A1-01        ------------------------------gctggctgacttttc-----
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ------------------------------gctggctgacttttc-----
O55179_BCL2A1-01        ------------------------------gctggctgacttttc-----
Q8K164_BCL2A1-01        ------------------------------gctggctgacttttc-----
Q4FK02_BCL2A1-01        ------------------------------gctggctgacttttc-----
O55177_BCL2A1-02        ------------------------------gctggctgacttttc-----
Q497M6_BCL2A1-01        ------------------------------gctggctgacttttc-----
H0WZ23_BCL2A1-01        ---------------------gctactctggctggctgacttttc-----
H2NNZ9_BCL2A1-01        ------------------------------gctggatgactttt------
A0A2I3HBP6_BCL2A1-      tgtgaaaccggcctaatttttctgactcttatggaaacaattgcc-----
A0A2I3HBP6_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K5KAA3_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K6AD27_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A0D9RRC3_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K6LV19_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K6PHF2_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K5KHH8_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A096NMX5_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K6DS18_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K5KHH8_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K5TMD1_BCL2A1-      ------------------------------gctggatgacttttc-----
F7E8V5_BCL2A1-01        ------------------------------gctggatgacttttc-----
A0A2K5KAA3_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K6LV19_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K6PHF2_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K6AD27_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A096NMX5_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K5TMD1_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2K6DS18_BCL2A1-      ------------------------------gtagagtcagtggcc-----
B4E1X9_BCL2A1-01        ------------------------------gtgaaat-------------
A0A2R8ZJX9_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2I2YML2_BCL2A1-      ------------------------------gctggatgacttttc-----
Q16548_BCL2A1-01        ------------------------------gctggatgacttttc-----
A0A2I2YML2_BCL2A1-      ------------------------------gtagagtcagtggcc-----
A0A2R8ZJX9_BCL2A1-      ------------------------------gtagagtcagtggcc-----
F7HXW0_BCL2A1-01        ------------------------------gt---atcagtggcc-----
A0A2K6TLJ5_BCL2A1-      ------------------------------gtggagtcagcg--------
A0A2K6TLJ5_BCL2A1-      ----------------------------------------cg--------
A0A2K5D2I1_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K5D2I1_BCL2A1-      ------------------------------gtggagtcagtggcc-----
A0A2K5PYQ3_BCL2A1-      ------------------------------gctggatgacttttc-----
A0A2K5PYQ3_BCL2A1-      ------------------------------gtagagtcagtggcc-----
G3T8E6_BCL2A1-01        ------------------------------gctggctgacttttc-----
C7F841_BCL2A1-01        ------------------------------gctggctgacctttg-----
F7CP56_BCL2A1-03        ------------------------------tctttctgagcatgc-----
F7CP56_BCL2A1-02        ------------------------------tctttctgagcatgc-----
F7CP56_BCL2A1-01        ------------------------------tctttctgagcatgc-----
F7CP56_BCL2A1-04        ------------------------------gctggctgacttttc-----
                                                                          

A0A452J3N6_BCL2A1-      --------tcaatatt----------aaa-gcaa----------------
K7G130_BCL2A1-01        --------tcaacatt----------aaa-gcaa----------------
U3JTB2_BCL2A1-01        --------ccaaaatt----------aca-gccc----------------
A0A218V8Z6_BCL2A1-      --------ccagaatt----------aca-gccc----------------
H0ZCL9_BCL2A1-01        --------ccaaaatt----------aca-gccc----------------
A0A493SSZ7_BCL2A1-      --------ccaaaatt----------aca-gact----------------
Q9W6F2_BCL2A1-01        --------ctacaatt----------aca-gaca----------------
G1N8C5_BCL2A1-01        --------ctacaatt----------aca-gaca----------------
F6SFL4_BCL2A1-01        --------cagatatt----------tca-acaa----------------
G3WSP8_BCL2A1-01        --------cagatatt----------tca-acaa----------------
F6S8G3_BCL2A1-01        --------cggatatt----------tcg-atga----------------
A0A286XUI2_BCL2A1-      --------tgggagtt----------atg-ggac----------------
M3YVH4_BCL2A1-01        --------tggaagtt----------ata-ggaa----------------
U6CQS8_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
E2RS00_BCL2A1-02        --------tggaagtt----------ctg-ggaa----------------
E2RS00_BCL2A1-01        --------tggaagtt----------ctg-ggaa----------------
A0A452U285_BCL2A1-      --------cggcaggt----------ctgagagg----------------
A0A452SIR9_BCL2A1-      --------tggaagtt----------acg-ggga----------------
A0A452U285_BCL2A1-      --------tggaagtt----------atg-ggga----------------
A0A2K6EKG1_BCL2A1-      --------tggaagtt----------acg-ggga----------------
I3MCZ7_BCL2A1-01        --------tgggagtt----------aca-gggc----------------
L8IZT5_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
Q3C2I0_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
A0A452EK63_BCL2A1-      --------tggaagtt----------aca-ggaa----------------
W5Q0N6_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
A0A3L7HT14_BCL2A1-      caatcacatggacatg----------gtg-agat----------------
A0A3L7HT14_BCL2A1-      caatcacatggacatg----------gtg-agat----------------
A0A3L7HT14_BCL2A1-      --------tggaaacg----------ata-gggc----------------
G3V977_BCL2A1-01        --------tgcagatg----------aca-ggga----------------
Q925A9_BCL2A1-01        --------tgcagatg----------aca-ggga----------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------tgcagatg----------aca-ggac----------------
O55179_BCL2A1-01        --------tgcagatg----------aca-ggac----------------
Q8K164_BCL2A1-01        --------tgcagatg----------aca-ggac----------------
Q4FK02_BCL2A1-01        --------tgcagatg----------aca-ggac----------------
O55177_BCL2A1-02        --------tgcagatg----------aca-ggac----------------
Q497M6_BCL2A1-01        --------tgcagatg----------aca-ggac----------------
H0WZ23_BCL2A1-01        --------tggaagtt----------aca-agaa----------------
H2NNZ9_BCL2A1-01        ----------gaagtt----------aca-ggaa----------------
A0A2I3HBP6_BCL2A1-      --------aacacatacttctactttaaa-ataa----------------
A0A2I3HBP6_BCL2A1-      --------cacaagaa----------gag-gaaa----------------
A0A2K5KAA3_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K6AD27_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A0D9RRC3_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K6LV19_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K6PHF2_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K5KHH8_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A096NMX5_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K6DS18_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K5KHH8_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K5TMD1_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
F7E8V5_BCL2A1-01        --------tagaagtt----------aca-ggaa----------------
A0A2K5KAA3_BCL2A1-      --------cacaagaa----------gaa-gaaa----------------
A0A2K6LV19_BCL2A1-      --------cataggaa----------gaa-gaaa----------------
A0A2K6PHF2_BCL2A1-      --------cacaagaa----------gaa-gaaa----------------
A0A2K6AD27_BCL2A1-      --------cacaggaa----------gaa-gaaa----------------
A0A096NMX5_BCL2A1-      --------cacaagaa----------gaa-gaaa----------------
A0A2K5TMD1_BCL2A1-      --------cac---aa----------gaa-gaaa----------------
A0A2K6DS18_BCL2A1-      --------cacaagaa----------gaa-gaaa----------------
B4E1X9_BCL2A1-01        ------------agaa----------att-gaga----------------
A0A2R8ZJX9_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2I2YML2_BCL2A1-      --------tagaagtt----------acg-ggaa----------------
Q16548_BCL2A1-01        --------tagaagtt----------aca-ggaa----------------
A0A2I2YML2_BCL2A1-      --------cacaagaa----------gag-gaaa----------------
A0A2R8ZJX9_BCL2A1-      --------cacaagaa----------gag-gaaa----------------
F7HXW0_BCL2A1-01        --------cagaagaa----------gag-gaaa----------------
A0A2K6TLJ5_BCL2A1-      --------cagaagaa----------gaa-gaaa----------------
A0A2K6TLJ5_BCL2A1-      --------caatag------------------------------------
A0A2K5D2I1_BCL2A1-      --------tagaagtt----------aca-ggaa----------------
A0A2K5D2I1_BCL2A1-      --------cagaagga----------gag-gaaa----------------
A0A2K5PYQ3_BCL2A1-      --------tagaagtc----------aca-ggaa----------------
A0A2K5PYQ3_BCL2A1-      --------cagaagaa----------gag-gaaa----------------
G3T8E6_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
C7F841_BCL2A1-01        --------tggaagtt----------aca-ggaa----------------
F7CP56_BCL2A1-03        --------aagatgaa----------att-gagacagaagagatcatcag
F7CP56_BCL2A1-02        --------aagatgaa----------att-gagacagaagagatcatcag
F7CP56_BCL2A1-01        --------aagatgaa----------att-gagacagaagagatcatcag
F7CP56_BCL2A1-04        --------tggaagtt----------act-ggaa----------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
A0A3L7HT14_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        ggacattttccaacaaggcaaaacctgctttatcccacggtaccagttca
F7CP56_BCL2A1-02        ggacattttccaacaaggcaaaacctgctttatcccacggtaccagttca
F7CP56_BCL2A1-01        ggacattttccaacaaggcaaaacctgctttatcccacggtaccagttca
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------aaat-catggatgctttttccttcttcag-
K7G130_BCL2A1-01        --------------------aaat-catggatgctttttccttcttcag-
U3JTB2_BCL2A1-01        --------------------tgtt-catagctgttgtttccttgttcag-
A0A218V8Z6_BCL2A1-      --------------------tgtt-catagcccttgtttccttgttcag-
H0ZCL9_BCL2A1-01        --------------------tgtt-catagctcttgtgtccttgttcag-
A0A493SSZ7_BCL2A1-      --------------------tatt-cgtggctgttttttccttgttcag-
Q9W6F2_BCL2A1-01        --------------------tatt-tgcagctgttctttccttgttcag-
G1N8C5_BCL2A1-01        --------------------tatt-tgcagctgttttttccttgttcag-
F6SFL4_BCL2A1-01        -------------ag-----atct-ggggcatattttcc-tttctgaag-
G3WSP8_BCL2A1-01        -------------ag-----atct-ggaatgtattttcc-tttctgaag-
F6S8G3_BCL2A1-01        -------------ag-----atct-tgggcgtactctcc-cacctgaag-
A0A286XUI2_BCL2A1-      -------------ag-----ctct-gtgagatgctctct-ctcctgaag-
M3YVH4_BCL2A1-01        -------------ag-----atct-gtgaaatgttctct-ctcctgaag-
U6CQS8_BCL2A1-01        -------------ag-----atct-gtgaaatgttctct-ctcctgaag-
E2RS00_BCL2A1-02        -------------ca-----gtgt-gtgaaatgtggtca-cacctaaag-
E2RS00_BCL2A1-01        -------------ca-----gtgt-gtgaaatgtggtca-cacctaaag-
A0A452U285_BCL2A1-      -------------ag-----agct-gc----tgccacct-tttcagctgg
A0A452SIR9_BCL2A1-      -------------ag-----atct-gtgaaatgttctct-ctcctgaag-
A0A452U285_BCL2A1-      -------------ag-----atct-gtgaaatgttctct-ctcctgaag-
A0A2K6EKG1_BCL2A1-      -------------ag-----atct-gtgacatgctgtcc-ctcctc----
I3MCZ7_BCL2A1-01        -------------ag-----atct-gtgagatgctgtct-ctcctgaag-
L8IZT5_BCL2A1-01        -------------ag-----atct-gtgaaacattatgt-cgcctgaag-
Q3C2I0_BCL2A1-01        -------------ag-----atct-gtgaaacattatgt-cgcctgaag-
A0A452EK63_BCL2A1-      -------------ag-----atct-gtgaaacattatgt-cgtctgaag-
W5Q0N6_BCL2A1-01        -------------ag-----atct-gtgaaacattatgt-cgtctgaag-
A0A3L7HT14_BCL2A1-      -------------tagcatcacct-gaagagatctctttacttcccaa--
A0A3L7HT14_BCL2A1-      -------------tagcatcacct-gaagagatctctttacttcccaa--
A0A3L7HT14_BCL2A1-      -------------ag-----atct-gggaaatgctcttttctcctcaag-
G3V977_BCL2A1-01        -------------ag-----atct-gggaaatgctcttt-ctcctcaag-
Q925A9_BCL2A1-01        -------------ag-----atct-gggaaatgctcttt-ctcctcaag-
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        -------------ag-----atct-gggaaatgctcttt-ctcctcaag-
O55179_BCL2A1-01        -------------ag-----atct-gggaaatgctcttt-ctcctcaag-
Q8K164_BCL2A1-01        -------------ag-----atct-gggaaatgctcttt-ctcctcaag-
Q4FK02_BCL2A1-01        -------------ag-----ttct-gggaaatgctcttt-ctcctcaag-
O55177_BCL2A1-02        -------------ag-----ttct-gggaaatgctcttt-ctcctcaag-
Q497M6_BCL2A1-01        -------------ag-----ttct-gggaaatgctcttt-ctcctcaag-
H0WZ23_BCL2A1-01        -------------ag-----atct-gtgaaatgctgcct-ctcctg----
H2NNZ9_BCL2A1-01        -------------ag-----atct-gtgaaatgctctct-cttctgaag-
A0A2I3HBP6_BCL2A1-      -------------ac-----aact-ttgatgatgtaac------------
A0A2I3HBP6_BCL2A1-      -------------at-----ggct-ttg----------------------
A0A2K5KAA3_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K6AD27_BCL2A1-      -------------ag-----atct-gtgaaatgctctct-ctcctgaag-
A0A0D9RRC3_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K6LV19_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K6PHF2_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K5KHH8_BCL2A1-      -------------ag-----atct-gtgaaatgctctct-cttctgaag-
A0A096NMX5_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K6DS18_BCL2A1-      -------------ag-----atct-gtgaaatgctctct-cttctgaag-
A0A2K5KHH8_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K5TMD1_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
F7E8V5_BCL2A1-01        -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2K5KAA3_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K6LV19_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K6PHF2_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K6AD27_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A096NMX5_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K5TMD1_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K6DS18_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
B4E1X9_BCL2A1-01        -------------at-----ttcc-ttgcta-------------------
A0A2R8ZJX9_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2I2YML2_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
Q16548_BCL2A1-01        -------------ag-----atct-gtgaaatgctatct-ctcctgaag-
A0A2I2YML2_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2R8ZJX9_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
F7HXW0_BCL2A1-01        -------------at-----ggct-ttgtaa-------------------
A0A2K6TLJ5_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -------------ag-----atct-gcgaaatgctatct-ctcttgaag-
A0A2K5D2I1_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
A0A2K5PYQ3_BCL2A1-      -------------ag-----atct-gtgaaatgctatct-ctcttgaag-
A0A2K5PYQ3_BCL2A1-      -------------at-----ggct-ttgtaa-------------------
G3T8E6_BCL2A1-01        -------------ag-----attt-gtgaaatgttattt-ctcctgaag-
C7F841_BCL2A1-01        -------------ag-----atct-gtgaaatgttatgt-ctcctgaag-
F7CP56_BCL2A1-03        atagcaatcacatgg-----atatggtgaaat-tagcat-cacctgagg-
F7CP56_BCL2A1-02        atagcaatcacatgg-----atatggtgaaat-tagcat-cacctgagg-
F7CP56_BCL2A1-01        atagcaatcacatgg-----atatggtgaaat-tagcat-cacctgagg-
F7CP56_BCL2A1-04        -------------ag-----atgt-gtgaaat---actt-ttcctgaag-
                                                                          

A0A452J3N6_BCL2A1-      --tcagtactat--------------------------------------
K7G130_BCL2A1-01        --tcagtattat--------------------------------------
U3JTB2_BCL2A1-01        --agagtactac--------------------------------------
A0A218V8Z6_BCL2A1-      --agagtactac--------------------------------------
H0ZCL9_BCL2A1-01        --agagtactac--------------------------------------
A0A493SSZ7_BCL2A1-      --agagtag-----------------------------------------
Q9W6F2_BCL2A1-01        --agagtaccac--------------------------------------
G1N8C5_BCL2A1-01        --agactactac--------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        ---caattttac--------------------------------------
A0A286XUI2_BCL2A1-      ---caattctac--------------------------------------
M3YVH4_BCL2A1-01        ---caatactac--------------------------------------
U6CQS8_BCL2A1-01        ---caatactac--------------------------------------
E2RS00_BCL2A1-02        ---caatactac--------------------------------------
E2RS00_BCL2A1-01        ---caatactac--------------------------------------
A0A452U285_BCL2A1-      ctccagcgttcg--------------------------------------
A0A452SIR9_BCL2A1-      ---caatactac--------------------------------------
A0A452U285_BCL2A1-      ---caatactac--------------------------------------
A0A2K6EKG1_BCL2A1-      ------tactcc--------------------------------------
I3MCZ7_BCL2A1-01        ---caatactat--------------------------------------
L8IZT5_BCL2A1-01        ---caatactat--------------------------------------
Q3C2I0_BCL2A1-01        ---caatactat--------------------------------------
A0A452EK63_BCL2A1-      ---caatactat--------------------------------------
W5Q0N6_BCL2A1-01        ---caatactat--------------------------------------
A0A3L7HT14_BCL2A1-      ----aacatcct------------------ggaatattcatcagcccgct
A0A3L7HT14_BCL2A1-      ----aacatcct------------------ggaatattcatcagcccgct
A0A3L7HT14_BCL2A1-      ---caaca-------------------------------------ctact
G3V977_BCL2A1-01        ---caacactac------------------tga-----------------
Q925A9_BCL2A1-01        ---caacactac------------------tga-----------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        ---taa--------------------------------------------
O55179_BCL2A1-01        ---taa--------------------------------------------
Q8K164_BCL2A1-01        ---taa--------------------------------------------
Q4FK02_BCL2A1-01        ---tag--------------------------------------------
O55177_BCL2A1-02        ---taa--------------------------------------------
Q497M6_BCL2A1-01        ---taa--------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        ---caatactgt--------------------------------------
A0A2I3HBP6_BCL2A1-      -----------t--------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      ---caatactgt--------------------------------------
A0A2K6AD27_BCL2A1-      ---caatactgt--------------------------------------
A0A0D9RRC3_BCL2A1-      ---caatactgt--------------------------------------
A0A2K6LV19_BCL2A1-      ---caatactgt--------------------------------------
A0A2K6PHF2_BCL2A1-      ---caatactgt--------------------------------------
A0A2K5KHH8_BCL2A1-      ---caatactgt--------------------------------------
A0A096NMX5_BCL2A1-      ---caatactgt--------------------------------------
A0A2K6DS18_BCL2A1-      ---caatactgt--------------------------------------
A0A2K5KHH8_BCL2A1-      ---caatactgt--------------------------------------
A0A2K5TMD1_BCL2A1-      ---caatactgt--------------------------------------
F7E8V5_BCL2A1-01        ---caatactgt--------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        ----------gt--------------------------------------
A0A2R8ZJX9_BCL2A1-      ---caatactgt--------------------------------------
A0A2I2YML2_BCL2A1-      ---caatactgt--------------------------------------
Q16548_BCL2A1-01        ---caatactgt--------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ---caatactat--------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      ---caatactat--------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        ---caatactat--------------------------------------
C7F841_BCL2A1-01        ---caatactat--------------------------------------
F7CP56_BCL2A1-03        ---aaattttgtcacttcccaaaacatcctggaatattcatcagcctggt
F7CP56_BCL2A1-02        ---aaattttgtcacttcccaaaacatcctggaatattcatcagcctggt
F7CP56_BCL2A1-01        ---aaattttgtcacttcccaaaacatcctggaatattcatcagcctggt
F7CP56_BCL2A1-04        ---caatactac--------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      gagggagatgctcgagaggaggccttatccactggtggacttgacctcat
A0A3L7HT14_BCL2A1-      gagggagatgctcgagaggaggccttatccactggtggacttgacctcat
A0A3L7HT14_BCL2A1-      g--------gccagagag------------------------gaccctgg
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        gaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcat
F7CP56_BCL2A1-02        gaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcat
F7CP56_BCL2A1-01        gaggaggaggttcgggaggaggccttgtcaacagcag-------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      cttcttgccaggccttgggtttgacaaagatggcaaccggctagggcggg
A0A3L7HT14_BCL2A1-      cttcttgccaggccttgggtttgacaaagatggcaaccggctagggcggg
A0A3L7HT14_BCL2A1-      ctcc---------------ttcgacaatggtgaccatcacttag------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        cctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggg
F7CP56_BCL2A1-02        cctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggg
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      gcaagggctactatgacacctacttgaagcgctgtgtgcagcaccaggaa
A0A3L7HT14_BCL2A1-      gcaagggctactatgacacctacttgaagcgctgtgtgcagcaccaggaa
A0A3L7HT14_BCL2A1-      --------------------tactt------ccatttgcaa---------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        gcaagggctactatgacacctacctgaagcgctgtctgcagcaccaggaa
F7CP56_BCL2A1-02        gcaagggctactatgacacctacctgaagcgctgtctgcagcaccaggaa
F7CP56_BCL2A1-01        -------------------------------------------cctggag
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -tga----------------------------------------------
K7G130_BCL2A1-01        -tga----------------------------------------------
U3JTB2_BCL2A1-01        -tga----------------------------------------------
A0A218V8Z6_BCL2A1-      -tga----------------------------------------------
H0ZCL9_BCL2A1-01        -tga----------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        -tga----------------------------------------------
G1N8C5_BCL2A1-01        -tga----------------------------------------------
F6SFL4_BCL2A1-01        -taa----------------------------------------------
G3WSP8_BCL2A1-01        -taa----------------------------------------------
F6S8G3_BCL2A1-01        -tga----------------------------------------------
A0A286XUI2_BCL2A1-      -tga----------------------------------------------
M3YVH4_BCL2A1-01        -tga----------------------------------------------
U6CQS8_BCL2A1-01        -tga----------------------------------------------
E2RS00_BCL2A1-02        -tga----------------------------------------------
E2RS00_BCL2A1-01        -tga----------------------------------------------
A0A452U285_BCL2A1-      -tgagtag------------------------------------------
A0A452SIR9_BCL2A1-      -tga----------------------------------------------
A0A452U285_BCL2A1-      -tga----------------------------------------------
A0A2K6EKG1_BCL2A1-      -tga----------------------------------------------
I3MCZ7_BCL2A1-01        -tga----------------------------------------------
L8IZT5_BCL2A1-01        -tga----------------------------------------------
Q3C2I0_BCL2A1-01        -tga----------------------------------------------
A0A452EK63_BCL2A1-      -tga----------------------------------------------
W5Q0N6_BCL2A1-01        -tga----------------------------------------------
A0A3L7HT14_BCL2A1-      gtgaagccctacaccttggctttggctttcaaagagcagatctgccccca
A0A3L7HT14_BCL2A1-      gtgaagccctacaccttggctttggctttcaaagagcagatctgccccca
A0A3L7HT14_BCL2A1-      ----------acaactcagc------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      -tga----------------------------------------------
A0A2I3HBP6_BCL2A1-      -taa----------------------------------------------
A0A2K5KAA3_BCL2A1-      -tga----------------------------------------------
A0A2K6AD27_BCL2A1-      -tga----------------------------------------------
A0A0D9RRC3_BCL2A1-      -tga----------------------------------------------
A0A2K6LV19_BCL2A1-      -tga----------------------------------------------
A0A2K6PHF2_BCL2A1-      -tga----------------------------------------------
A0A2K5KHH8_BCL2A1-      -tga----------------------------------------------
A0A096NMX5_BCL2A1-      -tga----------------------------------------------
A0A2K6DS18_BCL2A1-      -tga----------------------------------------------
A0A2K5KHH8_BCL2A1-      -tga----------------------------------------------
A0A2K5TMD1_BCL2A1-      -tga----------------------------------------------
F7E8V5_BCL2A1-01        -tga----------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        -taa----------------------------------------------
A0A2R8ZJX9_BCL2A1-      -tga----------------------------------------------
A0A2I2YML2_BCL2A1-      -tga----------------------------------------------
Q16548_BCL2A1-01        -tga----------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -tga----------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      -tga----------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        -tga----------------------------------------------
C7F841_BCL2A1-01        -tga----------------------------------------------
F7CP56_BCL2A1-03        gtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtcca
F7CP56_BCL2A1-02        gtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtcca
F7CP56_BCL2A1-01        atga----------------------------------------------
F7CP56_BCL2A1-04        -tga----------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
U3JTB2_BCL2A1-01        --------------------------------------------------
A0A218V8Z6_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
Q9W6F2_BCL2A1-01        --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
G3WSP8_BCL2A1-01        --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
E2RS00_BCL2A1-02        --------------------------------------------------
E2RS00_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
L8IZT5_BCL2A1-01        --------------------------------------------------
Q3C2I0_BCL2A1-01        --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A3L7HT14_BCL2A1-      ggtcccagtggatgagcatgacatgaaggtagatgaagtcctttatgaag
A0A3L7HT14_BCL2A1-      ggtcccagtggatgagcatgacatgaaggtagatgaagtcctttatgaag
A0A3L7HT14_BCL2A1-      ------------------tgacagga------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
Q07440_BCL2A1-01        --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2I3HBP6_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A096NMX5_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
Q16548_BCL2A1-01        --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
A0A2K5PYQ3_BCL2A1-      --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-03        ggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaag
F7CP56_BCL2A1-02        ggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaag
F7CP56_BCL2A1-01        --------------------------------------------------
F7CP56_BCL2A1-04        --------------------------------------------------
                                                                          

A0A452J3N6_BCL2A1-      -----------------
K7G130_BCL2A1-01        -----------------
U3JTB2_BCL2A1-01        -----------------
A0A218V8Z6_BCL2A1-      -----------------
H0ZCL9_BCL2A1-01        -----------------
A0A493SSZ7_BCL2A1-      -----------------
Q9W6F2_BCL2A1-01        -----------------
G1N8C5_BCL2A1-01        -----------------
F6SFL4_BCL2A1-01        -----------------
G3WSP8_BCL2A1-01        -----------------
F6S8G3_BCL2A1-01        -----------------
A0A286XUI2_BCL2A1-      -----------------
M3YVH4_BCL2A1-01        -----------------
U6CQS8_BCL2A1-01        -----------------
E2RS00_BCL2A1-02        -----------------
E2RS00_BCL2A1-01        -----------------
A0A452U285_BCL2A1-      -----------------
A0A452SIR9_BCL2A1-      -----------------
A0A452U285_BCL2A1-      -----------------
A0A2K6EKG1_BCL2A1-      -----------------
I3MCZ7_BCL2A1-01        -----------------
L8IZT5_BCL2A1-01        -----------------
Q3C2I0_BCL2A1-01        -----------------
A0A452EK63_BCL2A1-      -----------------
W5Q0N6_BCL2A1-01        -----------------
A0A3L7HT14_BCL2A1-      actgcccagcatcttaa
A0A3L7HT14_BCL2A1-      actgcccagcatcttaa
A0A3L7HT14_BCL2A1-      ------------cttaa
G3V977_BCL2A1-01        -----------------
Q925A9_BCL2A1-01        -----------------
O55178_BCL2A1-01        -----------------
Q0P538_BCL2A1-01        -----------------
Q07440_BCL2A1-01        -----------------
O55179_BCL2A1-01        -----------------
Q8K164_BCL2A1-01        -----------------
Q4FK02_BCL2A1-01        -----------------
O55177_BCL2A1-02        -----------------
Q497M6_BCL2A1-01        -----------------
H0WZ23_BCL2A1-01        -----------------
H2NNZ9_BCL2A1-01        -----------------
A0A2I3HBP6_BCL2A1-      -----------------
A0A2I3HBP6_BCL2A1-      -----------------
A0A2K5KAA3_BCL2A1-      -----------------
A0A2K6AD27_BCL2A1-      -----------------
A0A0D9RRC3_BCL2A1-      -----------------
A0A2K6LV19_BCL2A1-      -----------------
A0A2K6PHF2_BCL2A1-      -----------------
A0A2K5KHH8_BCL2A1-      -----------------
A0A096NMX5_BCL2A1-      -----------------
A0A2K6DS18_BCL2A1-      -----------------
A0A2K5KHH8_BCL2A1-      -----------------
A0A2K5TMD1_BCL2A1-      -----------------
F7E8V5_BCL2A1-01        -----------------
A0A2K5KAA3_BCL2A1-      -----------------
A0A2K6LV19_BCL2A1-      -----------------
A0A2K6PHF2_BCL2A1-      -----------------
A0A2K6AD27_BCL2A1-      -----------------
A0A096NMX5_BCL2A1-      -----------------
A0A2K5TMD1_BCL2A1-      -----------------
A0A2K6DS18_BCL2A1-      -----------------
B4E1X9_BCL2A1-01        -----------------
A0A2R8ZJX9_BCL2A1-      -----------------
A0A2I2YML2_BCL2A1-      -----------------
Q16548_BCL2A1-01        -----------------
A0A2I2YML2_BCL2A1-      -----------------
A0A2R8ZJX9_BCL2A1-      -----------------
F7HXW0_BCL2A1-01        -----------------
A0A2K6TLJ5_BCL2A1-      -----------------
A0A2K6TLJ5_BCL2A1-      -----------------
A0A2K5D2I1_BCL2A1-      -----------------
A0A2K5D2I1_BCL2A1-      -----------------
A0A2K5PYQ3_BCL2A1-      -----------------
A0A2K5PYQ3_BCL2A1-      -----------------
G3T8E6_BCL2A1-01        -----------------
C7F841_BCL2A1-01        -----------------
F7CP56_BCL2A1-03        actcttcagcatcttaa
F7CP56_BCL2A1-02        actcttcagcatcttaa
F7CP56_BCL2A1-01        -----------------
F7CP56_BCL2A1-04        -----------------
                                         

© 1998-2020Legal notice