Dataset for CDS BCL2A1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

183 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      ---------------------------------------------atgtc
A0A8I3MYG9_BCL2A1-      atgagcatgatacaggaatgtgcatcactgctggggagaaataaaatgtc
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      ccatctctttggtggttcttatgatgcccaacgatgttctggggagagaa
A0A8I3MYG9_BCL2A1-      ccatctctttggtggttcttatgatgcccaacgatgttctggggagagaa
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      -------------------------------------------------a
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      ggctgcctgctgttggcttcatgttcctgtggcccacgcccgagagtgac
A0A8I3MYG9_BCL2A1-      ggctgcctgctgttggcttcatgttcctgtggcccacgcccgagagtgac
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      tgccggctcaggagcccggttcctcctcagcccagctacgctcagaagtg
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      gaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttc
A0A8I3MYG9_BCL2A1-      gaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttc
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      ------------------------atgcacacagaaattccaccggcctc
G1LIJ8_BCL2A1-01        ------------------------atgcacacagaaattccaccggcctc
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      ------------------------atgcacacagaaattccaccggcctc
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      cctgggagggaggctcctatcagtgatgtaagcagaaattctaccggccc
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      ----------------------------atgggtcacatcctgctcagcg
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      cacgtgccgccctgagtcacatcccgagccccgccagccccggcctcaca
A0A8I3MYG9_BCL2A1-      cacgtgccgccctgagtcacatcccgagccccgccagccccggcctcaca
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      cgcgcgtc-ccatgagtcaccgccccagccccgccggcgctcgcctcatt
G1LIJ8_BCL2A1-01        cacgcctc-ccatgagtcacggtcccagccccgcaggcactcgcct-att
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      cgcgcgtc-ccatgagtcaccgccccagccccgccggcgctcgcctcatt
A0A5F9CXI7_BCL2A1-      -------------------------------------atg----------
A0A5F9CXI7_BCL2A1-      -------------------------------------atg----------
A0A5F9CXI7_BCL2A1-      -------------------------------------atgttcgcctccc
A0A5F9CXI7_BCL2A1-      -------------------------------------atgttcgcctccc
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      ----------atgtgccccactcccgccaagctcggcgagccctggcttc
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      ----------------atgtttcgccaggctccacaagcttgtgcttcag
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      cacatctcattgtgagtcacatcccgccaggcttggaactctagcttcag
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------atgaagcagctccagaccctgctccccgcc
A0A286XUI2_BCL2A1-      ccactgctggcagtctcgatctgcgcgagccagcagcaggctgctgtctg
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      gggcctcaggcagctcacgggggaccaggctcccatcccggcgggcgggc
A0A8I3MYG9_BCL2A1-      gggcctcaggcagctcacgggggaccaggctcccatcccggcgggcgggc
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      tggcc-----------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggc
G1LIJ8_BCL2A1-01        tggcctc-ggctgctggcggcggagcagacggccggctggccagcggggc
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      tggcc-----------nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggggc
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      agggcttcggaagcttccagaagaagcagtcaccggctctgctctccgag
A0A5F9CXI7_BCL2A1-      agggcttcggaagcttccagaagaagcagtcaccggctctgctctccgag
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      agtccgccgcagctgccccggtgagcggctgcagcccgcgcggcacctgc
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      actgtcttggtcagttgcaggtgagcaggctcaagactctgctccccagc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      attttctcagccccttcccggtgaacaagctcaagacgctgctctccagc
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      ---------atggcgg----------------------------------
A0A8B9S513_BCL2A1-      ---------atggaaa----------------------------------
A0A8C6ZVQ3_BCL2A1-      ---------atggaaa----------------------------------
A0A8C5X4L3_BCL2A1-      ---------atggaaa----------------------------------
H0ZCL9_BCL2A1-01        ---------atggaaa----------------------------------
A0A8C5J3C4_BCL2A1-      ---------atggaaa----------------------------------
A0A8D2QAC0_BCL2A1-      ---------atggaaa----------------------------------
A0A8C9MQN0_BCL2A1-      ---------atggaaa----------------------------------
A0A8C3NVU4_BCL2A1-      ---------atggaaa----------------------------------
A0A8D2PM01_BCL2A1-      ---------atggaaa----------------------------------
A0A8C0UPM3_BCL2A1-      ---------atg--------------------------------------
A0A8C0UPM3_BCL2A1-      ---------atggaaa----------------------------------
A0A8C3U920_BCL2A1-      ---------atggaaa----------------------------------
A0A803V184_BCL2A1-      ---------atggaaa----------------------------------
A0A8C2UCW6_BCL2A1-      ---------atggaaa----------------------------------
G1N8C5_BCL2A1-01        ---------atggaaa----------------------------------
A0A8C3KTI3_BCL2A1-      ---------atggaaa----------------------------------
A0A669PVQ4_BCL2A1-      ---------atggaaa----------------------------------
A0A8B9CVY0_BCL2A1-      ---------atggaaa----------------------------------
A0A8B9E009_BCL2A1-      ---------atggaaa----------------------------------
A0A8C3BNR4_BCL2A1-      ---------atggaaa----------------------------------
A0A493SSZ7_BCL2A1-      ---------atggaaa----------------------------------
A0A8B9UZT1_BCL2A1-      ---------atggaaa----------------------------------
A0A8C3K1C5_BCL2A1-      ---------atggaaa----------------------------------
A0A8B9FJB5_BCL2A1-      ---------atggaaa----------------------------------
A0A672UHF9_BCL2A1-      ---------atggaaa----------------------------------
A0A8C4U5U5_BCL2A1-      ---------atgggaa----------------------------------
A0A8B9Z3D5_BCL2A1-      ---------atggaaa----------------------------------
A0A8B9RZD1_BCL2A1-      ---------atggaaa----------------------------------
A0A663E5S6_BCL2A1-      ---------atggaaa----------------------------------
A0A8C8AIP7_BCL2A1-      ---------atggaaa----------------------------------
A0A663N622_BCL2A1-      ---------atggaaa----------------------------------
A0A8C0EQC0_BCL2A1-      ---------atggaaa----------------------------------
A0A8D0ELW8_BCL2A1-      ---------atggaaa----------------------------------
A0A8D0EB90_BCL2A1-      ---------atggaaa----------------------------------
A0A7M4FFQ8_BCL2A1-      ---------atggaaa----------------------------------
A0A8C8SUC3_BCL2A1-      ---------atggaaa----------------------------------
K7G130_BCL2A1-01        ---------atggaaa----------------------------------
A0A8C3FIW3_BCL2A1-      ---------atggaac----------------------------------
A0A8C0G393_BCL2A1-      ---------atggaaa----------------------------------
A0A452J3N6_BCL2A1-      ---------atggaaa----------------------------------
A0A8C4W4P8_BCL2A1-      ---------atggaaa----------------------------------
A0A8C3RME9_BCL2A1-      ---------atggaaa----------------------------------
A0A674K8Q6_BCL2A1-      ---------atggaac----------------------------------
A0A8C6VPU0_BCL2A1-      ---------atggaaa----------------------------------
A0A8C5SDG4_BCL2A1-      ---------atggaaa----------------------------------
A0A670YDS2_BCL2A1-      ---------atggaaa----------------------------------
A0A8D0H8G3_BCL2A1-      ---------atggaga----------------------------------
A0A8D2Q8F9_BCL2A1-      ---------atggaaa----------------------------------
A0A670JXJ0_BCL2A1-      ---------atggaga-gccgagg--------------------------
A0A670JXJ0_BCL2A1-      ---------atgaaaaggctgaagtcactaagttcagctctcaagcaacc
A0A670JXJ0_BCL2A1-      ---------atgaaaaggctgaagtcactaagttcagctctcaagcaacc
F6S8G3_BCL2A1-01        ---------atggacg----------------------------------
A0A8C5VB12_BCL2A1-      gggcggaagatgacgg----------------------------------
A0A286XUI2_BCL2A1-      ccgcccaggatgattg----------------------------------
A0A8C2UN30_BCL2A1-      ---------atgattg----------------------------------
A0A8C5L8K1_BCL2A1-      ---------atgactg----------------------------------
F6SFL4_BCL2A1-01        ---------atggatg----------------------------------
A0A4X2KFL7_BCL2A1-      ---------atggctg----------------------------------
A0A7N4P573_BCL2A1-      ---------atggcgg----------------------------------
A0A7N4P573_BCL2A1-      ---------atggctg----------------------------------
A0A7N4P573_BCL2A1-      ---------atggctg----------------------------------
A0A7N4P573_BCL2A1-      ---------atggctg----------------------------------
A0A8C0KQ53_BCL2A1-      ---------atgacgg----------------------------------
A0A8C0MTY3_BCL2A1-      gggccaaggatgacgg----------------------------------
A0A8I3MYG9_BCL2A1-      gggccaaggatgacgg----------------------------------
M3YVH4_BCL2A1-01        ---------atgacag----------------------------------
U6CQS8_BCL2A1-01        ---------atgacag----------------------------------
A0A452U285_BCL2A1-      gggtggaagatgacag----------------------------------
G1LIJ8_BCL2A1-01        gggtggaagatgacag----------------------------------
A0A452SIR9_BCL2A1-      ---------atgacag----------------------------------
A0A452U285_BCL2A1-      gggtggaagatgacag----------------------------------
A0A5F9CXI7_BCL2A1-      -------------gcg----------------------------------
A0A5F9CXI7_BCL2A1-      -------------gcg----------------------------------
A0A5F9CXI7_BCL2A1-      cagcagaagatgagtg----------------------------------
A0A5F9CXI7_BCL2A1-      cagcagaagatgagtg----------------------------------
A0A8C8X938_BCL2A1-      ---------atggcgg----------------------------------
M3WHW2_BCL2A1-01        ---------atggccg----------------------------------
A0A667HQV5_BCL2A1-      ---------atggcgg----------------------------------
A0A8C9KZ34_BCL2A1-      ---------atggcgg----------------------------------
A0A8C8X938_BCL2A1-      ---------atggcgg----------------------------------
A0A8C9KZ34_BCL2A1-      ---------atggcgg----------------------------------
A0A8C0WAG3_BCL2A1-      tgcgggaagatgagcg----------------------------------
A0A8C6QF32_BCL2A1-      ---------atgactg----------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      ---------atgagtg----------------------------------
G3V977_BCL2A1-01        ---------atgacag----------------------------------
Q925A9_BCL2A1-01        ---------atgacag----------------------------------
O55178_BCL2A1-01        ---------atggctg----------------------------------
Q0P538_BCL2A1-01        ---------atggctg----------------------------------
A0A8C6H5H7_BCL2A1-      ---------atgactg----------------------------------
O55179_BCL2A1-01        ---------atgtctg----------------------------------
Q8K164_BCL2A1-01        ---------atggctg----------------------------------
Q4FK02_BCL2A1-01        ---------atgtctg----------------------------------
O55177_BCL2A1-02        ---------atggctg----------------------------------
Q497M6_BCL2A1-01        ---------atggctg----------------------------------
A0A8C2LQI3_BCL2A1-      ---------atgactg----------------------------------
A0A8C8U2B9_BCL2A1-      ---------atgactg----------------------------------
A0A8D2B7G1_BCL2A1-      ---------atgaatg----------------------------------
A0A8C5YJP3_BCL2A1-      ---------atgaatg----------------------------------
I3MCZ7_BCL2A1-01        ---------atgaatg----------------------------------
A0A8C9PIV7_BCL2A1-      ---------atgaatg----------------------------------
A0A8D2IK51_BCL2A1-      ---------atgaatg----------------------------------
A0A8C9DF25_BCL2A1-      ---------atgagtg----------------------------------
A0A2K6EKG1_BCL2A1-      ---------atgactg----------------------------------
A0A8C6MJ03_BCL2A1-      aaggagaagatgactg----------------------------------
A0A8B9YDG7_BCL2A1-      ---------atg--------------------------------------
A0A8B9YDG7_BCL2A1-      ---------atgactg----------------------------------
A0A8B9YDG7_BCL2A1-      ---------atgactg----------------------------------
A0A8B9YDG7_BCL2A1-      ---------atgactg----------------------------------
A0A452EK63_BCL2A1-      ---------atgactg----------------------------------
W5Q0N6_BCL2A1-01        ---------atgactg----------------------------------
A0A671FLY8_BCL2A1-      tggcagaagatgaccg----------------------------------
H0WZ23_BCL2A1-01        ---------atgactg----------------------------------
F7HXW0_BCL2A1-01        ---------atgacag----------------------------------
F7HXW0_BCL2A1-02        ---------atgacag----------------------------------
A0A2K6TLG6_BCL2A1-      ---------atgacag----------------------------------
A0A2K6TLG6_BCL2A1-      ---------atgacag----------------------------------
A0A2K6TLG6_BCL2A1-      ---------atgacag----------------------------------
A0A2K5D2I1_BCL2A1-      ---------atgacag----------------------------------
A0A2K5D2I1_BCL2A1-      ---------atgacag----------------------------------
A0A2I3GQS0_BCL2A1-      ---------atgacag----------------------------------
A0A2I3GQS0_BCL2A1-      ---------atgacag----------------------------------
A0A2I3GQS0_BCL2A1-      ---------atgacag----------------------------------
A0A2K5KAA3_BCL2A1-      ---------atgacag----------------------------------
A0A8D2E7F6_BCL2A1-      ---------atgacag----------------------------------
A0A8C9HCC9_BCL2A1-      ---------atgacag----------------------------------
A0A2K6AD27_BCL2A1-      ---------atgacag----------------------------------
A0A0D9RRC3_BCL2A1-      ---------atgacag----------------------------------
A0A2K6LV19_BCL2A1-      ---------atgacag----------------------------------
A0A2K6PHF2_BCL2A1-      ---------atgacag----------------------------------
A0A2K5KHH8_BCL2A1-      ---------atgacag----------------------------------
A0A2K6DS18_BCL2A1-      ---------atgacag----------------------------------
A0A2K5KHH8_BCL2A1-      ---------atgacag----------------------------------
A0A2K5TMD1_BCL2A1-      ---------atgacag----------------------------------
F7E8V5_BCL2A1-01        ---------atgacag----------------------------------
A0A2K5KAA3_BCL2A1-      ---------atgacag----------------------------------
A0A2K6LV19_BCL2A1-      ---------atgacag----------------------------------
A0A2K6PHF2_BCL2A1-      ---------atgacag----------------------------------
A0A2K6AD27_BCL2A1-      ---------atgacag----------------------------------
A0A2K5KHH8_BCL2A1-      ---------atgacag----------------------------------
A0A2K5TMD1_BCL2A1-      ---------atgacag----------------------------------
A0A2K6DS18_BCL2A1-      ---------atgacag----------------------------------
H2NNZ9_BCL2A1-01        ---------atgacag----------------------------------
B4E1X9_BCL2A1-03        ---------atgacag----------------------------------
A0A2R8ZJ66_BCL2A1-      ---------atgacag----------------------------------
A0A2R8ZJ66_BCL2A1-      ---------atgacag----------------------------------
B4E1X9_BCL2A1-02        ---------atgacag----------------------------------
A0A2I2YJV4_BCL2A1-      ---------atgacag----------------------------------
A0A2I2YJV4_BCL2A1-      ---------atgacag----------------------------------
A0A2R8ZJ66_BCL2A1-      ---------atgacag----------------------------------
A0A2I2YJV4_BCL2A1-      ---------atgacag----------------------------------
B4E1X9_BCL2A1-01        ---------atgacag----------------------------------
G3T8E6_BCL2A1-01        ---------atgactg----------------------------------
A0A8C3WEA1_BCL2A1-      ---------atgacgg----------------------------------
A0A8D1BRF8_BCL2A1-      ---------atggc-g----------------------------------
A0A8D0Z1Y4_BCL2A1-      ---------atggc-g----------------------------------
A0A8D1SK15_BCL2A1-      ---------atggc-g----------------------------------
A0A4X1UP21_BCL2A1-      ---------atggc-g----------------------------------
A0A8D1BRF8_BCL2A1-      ---------atggc-g----------------------------------
A0A8D1YBS8_BCL2A1-      ---------atggc-g----------------------------------
A0A4X1UP21_BCL2A1-      ---------atgactg----------------------------------
A0A4X1UQW5_BCL2A1-      ---------atgactg----------------------------------
A0A8D0Z1Y4_BCL2A1-      ---------atgactg----------------------------------
A0A8D1BRF8_BCL2A1-      ---------atgactg----------------------------------
A0A8D1SK15_BCL2A1-      ---------atgactg----------------------------------
A0A8D1YBS8_BCL2A1-      ---------atgactg----------------------------------
C7F841_BCL2A1-01        ---------atgactg----------------------------------
A0A8D1KPD1_BCL2A1-      ---------atgactg----------------------------------
A0A8D1BRF8_BCL2A1-      ---------atgactg----------------------------------
A0A4X1UP21_BCL2A1-      ---------atgactg----------------------------------
A0A8D1SK15_BCL2A1-      ---------atgactg----------------------------------
A0A8D0Z1Y4_BCL2A1-      ---------atgactg----------------------------------
A0A8D1YBS8_BCL2A1-      ---------atgactg----------------------------------
A0A8C0CSU7_BCL2A1-      ---------atgaccg----------------------------------
A0A8C6FDW6_BCL2A1-      ---------atgaccg----------------------------------
A0A8C9BC20_BCL2A1-      ---------atgaccg----------------------------------
A0A5F5PK00_BCL2A1-      ---------atgaccg----------------------------------
A0A8C4PQL1_BCL2A1-      ---------atgaccg----------------------------------
A0A5F5PK00_BCL2A1-      ---------atgaccg----------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      -----------------------------------ac--g----------
A0A8B9S513_BCL2A1-      ---------------------------------ccgc--t----------
A0A8C6ZVQ3_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C5X4L3_BCL2A1-      ---------------------------------ctgc--t----------
H0ZCL9_BCL2A1-01        ---------------------------------ctgc--t----------
A0A8C5J3C4_BCL2A1-      ---------------------------------ctgc--t----------
A0A8D2QAC0_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C9MQN0_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C3NVU4_BCL2A1-      ---------------------------------ctgc--t----------
A0A8D2PM01_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C0UPM3_BCL2A1-      ---------------------------------ctgg--g----------
A0A8C0UPM3_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C3U920_BCL2A1-      ---------------------------------ctgc--t----------
A0A803V184_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C2UCW6_BCL2A1-      ---------------------------------ccgc--t----------
G1N8C5_BCL2A1-01        ---------------------------------ctgc--t----------
A0A8C3KTI3_BCL2A1-      ---------------------------------ctgc--t----------
A0A669PVQ4_BCL2A1-      ---------------------------------ctgc--t----------
A0A8B9CVY0_BCL2A1-      ---------------------------------ctgc--t----------
A0A8B9E009_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C3BNR4_BCL2A1-      ---------------------------------ctgc--t----------
A0A493SSZ7_BCL2A1-      ---------------------------------ctgc--t----------
A0A8B9UZT1_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C3K1C5_BCL2A1-      ---------------------------------cggc--t----------
A0A8B9FJB5_BCL2A1-      ---------------------------------ctgc--t----------
A0A672UHF9_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C4U5U5_BCL2A1-      ---------------------------------ctgc--g----------
A0A8B9Z3D5_BCL2A1-      ---------------------------------ctgc--t----------
A0A8B9RZD1_BCL2A1-      ---------------------------------ctgc--t----------
A0A663E5S6_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C8AIP7_BCL2A1-      ---------------------------------ctgc--t----------
A0A663N622_BCL2A1-      ---------------------------------ctgc--t----------
A0A8C0EQC0_BCL2A1-      ---------------------------------ctgc--t----------
A0A8D0ELW8_BCL2A1-      ---------------------------------ctgc--t----------
A0A8D0EB90_BCL2A1-      -----------------------------------gc--t----------
A0A7M4FFQ8_BCL2A1-      -----------------------------------gc--a----------
A0A8C8SUC3_BCL2A1-      -----------------------------------gc--t----------
K7G130_BCL2A1-01        -----------------------------------gt--t----------
A0A8C3FIW3_BCL2A1-      -----------------------------------gc--t----------
A0A8C0G393_BCL2A1-      -----------------------------------gc--t----------
A0A452J3N6_BCL2A1-      -----------------------------------gc--t----------
A0A8C4W4P8_BCL2A1-      -----------------------------------gc--t----------
A0A8C3RME9_BCL2A1-      -----------------------------------gc--t----------
A0A674K8Q6_BCL2A1-      -----------------------------------gc--t----------
A0A8C6VPU0_BCL2A1-      -----------------------------------gc--t----------
A0A8C5SDG4_BCL2A1-      -----------------------------------gc--t----------
A0A670YDS2_BCL2A1-      -----------------------------------gc--t----------
A0A8D0H8G3_BCL2A1-      -----------------------------------gc--t----------
A0A8D2Q8F9_BCL2A1-      -----------------------------------gc--t----------
A0A670JXJ0_BCL2A1-      -------------------------ggagggcgcagc--c----------
A0A670JXJ0_BCL2A1-      tgcaaatcatttgaacctgcattgtggaggtcacagc--ttgcattttgc
A0A670JXJ0_BCL2A1-      tgcaaatcatttgaacctgcattgtggaggtcacagc--ttgcattttgc
F6S8G3_BCL2A1-01        -----------------------------------ac--g----------
A0A8C5VB12_BCL2A1-      -----------------------------------gc--t----------
A0A286XUI2_BCL2A1-      -----------------------------------ac--c----------
A0A8C2UN30_BCL2A1-      -----------------------------------ac--c----------
A0A8C5L8K1_BCL2A1-      -----------------------------------ac--t----------
F6SFL4_BCL2A1-01        -----------------------------------at--t----------
A0A4X2KFL7_BCL2A1-      -----------------------------------at--t----------
A0A7N4P573_BCL2A1-      -----------------------------------ctgcg----------
A0A7N4P573_BCL2A1-      -----------------------------------at--t----------
A0A7N4P573_BCL2A1-      -----------------------------------at--t----------
A0A7N4P573_BCL2A1-      -----------------------------------at--t----------
A0A8C0KQ53_BCL2A1-      -----------------------------------ac--t----------
A0A8C0MTY3_BCL2A1-      -----------------------------------ac--t----------
A0A8I3MYG9_BCL2A1-      -----------------------------------ac--t----------
M3YVH4_BCL2A1-01        -----------------------------------ac--a----------
U6CQS8_BCL2A1-01        -----------------------------------ac--g----------
A0A452U285_BCL2A1-      -----------------------------------ac--t----------
G1LIJ8_BCL2A1-01        -----------------------------------ac--t----------
A0A452SIR9_BCL2A1-      -----------------------------------ac--t----------
A0A452U285_BCL2A1-      -----------------------------------ac--t----------
A0A5F9CXI7_BCL2A1-      -----------------------------------gc--g----------
A0A5F9CXI7_BCL2A1-      -----------------------------------gc--g----------
A0A5F9CXI7_BCL2A1-      -----------------------------------ac--t----------
A0A5F9CXI7_BCL2A1-      -----------------------------------ac--t----------
A0A8C8X938_BCL2A1-      ------------------------------------c--g----------
M3WHW2_BCL2A1-01        -----------------------------------ac--g----------
A0A667HQV5_BCL2A1-      -----------------------------------ac--g----------
A0A8C9KZ34_BCL2A1-      -----------------------------------at--g----------
A0A8C8X938_BCL2A1-      -----------------------------------ac--g----------
A0A8C9KZ34_BCL2A1-      -----------------------------------at--g----------
A0A8C0WAG3_BCL2A1-      -----------------------------------ag--g----------
A0A8C6QF32_BCL2A1-      -----------------------------------ac--t----------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      -----------------------------------ag--t----------
G3V977_BCL2A1-01        -----------------------------------ac--t----------
Q925A9_BCL2A1-01        -----------------------------------ac--t----------
O55178_BCL2A1-01        -----------------------------------ag--t----------
Q0P538_BCL2A1-01        -----------------------------------ag--t----------
A0A8C6H5H7_BCL2A1-      -----------------------------------ag--t----------
O55179_BCL2A1-01        -----------------------------------ag--t----------
Q8K164_BCL2A1-01        -----------------------------------ag--t----------
Q4FK02_BCL2A1-01        -----------------------------------ag--t----------
O55177_BCL2A1-02        -----------------------------------ag--t----------
Q497M6_BCL2A1-01        -----------------------------------ag--t----------
A0A8C2LQI3_BCL2A1-      -----------------------------------ac--t----------
A0A8C8U2B9_BCL2A1-      -----------------------------------ac--t----------
A0A8D2B7G1_BCL2A1-      -----------------------------------ac--t----------
A0A8C5YJP3_BCL2A1-      -----------------------------------ac--t----------
I3MCZ7_BCL2A1-01        -----------------------------------ac--t----------
A0A8C9PIV7_BCL2A1-      -----------------------------------ac--t----------
A0A8D2IK51_BCL2A1-      -----------------------------------ac--t----------
A0A8C9DF25_BCL2A1-      -----------------------------------ac--t----------
A0A2K6EKG1_BCL2A1-      -----------------------------------ac--t----------
A0A8C6MJ03_BCL2A1-      -----------------------------------ag--a----------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      -----------------------------------ac--a----------
A0A8B9YDG7_BCL2A1-      -----------------------------------ac--a----------
A0A8B9YDG7_BCL2A1-      -----------------------------------ac--a----------
A0A452EK63_BCL2A1-      -----------------------------------ac--a----------
W5Q0N6_BCL2A1-01        -----------------------------------ac--a----------
A0A671FLY8_BCL2A1-      -----------------------------------ac--t----------
H0WZ23_BCL2A1-01        -----------------------------------ac--t----------
F7HXW0_BCL2A1-01        -----------------------------------ac--t----------
F7HXW0_BCL2A1-02        -----------------------------------ac--t----------
A0A2K6TLG6_BCL2A1-      -----------------------------------ac--c----------
A0A2K6TLG6_BCL2A1-      -----------------------------------ac--c----------
A0A2K6TLG6_BCL2A1-      -----------------------------------ac--c----------
A0A2K5D2I1_BCL2A1-      -----------------------------------ac--t----------
A0A2K5D2I1_BCL2A1-      -----------------------------------ac--t----------
A0A2I3GQS0_BCL2A1-      -----------------------------------ac--t----------
A0A2I3GQS0_BCL2A1-      -----------------------------------ac--t----------
A0A2I3GQS0_BCL2A1-      -----------------------------------ac--t----------
A0A2K5KAA3_BCL2A1-      -----------------------------------ac--t----------
A0A8D2E7F6_BCL2A1-      -----------------------------------ac--t----------
A0A8C9HCC9_BCL2A1-      -----------------------------------ac--t----------
A0A2K6AD27_BCL2A1-      -----------------------------------ac--t----------
A0A0D9RRC3_BCL2A1-      -----------------------------------ac--t----------
A0A2K6LV19_BCL2A1-      -----------------------------------ac--t----------
A0A2K6PHF2_BCL2A1-      -----------------------------------ac--t----------
A0A2K5KHH8_BCL2A1-      -----------------------------------ac--t----------
A0A2K6DS18_BCL2A1-      -----------------------------------ac--t----------
A0A2K5KHH8_BCL2A1-      -----------------------------------ac--t----------
A0A2K5TMD1_BCL2A1-      -----------------------------------ac--t----------
F7E8V5_BCL2A1-01        -----------------------------------ac--t----------
A0A2K5KAA3_BCL2A1-      -----------------------------------ac--t----------
A0A2K6LV19_BCL2A1-      -----------------------------------ac--t----------
A0A2K6PHF2_BCL2A1-      -----------------------------------ac--t----------
A0A2K6AD27_BCL2A1-      -----------------------------------ac--t----------
A0A2K5KHH8_BCL2A1-      -----------------------------------ac--t----------
A0A2K5TMD1_BCL2A1-      -----------------------------------ac--t----------
A0A2K6DS18_BCL2A1-      -----------------------------------ac--t----------
H2NNZ9_BCL2A1-01        -----------------------------------ac--t----------
B4E1X9_BCL2A1-03        -----------------------------------ac--t----------
A0A2R8ZJ66_BCL2A1-      -----------------------------------ac--t----------
A0A2R8ZJ66_BCL2A1-      -----------------------------------ac--t----------
B4E1X9_BCL2A1-02        -----------------------------------ac--t----------
A0A2I2YJV4_BCL2A1-      -----------------------------------ac--t----------
A0A2I2YJV4_BCL2A1-      -----------------------------------ac--t----------
A0A2R8ZJ66_BCL2A1-      -----------------------------------ac--t----------
A0A2I2YJV4_BCL2A1-      -----------------------------------ac--t----------
B4E1X9_BCL2A1-01        -----------------------------------ac--t----------
G3T8E6_BCL2A1-01        -----------------------------------ac--t----------
A0A8C3WEA1_BCL2A1-      -----------------------------------ac--a----------
A0A8D1BRF8_BCL2A1-      -----------------------------------gc--g----------
A0A8D0Z1Y4_BCL2A1-      -----------------------------------gc--g----------
A0A8D1SK15_BCL2A1-      -----------------------------------gc--g----------
A0A4X1UP21_BCL2A1-      -----------------------------------gc--g----------
A0A8D1BRF8_BCL2A1-      -----------------------------------gc--g----------
A0A8D1YBS8_BCL2A1-      -----------------------------------gc--g----------
A0A4X1UP21_BCL2A1-      -----------------------------------ac--g----------
A0A4X1UQW5_BCL2A1-      -----------------------------------ac--g----------
A0A8D0Z1Y4_BCL2A1-      -----------------------------------ac--g----------
A0A8D1BRF8_BCL2A1-      -----------------------------------ac--g----------
A0A8D1SK15_BCL2A1-      -----------------------------------ac--g----------
A0A8D1YBS8_BCL2A1-      -----------------------------------ac--g----------
C7F841_BCL2A1-01        -----------------------------------ac--g----------
A0A8D1KPD1_BCL2A1-      -----------------------------------ac--g----------
A0A8D1BRF8_BCL2A1-      -----------------------------------ac--g----------
A0A4X1UP21_BCL2A1-      -----------------------------------ac--g----------
A0A8D1SK15_BCL2A1-      -----------------------------------ac--g----------
A0A8D0Z1Y4_BCL2A1-      -----------------------------------ac--g----------
A0A8D1YBS8_BCL2A1-      -----------------------------------ac--g----------
A0A8C0CSU7_BCL2A1-      -----------------------------------ac--a----------
A0A8C6FDW6_BCL2A1-      -----------------------------------ac--a----------
A0A8C9BC20_BCL2A1-      -----------------------------------ac--a----------
A0A5F5PK00_BCL2A1-      -----------------------------------ac--t----------
A0A8C4PQL1_BCL2A1-      -----------------------------------ac--t----------
A0A5F5PK00_BCL2A1-      -----------------------------------ac--t----------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      -----------------------------gcga-gttcgggttcgtcctc
A0A8B9S513_BCL2A1-      -------------------------------ga-gttttattacgtttat
A0A8C6ZVQ3_BCL2A1-      -------------------------------ga-gttttattacgtgtat
A0A8C5X4L3_BCL2A1-      -------------------------------ga-gttctattacgtttat
H0ZCL9_BCL2A1-01        -------------------------------ga-gttctattacgtttat
A0A8C5J3C4_BCL2A1-      -------------------------------ga-gttctactacgtttat
A0A8D2QAC0_BCL2A1-      -------------------------------ga-gttctactacgtttat
A0A8C9MQN0_BCL2A1-      -------------------------------ga-gttctattacgtttac
A0A8C3NVU4_BCL2A1-      -------------------------------ga-gttttattacgtttat
A0A8D2PM01_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C0UPM3_BCL2A1-      -------------------------------gg-tgccttttgctt----
A0A8C0UPM3_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C3U920_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A803V184_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C2UCW6_BCL2A1-      -------------------------------ga-gttctattacgtttat
G1N8C5_BCL2A1-01        -------------------------------ga-gttctattatgtttat
A0A8C3KTI3_BCL2A1-      -------------------------------ga-gttctactatgtttat
A0A669PVQ4_BCL2A1-      -------------------------------ga-gttctattatgtttat
A0A8B9CVY0_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8B9E009_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C3BNR4_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A493SSZ7_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8B9UZT1_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C3K1C5_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8B9FJB5_BCL2A1-      -------------------------------ga-cttctactacgtttat
A0A672UHF9_BCL2A1-      -------------------------------ga-cttctactacgtttat
A0A8C4U5U5_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8B9Z3D5_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8B9RZD1_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A663E5S6_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C8AIP7_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A663N622_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8C0EQC0_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8D0ELW8_BCL2A1-      -------------------------------ga-gttctattacgtttat
A0A8D0EB90_BCL2A1-      -----------------------------gtga-gcacctttatgtttac
A0A7M4FFQ8_BCL2A1-      -----------------------------ctga-gttctgttatgtttgc
A0A8C8SUC3_BCL2A1-      -----------------------------ccga-gtaccgttatgtttac
K7G130_BCL2A1-01        -----------------------------ctga-gttccgctatgtttac
A0A8C3FIW3_BCL2A1-      -----------------------------ctga-gtactgttatgtttac
A0A8C0G393_BCL2A1-      -----------------------------ctga-gtactgctatgtttac
A0A452J3N6_BCL2A1-      -----------------------------ctga-gtactgctatgtttac
A0A8C4W4P8_BCL2A1-      -----------------------------ctga-gtactgctatgtttac
A0A8C3RME9_BCL2A1-      -----------------------------ctga-gtaccgtaatgtttac
A0A674K8Q6_BCL2A1-      -----------------------------ctga-gtactgctatgtttac
A0A8C6VPU0_BCL2A1-      -----------------------------acaa-tttcctttatgtgaac
A0A8C5SDG4_BCL2A1-      -----------------------------acaa-tttcctttatgtgaac
A0A670YDS2_BCL2A1-      -----------------------------acaa-tttcctttatgtgaac
A0A8D0H8G3_BCL2A1-      -----------------------------atga-gttccgttatgtgcac
A0A8D2Q8F9_BCL2A1-      -----------------------------acga-tttcctttatgtttac
A0A670JXJ0_BCL2A1-      ----------------------------------------gtct------
A0A670JXJ0_BCL2A1-      cctctgtgctcatttctcaatggaaaacaacca-gttgcagtctgttgac
A0A670JXJ0_BCL2A1-      cctctgtgctcatttctcaatggaaaacaacca-gttgcagtctgttgac
F6S8G3_BCL2A1-01        -----------------------------gtgt-attctggtccgtccga
A0A8C5VB12_BCL2A1-      -----------------------------gcga-gttcgaattcacccga
A0A286XUI2_BCL2A1-      -----------------------------tgga-gttcaggtacacgcag
A0A8C2UN30_BCL2A1-      -----------------------------agga-gttcaggtacacgcaa
A0A8C5L8K1_BCL2A1-      -----------------------------gtga-gtttgcatacgtccac
F6SFL4_BCL2A1-01        -----------------------------acga-gttccattatgttcac
A0A4X2KFL7_BCL2A1-      -----------------------------atga-attccattatgttcac
A0A7N4P573_BCL2A1-      -----------------------------gcgg-ctctcagcggatttaa
A0A7N4P573_BCL2A1-      -----------------------------gtga-attccattatgttcac
A0A7N4P573_BCL2A1-      -----------------------------gtga-attccattatgttcac
A0A7N4P573_BCL2A1-      -----------------------------gtga-attccattatgttcac
A0A8C0KQ53_BCL2A1-      -----------------------------gcga-gtttggctacacgctg
A0A8C0MTY3_BCL2A1-      -----------------------------gcga-gtttggctacacgctg
A0A8I3MYG9_BCL2A1-      -----------------------------gcga-gtttggctacacgctg
M3YVH4_BCL2A1-01        -----------------------------gtga-gttcgggtacacgctg
U6CQS8_BCL2A1-01        -----------------------------gtga-gttcgggtacacgctg
A0A452U285_BCL2A1-      -----------------------------gcga-gttcgggtacaccctg
G1LIJ8_BCL2A1-01        -----------------------------gcga-gttcgggtacaccctg
A0A452SIR9_BCL2A1-      -----------------------------gtga-gttcgggtacaccctg
A0A452U285_BCL2A1-      -----------------------------gcga-gttcgggtacaccctg
A0A5F9CXI7_BCL2A1-      -----------------------------gcgg----cggctgtgagc--
A0A5F9CXI7_BCL2A1-      -----------------------------gcgg----cggctgtgagc--
A0A5F9CXI7_BCL2A1-      -----------------------------gcga-gtttggctatgtgcac
A0A5F9CXI7_BCL2A1-      -----------------------------gcga-gtttggctatgtgcac
A0A8C8X938_BCL2A1-      -----------------------------gcgacggccgtgagcagcgcc
M3WHW2_BCL2A1-01        -----------------------------gcga-gtttgggtacgttctc
A0A667HQV5_BCL2A1-      -----------------------------gcga-gtttgggtacgttctc
A0A8C9KZ34_BCL2A1-      -----------------------------gcga-gtttgggtacgttctc
A0A8C8X938_BCL2A1-      -----------------------------gcga-gtttgggtacgttctc
A0A8C9KZ34_BCL2A1-      -----------------------------gcga-gtttgggtacgttctc
A0A8C0WAG3_BCL2A1-      -----------------------------gcga-gttcgccttcacgcat
A0A8C6QF32_BCL2A1-      -----------------------------gtga-attcacatctgtctac
A0A8C6R201_BCL2A1-      -----------------------------------------------tac
A0A8C6GN16_BCL2A1-      -----------------------------atga-gttcacgtatatccac
G3V977_BCL2A1-01        -----------------------------gtga-gttcatgtatatccac
Q925A9_BCL2A1-01        -----------------------------gtga-gttcatgtatatccac
O55178_BCL2A1-01        -----------------------------acga-gctcatgcatatccac
Q0P538_BCL2A1-01        -----------------------------acga-gctcatgcatatccac
A0A8C6H5H7_BCL2A1-      -----------------------------ccga-gctcatgcatatccac
O55179_BCL2A1-01        -----------------------------acga-gttcatgtatatccac
Q8K164_BCL2A1-01        -----------------------------acga-gttcatgtatatccac
Q4FK02_BCL2A1-01        -----------------------------acga-gttcatgtatatccac
O55177_BCL2A1-02        -----------------------------acga-gttcatgtatatccac
Q497M6_BCL2A1-01        -----------------------------acga-gttcatgtatatccac
A0A8C2LQI3_BCL2A1-      -----------------------------gtga-gttcatgtacatccac
A0A8C8U2B9_BCL2A1-      -----------------------------gtga-gttcatgtttatccac
A0A8D2B7G1_BCL2A1-      -----------------------------gtga-gtttggctacatccac
A0A8C5YJP3_BCL2A1-      -----------------------------gtga-gttcaggttcatccac
I3MCZ7_BCL2A1-01        -----------------------------gtga-gttcaggttcatccac
A0A8C9PIV7_BCL2A1-      -----------------------------gtga-gttcaggttcatccac
A0A8D2IK51_BCL2A1-      -----------------------------gtga-gttcaggttcatccac
A0A8C9DF25_BCL2A1-      -----------------------------gcga-gttcgggtacacccac
A0A2K6EKG1_BCL2A1-      -----------------------------gtga-gtttggatacacccac
A0A8C6MJ03_BCL2A1-      -----------------------------ctga-gtttggctacgttcac
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      -----------------------------ctga-gtttggctacgttcac
A0A8B9YDG7_BCL2A1-      -----------------------------ctga-gtttggctacgttcac
A0A8B9YDG7_BCL2A1-      -----------------------------ctga-gtttggctacgttcac
A0A452EK63_BCL2A1-      -----------------------------ctga-gtttgactacgttcac
W5Q0N6_BCL2A1-01        -----------------------------ctga-gtttgactacgttcac
A0A671FLY8_BCL2A1-      -----------------------------gtga-gtttgggtacatccac
H0WZ23_BCL2A1-01        -----------------------------gtga-gtttggatacattcac
F7HXW0_BCL2A1-01        -----------------------------ctga-atttggatatattcac
F7HXW0_BCL2A1-02        -----------------------------ctga-atttggatatattcac
A0A2K6TLG6_BCL2A1-      -----------------------------acga-atttggatatattcac
A0A2K6TLG6_BCL2A1-      -----------------------------acga-atttggatatattcac
A0A2K6TLG6_BCL2A1-      -----------------------------acga-atttggatatattcac
A0A2K5D2I1_BCL2A1-      -----------------------------gtga-atttggatatattcac
A0A2K5D2I1_BCL2A1-      -----------------------------gtga-atttggatatattcac
A0A2I3GQS0_BCL2A1-      -----------------------------gcga-atttggatatatttac
A0A2I3GQS0_BCL2A1-      -----------------------------gcga-atttggatatatttac
A0A2I3GQS0_BCL2A1-      -----------------------------gcga-atttggatatatttac
A0A2K5KAA3_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A8D2E7F6_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A8C9HCC9_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6AD27_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A0D9RRC3_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6LV19_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6PHF2_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K5KHH8_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6DS18_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K5KHH8_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K5TMD1_BCL2A1-      -----------------------------gtga-atttggatatatttac
F7E8V5_BCL2A1-01        -----------------------------gtga-atttggatatatttac
A0A2K5KAA3_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6LV19_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6PHF2_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6AD27_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K5KHH8_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K5TMD1_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2K6DS18_BCL2A1-      -----------------------------gtga-atttggatatatttac
H2NNZ9_BCL2A1-01        -----------------------------gtga-atttgggtatatttac
B4E1X9_BCL2A1-03        -----------------------------gtga-atttggatatatttac
A0A2R8ZJ66_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2R8ZJ66_BCL2A1-      -----------------------------gtga-atttggatatatttac
B4E1X9_BCL2A1-02        -----------------------------gtga-atttggatatatttac
A0A2I2YJV4_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2I2YJV4_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2R8ZJ66_BCL2A1-      -----------------------------gtga-atttggatatatttac
A0A2I2YJV4_BCL2A1-      -----------------------------gtga-atttggatatatttac
B4E1X9_BCL2A1-01        -----------------------------gtga-atttggatatatttac
G3T8E6_BCL2A1-01        -----------------------------gtga-gtttggatacatttac
A0A8C3WEA1_BCL2A1-      -----------------------------acga-atttggatatattcac
A0A8D1BRF8_BCL2A1-      -----------------------------gcg------------------
A0A8D0Z1Y4_BCL2A1-      -----------------------------gcg------------------
A0A8D1SK15_BCL2A1-      -----------------------------gcg------------------
A0A4X1UP21_BCL2A1-      -----------------------------gcg------------------
A0A8D1BRF8_BCL2A1-      -----------------------------gcg------------------
A0A8D1YBS8_BCL2A1-      -----------------------------gcg------------------
A0A4X1UP21_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A4X1UQW5_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D0Z1Y4_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1BRF8_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1SK15_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1YBS8_BCL2A1-      -----------------------------acga-gtttggatatattcac
C7F841_BCL2A1-01        -----------------------------acga-gtttggatatattcac
A0A8D1KPD1_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1BRF8_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A4X1UP21_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1SK15_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D0Z1Y4_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8D1YBS8_BCL2A1-      -----------------------------acga-gtttggatatattcac
A0A8C0CSU7_BCL2A1-      -----------------------------gcga-gtttggctatattcac
A0A8C6FDW6_BCL2A1-      -----------------------------gcga-gtttggctatattcac
A0A8C9BC20_BCL2A1-      -----------------------------gcga-atttggctatattcac
A0A5F5PK00_BCL2A1-      -----------------------------gtga-gtttggatatattcac
A0A8C4PQL1_BCL2A1-      -----------------------------gtga-gtttggatatattcac
A0A5F5PK00_BCL2A1-      -----------------------------gtga-gtttggatatattcac
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      acgctggcc---caggactacatgg--------ggcacgtcctgcagg-t
A0A8B9S513_BCL2A1-      tatttagct---cacgattatctgc--------agtatgttcttcaag-a
A0A8C6ZVQ3_BCL2A1-      tatttaact---cacgattatctgc--------agtatgtgcttcaag-a
A0A8C5X4L3_BCL2A1-      tacctcgct---caagattacctgc--------agtatgtgctccagg-a
H0ZCL9_BCL2A1-01        tacttagcc---caggattatctgc--------agtatgtgctccagg-a
A0A8C5J3C4_BCL2A1-      tacctggct---caggactatctac--------agtatgtgctccagg-a
A0A8D2QAC0_BCL2A1-      tacctggct---caggactatctac--------agtatgtgctccagg-a
A0A8C9MQN0_BCL2A1-      tacttagct---caggactatctgc--------agtatgtgctccagg-a
A0A8C3NVU4_BCL2A1-      tacttagct---caggattatctgc--------aatatgtgctccagg-a
A0A8D2PM01_BCL2A1-      tacttagct---caggattatctgc--------aatatgtactccagg-a
A0A8C0UPM3_BCL2A1-      ---tcaaag---aaggaagagcagtgaaaagagagtatgtgctccagg-a
A0A8C0UPM3_BCL2A1-      tacttagct---caggattatctgc--------agtatgtgctccagg-a
A0A8C3U920_BCL2A1-      tacttagct---caggattatctgc--------agtatgtgctccagg-a
A0A803V184_BCL2A1-      tacttagcc---caggattatctgc--------agtatgtgctccagg-a
A0A8C2UCW6_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
G1N8C5_BCL2A1-01        tatttagct---caagattatctgc--------aatatgtccttcagg-a
A0A8C3KTI3_BCL2A1-      tatttagct---caagattatctgc--------agtatgtgcttcagg-a
A0A669PVQ4_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8B9CVY0_BCL2A1-      tatttagct---caagattatctgc--------agtatgtgcttcagg-a
A0A8B9E009_BCL2A1-      tatttagct---caagattatctgc--------agtatgtgcttcagg-a
A0A8C3BNR4_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A493SSZ7_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8B9UZT1_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8C3K1C5_BCL2A1-      tacttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8B9FJB5_BCL2A1-      tatttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A672UHF9_BCL2A1-      tacttagct---caagattatctgc--------agtatgtgcttcagg-a
A0A8C4U5U5_BCL2A1-      tacttagct---caagattatctgc--------agtatgtgcttcaag-a
A0A8B9Z3D5_BCL2A1-      tacttggct---caagattatctgc--------aatatgtgcttcagg-a
A0A8B9RZD1_BCL2A1-      tacttggct---caagattatctgc--------aatatgtgcttcagg-a
A0A663E5S6_BCL2A1-      tacttggct---caagattatctgc--------aatatgtgcttcagg-a
A0A8C8AIP7_BCL2A1-      tacttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A663N622_BCL2A1-      tacttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8C0EQC0_BCL2A1-      tacttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8D0ELW8_BCL2A1-      tacttagct---caagattatctgc--------aatatgtgcttcagg-a
A0A8D0EB90_BCL2A1-      agtctggtt---gaagattacttga--------aatatgtttctcagg-a
A0A7M4FFQ8_BCL2A1-      tgcttagtc---caagattatctga--------aatatgttcttcagg-a
A0A8C8SUC3_BCL2A1-      tatttagtc---caagattatctga--------aatacattcttcagg-a
K7G130_BCL2A1-01        tatttagtc---caggattatctga--------aatacattcttcagg-a
A0A8C3FIW3_BCL2A1-      catttagtc---caagattatctga--------aatacattcttcagg-a
A0A8C0G393_BCL2A1-      tatttagtc---caagattatctga--------aatacattcttcagg-a
A0A452J3N6_BCL2A1-      tatttagtc---caagattatctga--------aatacgttcttcagg-a
A0A8C4W4P8_BCL2A1-      tatttagtc---caagattatctga--------aatacgttcttcagg-a
A0A8C3RME9_BCL2A1-      tatttagtc---caagattatctga--------aatacattcttcagg-a
A0A674K8Q6_BCL2A1-      catttagtc---caagattatctga--------aatacgttcttcagg-a
A0A8C6VPU0_BCL2A1-      actttggtg---caagattacctga--------aatacatttgtcaag-a
A0A8C5SDG4_BCL2A1-      accttggtg---caagattacctga--------aatacatttgtcaag-a
A0A670YDS2_BCL2A1-      accttggtg---caagattacctga--------aatacatttgtcaag-a
A0A8D0H8G3_BCL2A1-      ggtttggtc---caagattatttga--------aatatatccttcacg-a
A0A8D2Q8F9_BCL2A1-      aatttgatt---caggatcacttgg--------aacatgtttgcgcag-a
A0A670JXJ0_BCL2A1-      -----------------ccgccggc--------gacatg-----------
A0A670JXJ0_BCL2A1-      actttggtc---caagactacttga--------aacatgtttgtgagg-a
A0A670JXJ0_BCL2A1-      actttggtc---caagactacttga--------aacatgtttgtgagg-a
F6S8G3_BCL2A1-01        gccctggct---ctggactatctgg--------atgacgtcctccaga-c
A0A8C5VB12_BCL2A1-      gagctggcc---caggactacctgc--------agcatgtcctgcggg-c
A0A286XUI2_BCL2A1-      gctctggcc---caggactacctgc--------tccacgtcctgcagg-t
A0A8C2UN30_BCL2A1-      actctggcc---caggagtacctgc--------tgcacgtcctgcagg-t
A0A8C5L8K1_BCL2A1-      tcgctggct---caggactacctgc--------agtgcgtctggcagg-a
F6SFL4_BCL2A1-01        atgttagct---cgggactacttga--------agcatgttcaacaga-c
A0A4X2KFL7_BCL2A1-      atgttagcc---caggactacttga--------agtatgttcaacaga-t
A0A7N4P573_BCL2A1-      gcgcaacct--gcgggccgagatga--------agca-------------
A0A7N4P573_BCL2A1-      atgctagcc---caggactacttga--------agcatgttcaacaaa-t
A0A7N4P573_BCL2A1-      atgctagcc---caggactacttga--------agcatgttcaacaaa-t
A0A7N4P573_BCL2A1-      atgctagcc---caggactacttga--------agcatgttcaacaaa-t
A0A8C0KQ53_BCL2A1-      gcgctggcc---caggactacgtga--------ggcacgtcctgcaga-t
A0A8C0MTY3_BCL2A1-      gcgctggcc---caggactacgtga--------ggcacgtcctgcaga-t
A0A8I3MYG9_BCL2A1-      gcgctggcc---caggactacgtga--------ggcacgtcctgcaga-t
M3YVH4_BCL2A1-01        tcgctggcc---caggactacgtga--------ggcatgtcctgcaga-t
U6CQS8_BCL2A1-01        tcgctggct---caggactacgtga--------ggcatgtcctgcaga-t
A0A452U285_BCL2A1-      acgctggcc---caggactacgtga--------agcacgtcctgcaga-t
G1LIJ8_BCL2A1-01        acgctggcc---caggactacgtga--------agcacgtcctgcaga-t
A0A452SIR9_BCL2A1-      acgctggcc---caggactacgtga--------agcacgtcctgcaga-t
A0A452U285_BCL2A1-      acgctggcc---caggactacgtga--------agcacgtcctgcaga-t
A0A5F9CXI7_BCL2A1-      ----------------------------------------------gg-c
A0A5F9CXI7_BCL2A1-      ----------------------------------------------gg-c
A0A5F9CXI7_BCL2A1-      acactggct---caggactatctgc--------tgtacatcctgaaga-c
A0A5F9CXI7_BCL2A1-      acactggct---caggactatctgc--------tgtacatcctgaaga-c
A0A8C8X938_BCL2A1-      aagcggagcctgcgggccgagctga--------agcagcgtctgcgggcg
M3WHW2_BCL2A1-01        acgctggcc---cgggactatacgg--------agcacgttctgcagg-g
A0A667HQV5_BCL2A1-      acgctgacc---cgggactatatga--------agcacgttctgcagg-g
A0A8C9KZ34_BCL2A1-      acgctggcc---cgggactatacga--------agcacgttctgcagg-g
A0A8C8X938_BCL2A1-      acgctggcc---cgggactatacga--------agcacgttctgcagg-g
A0A8C9KZ34_BCL2A1-      acgctggcc---cgggactatacga--------agcacgttctgcagg-g
A0A8C0WAG3_BCL2A1-      gcgctggcc---caggactacctgc--------gccacgtgctgcagg-t
A0A8C6QF32_BCL2A1-      tctttggct---gaggactatcttc--------agtatgtcctacaag-t
A0A8C6R201_BCL2A1-      tctttggct---gaggactatcttc--------agtatgtcctacaag-t
A0A8C6GN16_BCL2A1-      tccctggct---gagcactaccttc--------agtatgtgctacagg-t
G3V977_BCL2A1-01        tccctggct---gagaactatcttc--------agtatgtcctgcagg-t
Q925A9_BCL2A1-01        tccctggct---gagaactatcttc--------agtatgtcctgcagg-t
O55178_BCL2A1-01        tccctggct---gagcactaccttc--------agtatgtgctacagg-t
Q0P538_BCL2A1-01        tccctggct---gagcactaccttc--------agtatgtgctacagg-t
A0A8C6H5H7_BCL2A1-      tccctggct---gagcactactttc--------agtatgtcctacagg-t
O55179_BCL2A1-01        tccctggct---gagcactaccttc--------agtatgtgctacagg-t
Q8K164_BCL2A1-01        tccctggct---gagcactatcttc--------agtatgtgctacagg-t
Q4FK02_BCL2A1-01        tccctggct---gagcactatcttc--------agtatgtgctacagg-t
O55177_BCL2A1-02        tccctggct---gagcactatcttc--------agtatgtgctacagg-t
Q497M6_BCL2A1-01        tccctggct---gagcactatcttc--------agtatgtgctacagg-t
A0A8C2LQI3_BCL2A1-      tcgctggct---gaggactatcttc--------agtatgtcctgaagg-t
A0A8C8U2B9_BCL2A1-      ------gct---gaggactatcttc--------agtatgtcttgcagg-t
A0A8D2B7G1_BCL2A1-      atgctggct---caggactacctgc--------agcatgtcctgcagg-t
A0A8C5YJP3_BCL2A1-      atgctggct---caggactacctgc--------agcacgtcctgcagg-t
I3MCZ7_BCL2A1-01        acgctggct---caggactacctgc--------agcacgtcctgcagg-t
A0A8C9PIV7_BCL2A1-      acgctggct---caggactacctgc--------agcacgtcctgcagg-t
A0A8D2IK51_BCL2A1-      acgctggct---caggactacctgc--------agcacgtcctgcagg-t
A0A8C9DF25_BCL2A1-      aggctggcc---caggactacctgc--------agtatgtcctgcagg-t
A0A2K6EKG1_BCL2A1-      aggctggtc---caggactacctgc--------agtacgtcctgcggg-t
A0A8C6MJ03_BCL2A1-      aggctggcc---gaggactatctga--------aatatgtgttgcaga-t
A0A8B9YDG7_BCL2A1-      -------------------------------------------gcggc-a
A0A8B9YDG7_BCL2A1-      gggctggct---gaggactatctga--------aatatgtgttgcaga-t
A0A8B9YDG7_BCL2A1-      gggctggct---gaggactatctga--------aatatgtgttgcaga-t
A0A8B9YDG7_BCL2A1-      gggctggct---gaggactatctga--------aatatgtgttgcaga-t
A0A452EK63_BCL2A1-      aagctggct---gaggactatctga--------aatatgtgttgcaga-t
W5Q0N6_BCL2A1-01        aagctggct---gaggactatctga--------aatatgtgttgcaga-t
A0A671FLY8_BCL2A1-      gcgctggcc---caggactatctga--------cgtatgtcctgcagg-t
H0WZ23_BCL2A1-01        aggctggct---caggactatctgc--------agtatgtcctgcaaa-t
F7HXW0_BCL2A1-01        aatctaact---caggactatctgc--------agtacgtcctgcaga-t
F7HXW0_BCL2A1-02        aatctaact---caggactatctgc--------agtacgtcctgcaga-t
A0A2K6TLG6_BCL2A1-      aatctaact---caggactatctgc--------ggtatgtcctgcaga-t
A0A2K6TLG6_BCL2A1-      aatctaact---caggactatctgc--------ggtatgtcctgcaga-t
A0A2K6TLG6_BCL2A1-      aatctaact---caggactatctgc--------ggtatgtcctgcaga-t
A0A2K5D2I1_BCL2A1-      aatctaact---caggactatctgc--------ggtacgtcctgcaga-t
A0A2K5D2I1_BCL2A1-      aatctaact---caggactatctgc--------ggtacgtcctgcaga-t
A0A2I3GQS0_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
A0A2I3GQS0_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
A0A2I3GQS0_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
A0A2K5KAA3_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A8D2E7F6_BCL2A1-      aggctagca---caggactatttgc--------agtacgttctgcaga-t
A0A8C9HCC9_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6AD27_BCL2A1-      aggctagct---caggactatttgc--------agtatgttctgcaga-t
A0A0D9RRC3_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6LV19_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6PHF2_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K5KHH8_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K6DS18_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K5KHH8_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K5TMD1_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
F7E8V5_BCL2A1-01        aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K5KAA3_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6LV19_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6PHF2_BCL2A1-      aggctagct---caggactatttgc--------agtacgtcctgcaga-t
A0A2K6AD27_BCL2A1-      aggctagct---caggactatttgc--------agtatgttctgcaga-t
A0A2K5KHH8_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K5TMD1_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
A0A2K6DS18_BCL2A1-      aggctagct---caggactatttgc--------agtacgttctgcaga-t
H2NNZ9_BCL2A1-01        aggctagct---caggactatctgc--------agtacgtcctacaga-t
B4E1X9_BCL2A1-03        aggctggct---caggactatctgc--------agtgcgtcctacaga-t
A0A2R8ZJ66_BCL2A1-      aggctggct---caggactatctgc--------agtacgtcctacaga-t
A0A2R8ZJ66_BCL2A1-      aggctggct---caggactatctgc--------agtacgtcctacaga-t
B4E1X9_BCL2A1-02        aggctggct---caggactatctgc--------agtgcgtcctacaga-t
A0A2I2YJV4_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
A0A2I2YJV4_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
A0A2R8ZJ66_BCL2A1-      aggctggct---caggactatctgc--------agtacgtcctacaga-t
A0A2I2YJV4_BCL2A1-      aggctagct---caggactatctgc--------agtacgtcctacaga-t
B4E1X9_BCL2A1-01        aggctggct---caggactatctgc--------agtgcgtcctacaga-t
G3T8E6_BCL2A1-01        aagctggtc---caggactatctga--------agtacgtcctgcaga-t
A0A8C3WEA1_BCL2A1-      atgctggcc---caggactatctga--------actatgttcttcaga-t
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A4X1UQW5_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D0Z1Y4_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1BRF8_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1SK15_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1YBS8_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
C7F841_BCL2A1-01        atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1KPD1_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1BRF8_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A4X1UP21_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1SK15_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D0Z1Y4_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8D1YBS8_BCL2A1-      atgctggcc---caggactatctga--------agtatgtcctgcaga-t
A0A8C0CSU7_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcttgcaga-t
A0A8C6FDW6_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcttgcaga-t
A0A8C9BC20_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcttgcaga-t
A0A5F5PK00_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcctgcaga-t
A0A8C4PQL1_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcctgcaga-t
A0A5F5PK00_BCL2A1-      atgctggcc---caggactacctga--------agtacgtcctgcaga-t
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      gccgccgccgcagccg-------agccgagcgtccgaggtgctgcagggc
A0A8B9S513_BCL2A1-      atcacaccttggacca-gcccaaaccagagttgctcacgtcctgcgaaac
A0A8C6ZVQ3_BCL2A1-      atcacatcttggacca-gcccaaaccagagttgctcacgtcctgcgaaac
A0A8C5X4L3_BCL2A1-      atcccacctcgcacca-gcccagaccagggttgctcacgtcttgagaagc
H0ZCL9_BCL2A1-01        atcacacctcggacca-gcccagacccgggttgctcatgtcctgagaacc
A0A8C5J3C4_BCL2A1-      atcacacctgggacca-gcccagaccagggttgctcgtgtcctgagaacc
A0A8D2QAC0_BCL2A1-      atcacacctggcacca-gcccagaccagggttgctcgtgtcctgagaacc
A0A8C9MQN0_BCL2A1-      atcacacctcggacca-gcccagaccagggttgctcatgtcttgagaacc
A0A8C3NVU4_BCL2A1-      atcgcacctcggacca-gcccagaccagggttgctcgtgtcttgcgaacc
A0A8D2PM01_BCL2A1-      atcccaccttggacca-gcccagaccagggttgctcatgtcttgcgaacc
A0A8C0UPM3_BCL2A1-      atcacagctcggacca-gcccagaccagggttgctcatgtcttgcgaacc
A0A8C0UPM3_BCL2A1-      atcacagctcggacca-gcccagaccagggttgctcatgtcttgcgaacc
A0A8C3U920_BCL2A1-      atcccacctgggacca-gcccagaccagggttgctcatgtcctgcgaacc
A0A803V184_BCL2A1-      atcacacctcggacca-gcccagaccagggttgcccatgtcctgcgaacc
A0A8C2UCW6_BCL2A1-      atcacgtcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
G1N8C5_BCL2A1-01        atcacgtcttggacca-gcccaaaccagagttgctcatgtcttgcgaaat
A0A8C3KTI3_BCL2A1-      atcacatcttggacca-gcccaaaccagagttgctcatgtcttgcgaaac
A0A669PVQ4_BCL2A1-      atcacatcttggacca-gcccaaaccagagttgctcatgtcttgcgaaac
A0A8B9CVY0_BCL2A1-      atcacatctcggacca-gcccaaaccagagttgctcatgtcttgcgaaac
A0A8B9E009_BCL2A1-      atcacatctcggacca-gcccaaaccagagttgctcatgtcttgcgaaac
A0A8C3BNR4_BCL2A1-      atcacatcttggacca-gcgcaaaccagagttgctcatgtcttgcgaaac
A0A493SSZ7_BCL2A1-      atcacatcttggacca-gcgcaaaccagagttgctcatgtcttgcgaaac
A0A8B9UZT1_BCL2A1-      atcacatcttggacca-gcgcaaaccagagttgctcatgtcttgcgaaac
A0A8C3K1C5_BCL2A1-      gtcacatcttggacca-gcccaaaccagggttgctcacgtcttgcgaaac
A0A8B9FJB5_BCL2A1-      gtcacatcttggacca-gcccaaaccagagttgctcatgtcttgcgaaac
A0A672UHF9_BCL2A1-      gtcacatcttggacca-gctcaaaccagagttgctcatgtcttgcgaaac
A0A8C4U5U5_BCL2A1-      atcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaat
A0A8B9Z3D5_BCL2A1-      atcacatcttggacca-gcccaaaccagggttgctcacgtcttgcgaaac
A0A8B9RZD1_BCL2A1-      atcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
A0A663E5S6_BCL2A1-      atcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
A0A8C8AIP7_BCL2A1-      gtcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
A0A663N622_BCL2A1-      gtcacatcttggacca-gctcaaaccagggttgctcacgtcttgcgaaac
A0A8C0EQC0_BCL2A1-      gtcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
A0A8D0ELW8_BCL2A1-      gtcacatcttggacca-gcccaaaccagggttgctcatgtcttgcgaaac
A0A8D0EB90_BCL2A1-      aacaatgtttgaagct-cctccaagcagagctgctgaagtcttgcgcaaa
A0A7M4FFQ8_BCL2A1-      atcacagcctggacca-gccccaagcagagtggctcatgttttacgaaac
A0A8C8SUC3_BCL2A1-      accacatcttggacca-gccccaagcagagttgctcatgtcttaagaaac
K7G130_BCL2A1-01        acctgagcttggacca-gccccaagcagagttgctcatgtcttaagaaat
A0A8C3FIW3_BCL2A1-      accacagcttggacca-gccccaagcagagttgctcatgtcttaagaaat
A0A8C0G393_BCL2A1-      accacagcttggacca-gctccaagcagagttgctcatgtcttaagacac
A0A452J3N6_BCL2A1-      accacagcttggacca-gccccaagcagagttgctcatgtcttaagacac
A0A8C4W4P8_BCL2A1-      accacagcttggacca-gccccaagcagagttgctcatgtcttaagacac
A0A8C3RME9_BCL2A1-      accacagcttggacca-gccccaagcagagttgctcatgtcttaagaaac
A0A674K8Q6_BCL2A1-      accacagcttggacca-gccccaagcagagttgctcatgttttaagaact
A0A8C6VPU0_BCL2A1-      ggctcagctggcagcg-gccccaaacaaagtggctgaagtccttcgtaaa
A0A8C5SDG4_BCL2A1-      ggctcagctggcagcg-gccccaaacaaagtggctgaagtccttcgtaaa
A0A670YDS2_BCL2A1-      ggctcagctggcagcg-gccccaaacaaagtggctgaagtccttcgtaaa
A0A8D0H8G3_BCL2A1-      accgcaggtcggaaca-gctccaagcaaagcctcacaggtcttaagaaat
A0A8D2Q8F9_BCL2A1-      agtgcagctcaaagaa-gctcccaatgaagctgcccaagtcttaagaaaa
A0A670JXJ0_BCL2A1-      -gccgccctgcacgcc-gcc------------------------------
A0A670JXJ0_BCL2A1-      tgccgaactggacgct-gccccgagtcgagttgcccaagtcttggcaaga
A0A670JXJ0_BCL2A1-      tgccgaactggacgct-gccccgagtcgagttgcccaagtcttggcaaga
F6S8G3_BCL2A1-01        gccgcgacttgggacg-gtcccaagcagaacttctcgggcgctgcaaaac
A0A8C5VB12_BCL2A1-      gccgcagcccgggtcc-agccccagcgaggcgtcccgggtgctgcggagc
A0A286XUI2_BCL2A1-      gcctcagtgcgagacc-agccccagcaaggcatccaaggtgctgcaggac
A0A8C2UN30_BCL2A1-      gccgcagtgcggggcc-agccccagcaggacgtccagagtgctacagggt
A0A8C5L8K1_BCL2A1-      gccctccctctgtccg-gctcccagcaaggcatccaggctgctacagaaa
F6SFL4_BCL2A1-01        accaccactgggatca-tgtctaaataagacatctcaaatactacaaaag
A0A4X2KFL7_BCL2A1-      gccacaactgggatcg-tgtctaaataagacatctcaaatactacaaaaa
A0A7N4P573_BCL2A1-      ---gcggctgcgggcg-----------------ctca---gcgccgagga
A0A7N4P573_BCL2A1-      gccacgactgggatca-tgtctacataggacatctcaaatacttcaaaaa
A0A7N4P573_BCL2A1-      gccacgactgggatca-tgtctacataggacatctcaaatacttcaaaaa
A0A7N4P573_BCL2A1-      gccacgactgggatca-tgtctacataggacatctcaaatacttcaaaaa
A0A8C0KQ53_BCL2A1-      cccgcagcccggcccg-gcccccagcagagcgtccagggtgctccaggac
A0A8C0MTY3_BCL2A1-      cccgcagcccggcccg-gcccccagcagagcgtccagggtgctccaggac
A0A8I3MYG9_BCL2A1-      cccgcagcccggcccg-gcccccagcagagcgtccagggtgctccaggac
M3YVH4_BCL2A1-01        cccgcagcccagcccg-gccgccagcagagtgtcccgggtcctgcgggac
U6CQS8_BCL2A1-01        cccgcagcccggcccg-gccgccagcagagtgtcccgggtcctgcgggac
A0A452U285_BCL2A1-      cccgcagccgggctca-gccccgagcagggcgtcccaggtgctgcgggac
G1LIJ8_BCL2A1-01        cccgcagccgggctcg-gcccccagcagggcgtcccaggtgctgcgggac
A0A452SIR9_BCL2A1-      cccgcagccgggctca-gccccgagcagggcgtcccaggtgctgcgggac
A0A452U285_BCL2A1-      cccgcagccgggctca-gccccgagcagggcgtcccaggtgctgcgggac
A0A5F9CXI7_BCL2A1-      gcca-agcggagcctgcgggccgagctgaa---gcagcgt-ctgcgggcc
A0A5F9CXI7_BCL2A1-      gcca-agcggagcctgcgggccgagctgaa---gcagcgt-ctgcgggcc
A0A5F9CXI7_BCL2A1-      gccacagcctggactg-ggaccgagcaaaacgtccagggtgctgcagaac
A0A5F9CXI7_BCL2A1-      gccacagcctggactg-ggaccgagcaaaacgtccagggtgctgcagaac
A0A8C8X938_BCL2A1-      atgagcgccgaggagc-ggctgcgtcag----tcccaa------------
M3WHW2_BCL2A1-01        gccccagcccgggtcc-cacccaagcagagtatcccaagtgctacaagac
A0A667HQV5_BCL2A1-      gccccagcccggatcc-cacccaagcagagtatcccaagtgctacaagac
A0A8C9KZ34_BCL2A1-      gccccagcccgggtgc-cacccaagcagagtatcccaagtgctacaagac
A0A8C8X938_BCL2A1-      gccccagcccgggtgc-cacccaagcagagtatcccaagtgctacaagac
A0A8C9KZ34_BCL2A1-      gccccagcccgggtgc-cacccaagcagagtatcccaagtgctacaagac
A0A8C0WAG3_BCL2A1-      gcagcccgccggcctg-ggggccagcaaggcggcccgagtgctgcgagac
A0A8C6QF32_BCL2A1-      tcccttgtttgaatcg-gctccaagcaaaacgtccagagtgctacaaaaa
A0A8C6R201_BCL2A1-      tccctcgtttgaatcg-gctccaa--------------------------
A0A8C6GN16_BCL2A1-      acccgcctttgagtcg-gctccaagccaagcatacagactgctgcaaaga
G3V977_BCL2A1-01        acctgcctttgaatcg-gctccaagcaaaacgtccagagtgctacagaga
Q925A9_BCL2A1-01        acctgcctttgaatcg-gctccaagcaaaacgtccagagtgctacagaga
O55178_BCL2A1-01        acccgcctttgagtcg-gctccaagccaagcattcagagtgctacaaaga
Q0P538_BCL2A1-01        acccgcctttgagtcg-gctccaagccaagcattcagagtgctacaaaga
A0A8C6H5H7_BCL2A1-      acctgcctttgagtcg-gctccaagcaaagcatgcagagtgctacaaaga
O55179_BCL2A1-01        acccgcctttgagtcg-gctccaagccaagcatgcagagtgctacaaaga
Q8K164_BCL2A1-01        acccgcctttgagtcg-gctccaagccaagcatgcagagtgctacaaaga
Q4FK02_BCL2A1-01        acccgcctttgagtcg-gctccaagcaaagcatgcagagtgctacaaaga
O55177_BCL2A1-02        acccgcctttgagtcg-gctccaagccaagcatgcagagtgctacaaaga
Q497M6_BCL2A1-01        acccgcctttgagtcg-gctccaagcaaagcatgcagagtgctacaaaga
A0A8C2LQI3_BCL2A1-      acctacttttgaatct-gctccaagcaaaacatccagggtgctacaaaga
A0A8C8U2B9_BCL2A1-      acccactttggaatcg-gctccaagcaaaacatccagagtgctacaaaga
A0A8D2B7G1_BCL2A1-      accacaacaagggtca-agtaccagcaaaacatccagagtgttacaaaat
A0A8C5YJP3_BCL2A1-      accgcaacgtgggtca-agtcccaacaaaacgtccaaagtgttacaaaac
I3MCZ7_BCL2A1-01        accgcaacgtgggtca-agccccagcaaaacgtccaaagtgttacaaaac
A0A8C9PIV7_BCL2A1-      accgcaacgtgggtca-agtcccagcaaaacgtccaaagtgttacaaaac
A0A8D2IK51_BCL2A1-      accgcaacgtgggtca-agtcccagcaaaacgtccaaagtgttacaaaac
A0A8C9DF25_BCL2A1-      accgcagcccgggtcg-ggtccaaacaagacgtccagagtgctgcaaaac
A0A2K6EKG1_BCL2A1-      tccgcagcccgggtcc-ggtccgagcaagacgtccagagtgctgcaaaac
A0A8C6MJ03_BCL2A1-      acagcaaactggatcc-aggccaagcaaaacatccagggtgttacaagac
A0A8B9YDG7_BCL2A1-      gcggtggccgtgagcg-gcgccaagcggagcctgcggg------------
A0A8B9YDG7_BCL2A1-      acagcaacctggatcc-aagccaagcaaaatatccagggtgttacaagat
A0A8B9YDG7_BCL2A1-      acagcaacctggatcc-aagccaagcaaaatatccagggtgttacaagat
A0A8B9YDG7_BCL2A1-      acagcaacctggatcc-aagccaagcaaaatatccagggtgttacaagat
A0A452EK63_BCL2A1-      acagcaacctggatcc-aagccaagcaaaacatccagggtgttacaagac
W5Q0N6_BCL2A1-01        acagcaacctggatcc-aagccaagcaaaacatccagggtgttacaagac
A0A671FLY8_BCL2A1-      gccacagcctgggact-ggccccagcagaacctccagagtattgcaagat
H0WZ23_BCL2A1-01        acagcaatgtggatca-ggtccaagcaaaacgtccagagtgctgcaaaat
F7HXW0_BCL2A1-01        accacagtctggaatg-ggtccgagcaaaacgtctagagtgctacaacag
F7HXW0_BCL2A1-02        accacagtctggaatg-ggtccgagcaaaacgtctagagtgctacaacag
A0A2K6TLG6_BCL2A1-      accacaatctggaacg-ggtccaagcaaaacgtccagagtactacaaaag
A0A2K6TLG6_BCL2A1-      accacaatctggaacg-ggtccaagcaaaacgtccagagtactacaaaag
A0A2K6TLG6_BCL2A1-      accacaatctggaacg-ggtccaagcaaaacgtccagagtactacaaaag
A0A2K5D2I1_BCL2A1-      accacaatctggaacg-ggtccaagcaaaacgtccagggtgctacaaaag
A0A2K5D2I1_BCL2A1-      accacaatctggaacg-ggtccaagcaaaacgtccagggtgctacaaaag
A0A2I3GQS0_BCL2A1-      accacagcctggatca-ggtccaagcaaaacgtccagagtgctacaaaac
A0A2I3GQS0_BCL2A1-      accacagcctggatca-ggtccaagcaaaacgtccagagtgctacaaaac
A0A2I3GQS0_BCL2A1-      accacagcctggatca-ggtccaagcaaaacgtccagagtgctacaaaac
A0A2K5KAA3_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A8D2E7F6_BCL2A1-      accacaacctggattg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A8C9HCC9_BCL2A1-      accacaatctggatcg-ggtccaagcaaaacgtccagagtgctacaaaat
A0A2K6AD27_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A0D9RRC3_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6LV19_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6PHF2_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5KHH8_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6DS18_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5KHH8_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5TMD1_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
F7E8V5_BCL2A1-01        accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5KAA3_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6LV19_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6PHF2_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6AD27_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5KHH8_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K5TMD1_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2K6DS18_BCL2A1-      accacaacctggatcg-ggtccaagcaaaacgtccagagtgctacaaaag
H2NNZ9_BCL2A1-01        accacaacctggatca-ggtccaagcaaagcgtccagagtactacaaaag
B4E1X9_BCL2A1-03        accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaat
A0A2R8ZJ66_BCL2A1-      accacaacctggatca-ggtccaagccaaacgtccagagtgctacaaaat
A0A2R8ZJ66_BCL2A1-      accacaacctggatca-ggtccaagccaaacgtccagagtgctacaaaat
B4E1X9_BCL2A1-02        accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaat
A0A2I2YJV4_BCL2A1-      accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2I2YJV4_BCL2A1-      accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaag
A0A2R8ZJ66_BCL2A1-      accacaacctggatca-ggtccaagccaaacgtccagagtgctacaaaat
A0A2I2YJV4_BCL2A1-      accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaag
B4E1X9_BCL2A1-01        accacaacctggatca-ggtccaagcaaaacgtccagagtgctacaaaat
G3T8E6_BCL2A1-01        accacaacctgcagct-ggttcaagcaaaacgtccagagtgttacaaaat
A0A8C3WEA1_BCL2A1-      accacagcctggatct-ggtccaagcaaaacgtccagagtgctacaagac
A0A8D1BRF8_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A8D0Z1Y4_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A8D1SK15_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A4X1UP21_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A8D1BRF8_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A8D1YBS8_BCL2A1-      ------gccgtgagcg-gcgctaagcggagc----------ctgcgggcc
A0A4X1UP21_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A4X1UQW5_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D0Z1Y4_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1BRF8_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1SK15_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1YBS8_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
C7F841_BCL2A1-01        accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1KPD1_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1BRF8_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A4X1UP21_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1SK15_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D0Z1Y4_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8D1YBS8_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatctagagtgttacgagac
A0A8C0CSU7_BCL2A1-      accacagcctggatct-ggtccaagcaaaacatccagggtgttacaagac
A0A8C6FDW6_BCL2A1-      accgcaacctggatct-ggtccaagcaaaacatccagggtgttacaagac
A0A8C9BC20_BCL2A1-      accgcaacctggatct-ggtccaagcaaaacatccagggtgttacaagac
A0A5F5PK00_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatccagagtgttacaagac
A0A8C4PQL1_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatccagagtgttacaagac
A0A5F5PK00_BCL2A1-      accacaacctggatct-ggtccaagcaaaacatccagagtgttacaagac
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      gtggcctcctcggtgc---------agggg--------------------
A0A8B9S513_BCL2A1-      attgcattttcactgc---------aagat--------------------
A0A8C6ZVQ3_BCL2A1-      attgcgtcctcactgc---------aagat--------------------
A0A8C5X4L3_BCL2A1-      atcgcatcttccctgc---------aagag--------------------
H0ZCL9_BCL2A1-01        atggcatcctctctgc---------aagac--------------------
A0A8C5J3C4_BCL2A1-      atggcatcctctctgc---------aagaa--------------------
A0A8D2QAC0_BCL2A1-      atggcatcctcgctgc---------aagaa--------------------
A0A8C9MQN0_BCL2A1-      atggcatcctctctcc---------aagac--------------------
A0A8C3NVU4_BCL2A1-      atcgcatcttccctgc---------aagac--------------------
A0A8D2PM01_BCL2A1-      atcgcatcttccctgc---------aagac--------------------
A0A8C0UPM3_BCL2A1-      attgcatcttccctgc---------aagac--------------------
A0A8C0UPM3_BCL2A1-      attgcatcttccctgc---------aagac--------------------
A0A8C3U920_BCL2A1-      atggcatcttccttgc---------aagac--------------------
A0A803V184_BCL2A1-      atggcatcttccctgc---------aagac--------------------
A0A8C2UCW6_BCL2A1-      attgcatcttcactcc---------aagat--------------------
G1N8C5_BCL2A1-01        attgcatcctcactcc---------aagat--------------------
A0A8C3KTI3_BCL2A1-      attgcatcctcactcc---------aagat--------------------
A0A669PVQ4_BCL2A1-      attgcatcctcactcc---------aagat--------------------
A0A8B9CVY0_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8B9E009_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8C3BNR4_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A493SSZ7_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8B9UZT1_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8C3K1C5_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8B9FJB5_BCL2A1-      attgcatcttcactgc---------aagat--------------------
A0A672UHF9_BCL2A1-      attgcatcttcactgc---------aagat--------------------
A0A8C4U5U5_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8B9Z3D5_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8B9RZD1_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A663E5S6_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8C8AIP7_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A663N622_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8C0EQC0_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8D0ELW8_BCL2A1-      attgcatcttcgctgc---------aagat--------------------
A0A8D0EB90_BCL2A1-      attgcgccttcacttc---------aagaa--------------------
A0A7M4FFQ8_BCL2A1-      attgcatcctctttgc---------aaaag--------------------
A0A8C8SUC3_BCL2A1-      actgcatcctttctgc---------aaaag--------------------
K7G130_BCL2A1-01        tctgcatcttttcttc---------aaaaa--------------------
A0A8C3FIW3_BCL2A1-      actgcatcctttctgc---------aaaag--------------------
A0A8C0G393_BCL2A1-      gctgcatcctttctgc---------aaaag--------------------
A0A452J3N6_BCL2A1-      gctgcatcctttctgc---------aaaag--------------------
A0A8C4W4P8_BCL2A1-      gctgcatcctttctgc---------aaaag--------------------
A0A8C3RME9_BCL2A1-      gctgcatcctttctgc---------aaaag--------------------
A0A674K8Q6_BCL2A1-      actgcatcctttctgc---------aaaag--------------------
A0A8C6VPU0_BCL2A1-      gccggatattctgctc---------agaaa--------------------
A0A8C5SDG4_BCL2A1-      gccggatcttctgctc---------agaag--------------------
A0A670YDS2_BCL2A1-      gccggatcttctgctc---------agaaa--------------------
A0A8D0H8G3_BCL2A1-      gttgcagcctctcatc---------agaag--------------------
A0A8D2Q8F9_BCL2A1-      attgcgccttcacttc---------aggga--------------------
A0A670JXJ0_BCL2A1-      ---------------a---------aggga--------------------
A0A670JXJ0_BCL2A1-      gtagcaccttcgcttc---------aggaa--------------------
A0A670JXJ0_BCL2A1-      gtagcaccttcgcttc---------aggaa--------------------
F6S8G3_BCL2A1-01        gtcatgttctcggtcc---------agggg--------------------
A0A8C5VB12_BCL2A1-      gtggcctcctccgtcc---------aaaac--------------------
A0A286XUI2_BCL2A1-      atggccctttccgtcc---------aggaa--------------------
A0A8C2UN30_BCL2A1-      gtggctttctcagtgc---------agaaa--------------------
A0A8C5L8K1_BCL2A1-      gttgcattctcagctc---------agaaa--------------------
F6SFL4_BCL2A1-01        gttgctttctctgtcc---------aacaa--------------------
A0A4X2KFL7_BCL2A1-      gttgctttctctgttc---------aagga--------------------
A0A7N4P573_BCL2A1-      acggctccgtcagtcccgcctgctgacaga--------------------
A0A7N4P573_BCL2A1-      gttgctttctctgtcc---------aagaa--------------------
A0A7N4P573_BCL2A1-      gttgctttctctgtcc---------aagaa--------------------
A0A7N4P573_BCL2A1-      gttgctttctctgtcc---------aagaa--------------------
A0A8C0KQ53_BCL2A1-      gtggccttctccgtcc---------agggg--------------------
A0A8C0MTY3_BCL2A1-      gtggccttctccgtcc---------agggg--------------------
A0A8I3MYG9_BCL2A1-      gtggccttctccgtcc---------agggg--------------------
M3YVH4_BCL2A1-01        gtggcctcctccgtgc---------agggg--------------------
U6CQS8_BCL2A1-01        gtggcctcctccgtgc---------agcgg--------------------
A0A452U285_BCL2A1-      gtggcctcctccgtgc---------agggg--------------------
G1LIJ8_BCL2A1-01        gtggcctcctccgtgc---------agggg--------------------
A0A452SIR9_BCL2A1-      gtggcctcctccgtgc---------agggg--------------------
A0A452U285_BCL2A1-      gtggcctcctccgtgc---------agggg--------------------
A0A5F9CXI7_BCL2A1-      atcagcgc-------------------cga--------------------
A0A5F9CXI7_BCL2A1-      atcagcgc-------------------cga--------------------
A0A5F9CXI7_BCL2A1-      gtcaccttctccatcc---------agcaa--------------------
A0A5F9CXI7_BCL2A1-      gtcaccttctccatcc---------agcaa--------------------
A0A8C8X938_BCL2A1-      ------ctcttggccc---------agaaggtgatagctcacagtcagta
M3WHW2_BCL2A1-01        gtggccttctcggtcc---------agggg--------------------
A0A667HQV5_BCL2A1-      atggccttctcggtcc---------agggg--------------------
A0A8C9KZ34_BCL2A1-      gtggccttctcggtcc---------agggg--------------------
A0A8C8X938_BCL2A1-      gtggccttctcggtcc---------agggg--------------------
A0A8C9KZ34_BCL2A1-      gtggccttctcggtcc---------agggg--------------------
A0A8C0WAG3_BCL2A1-      gtcgccttctccatcc---------aagaa--------------------
A0A8C6QF32_BCL2A1-      gttgctttctcagtcc---------aaaaa--------------------
A0A8C6R201_BCL2A1-      -ttgttttctcagtcc---------aaaaa--------------------
A0A8C6GN16_BCL2A1-      gttgctttctctgttc---------agaag--------------------
G3V977_BCL2A1-01        gttgctttctctgtac---------aaaag--------------------
Q925A9_BCL2A1-01        gttgctttctctgtac---------aaaag--------------------
O55178_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
Q0P538_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
A0A8C6H5H7_BCL2A1-      gttgctttctccgttc---------agaag--------------------
O55179_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
Q8K164_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
Q4FK02_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
O55177_BCL2A1-02        gttgctttctccgttc---------agaag--------------------
Q497M6_BCL2A1-01        gttgctttctccgttc---------agaag--------------------
A0A8C2LQI3_BCL2A1-      gttgcttcctcagttc---------aaaaa--------------------
A0A8C8U2B9_BCL2A1-      gttgctttctcagctc---------aaaaa--------------------
A0A8D2B7G1_BCL2A1-      gtggctttctcagtcc---------aaaga--------------------
A0A8C5YJP3_BCL2A1-      gtggctttctcagtcc---------aaaaa--------------------
I3MCZ7_BCL2A1-01        gtggctttctcagtcc---------aaaaa--------------------
A0A8C9PIV7_BCL2A1-      gtggctttctcagtcc---------aaaaa--------------------
A0A8D2IK51_BCL2A1-      gtggctttctcagtcc---------aaaaa--------------------
A0A8C9DF25_BCL2A1-      atcgcattctcagtcc---------aaaac--------------------
A0A2K6EKG1_BCL2A1-      attgccttctccgtcc---------aaaac--------------------
A0A8C6MJ03_BCL2A1-      gtggcttcctctgtcc---------agaac--------------------
A0A8B9YDG7_BCL2A1-      --------------cc---------gag----------------------
A0A8B9YDG7_BCL2A1-      gtggcttcctctgtcc---------aggac--------------------
A0A8B9YDG7_BCL2A1-      gtggcttcctctgtcc---------aggac--------------------
A0A8B9YDG7_BCL2A1-      gtggcttcctctgtcc---------aggac--------------------
A0A452EK63_BCL2A1-      gtggcttcctctgtcc---------aggac--------------------
W5Q0N6_BCL2A1-01        gtggcttcctctgtcc---------aggac--------------------
A0A671FLY8_BCL2A1-      attgcctcttccgtcc---------aaaag--------------------
H0WZ23_BCL2A1-01        gttgcattttcagtcc---------aagaa--------------------
F7HXW0_BCL2A1-01        gttgcattctcagtcc---------aaaaa--------------------
F7HXW0_BCL2A1-02        gttgcattctcagtcc---------aaaaa--------------------
A0A2K6TLG6_BCL2A1-      gttgcattctcagtcc---------aaaag--------------------
A0A2K6TLG6_BCL2A1-      gttgcattctcagtcc---------aaaag--------------------
A0A2K6TLG6_BCL2A1-      gttgcattctcagtcc---------aaaag--------------------
A0A2K5D2I1_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K5D2I1_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2I3GQS0_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
A0A2I3GQS0_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
A0A2I3GQS0_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
A0A2K5KAA3_BCL2A1-      gttgcattctcagtcc---------aggaa--------------------
A0A8D2E7F6_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A8C9HCC9_BCL2A1-      gttgcattctcagtcc---------agaaa--------------------
A0A2K6AD27_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A0D9RRC3_BCL2A1-      gttgcatcctcagtcc---------aaaaa--------------------
A0A2K6LV19_BCL2A1-      gttgcattctcagtcc---------agaaa--------------------
A0A2K6PHF2_BCL2A1-      gttgcattctcagtcc---------agaaa--------------------
A0A2K5KHH8_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K6DS18_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K5KHH8_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K5TMD1_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
F7E8V5_BCL2A1-01        gttgcattctcagtcc---------aaaaa--------------------
A0A2K5KAA3_BCL2A1-      gttgcattctcagtcc---------aggaa--------------------
A0A2K6LV19_BCL2A1-      gttgcattctcagtcc---------agaaa--------------------
A0A2K6PHF2_BCL2A1-      gttgcattctcagtcc---------agaaa--------------------
A0A2K6AD27_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K5KHH8_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K5TMD1_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2K6DS18_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
H2NNZ9_BCL2A1-01        gttgcgttctcagtcc---------aaaaa--------------------
B4E1X9_BCL2A1-03        gttgcgttctcagtcc---------aaaaa--------------------
A0A2R8ZJ66_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2R8ZJ66_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
B4E1X9_BCL2A1-02        gttgcgttctcagtcc---------aaaaa--------------------
A0A2I2YJV4_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
A0A2I2YJV4_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
A0A2R8ZJ66_BCL2A1-      gttgcattctcagtcc---------aaaaa--------------------
A0A2I2YJV4_BCL2A1-      gttgcgttctcagtcc---------aaaaa--------------------
B4E1X9_BCL2A1-01        gttgcgttctcagtcc---------aaaaa--------------------
G3T8E6_BCL2A1-01        gtggctttctcagttc---------aaaaa--------------------
A0A8C3WEA1_BCL2A1-      gttgctttctccgtcc---------aaaac--------------------
A0A8D1BRF8_BCL2A1-      g-------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      g-------------------------------------------------
A0A8D1SK15_BCL2A1-      g-------------------------------------------------
A0A4X1UP21_BCL2A1-      g-------------------------------------------------
A0A8D1BRF8_BCL2A1-      g-------------------------------------------------
A0A8D1YBS8_BCL2A1-      g-------------------------------------------------
A0A4X1UP21_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A4X1UQW5_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D0Z1Y4_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1BRF8_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1SK15_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1YBS8_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
C7F841_BCL2A1-01        gtggctttctccgtcc---------aaaac--------------------
A0A8D1KPD1_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1BRF8_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A4X1UP21_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1SK15_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D0Z1Y4_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8D1YBS8_BCL2A1-      gtggctttctccgtcc---------aaaac--------------------
A0A8C0CSU7_BCL2A1-      attgctttctcagtcc---------aaaac--------------------
A0A8C6FDW6_BCL2A1-      gttgccttctcagtcc---------aaaac--------------------
A0A8C9BC20_BCL2A1-      gttgctttctcagtcc---------aaaac--------------------
A0A5F5PK00_BCL2A1-      attgctttctcagttc---------aaaat--------------------
A0A8C4PQL1_BCL2A1-      attgctttctcagttc---------aaaat--------------------
A0A5F5PK00_BCL2A1-      attgctttctcagttc---------aaaat--------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      ---gaggtggaggagaagctgcggccgtggctggacacggt---ctccgt
A0A8B9S513_BCL2A1-      ---caaacagaggaggctctccgaccattcttggataggat---tgatat
A0A8C6ZVQ3_BCL2A1-      ---caaacagaggaggctctgcgacccatcttggataggat---tgatat
A0A8C5X4L3_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaccat---tgacat
H0ZCL9_BCL2A1-01        ---caaacggaggaggctgtcaggccgctcctggacaggat---tgacat
A0A8C5J3C4_BCL2A1-      ---caaaccgaggaggctctcaggccgctcctggacaggat---tgacat
A0A8D2QAC0_BCL2A1-      ---caaaccgaggaggctctcaggccgctcctggacaggat---tgacat
A0A8C9MQN0_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A8C3NVU4_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A8D2PM01_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaagat---tgacat
A0A8C0UPM3_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A8C0UPM3_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A8C3U920_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A803V184_BCL2A1-      ---caaaccgaggaggctctcaggccactcctggacaggat---tgacat
A0A8C2UCW6_BCL2A1-      ---cagacagaggaggctctcagaccctttttggacaggat---cgatat
G1N8C5_BCL2A1-01        ---cagacagaggaggcactcagacccttcttggacaggat---cgatat
A0A8C3KTI3_BCL2A1-      ---cagacagaggaggctctcagacccttcctggacaggat---cgatat
A0A669PVQ4_BCL2A1-      ---cagacagaggaggctctcagacccttcttggacaggat---cgatat
A0A8B9CVY0_BCL2A1-      ---caaacagaggaggctctcagacccttcctggacaggat---tgatat
A0A8B9E009_BCL2A1-      ---caaacagaggaggctctcagacccttcctggacaggat---tgatat
A0A8C3BNR4_BCL2A1-      ---caaacagaggaggctctcagacccttcctggacaggat---tgatat
A0A493SSZ7_BCL2A1-      ---caaacagaggaggctctcagacccttcctggacaggat---tgatat
A0A8B9UZT1_BCL2A1-      ---caaacagaggaggctctcagacccttcctggacaggat---tgatat
A0A8C3K1C5_BCL2A1-      ---caaactgaggaggctctcagaccgttcctggacaagat---tgatat
A0A8B9FJB5_BCL2A1-      ---caaactgaggaggctctcagaccattcctggacagaat---tgacat
A0A672UHF9_BCL2A1-      ---caaaccgaggaggctctcagaccattcctggacaggat---tgacat
A0A8C4U5U5_BCL2A1-      ---caaaccgaggaggctctcaaaccattcttagacaagat---tgatat
A0A8B9Z3D5_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A8B9RZD1_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A663E5S6_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A8C8AIP7_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A663N622_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A8C0EQC0_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A8D0ELW8_BCL2A1-      ---caaaccgaggaggctctcagaccattcttggacaggat---tgatat
A0A8D0EB90_BCL2A1-      ---gaagttgagaagaaattggaactgttgtgggactcagt---tgagat
A0A7M4FFQ8_BCL2A1-      ---gaaactgaagagaatctaaagccattcttggacacact---tgaatt
A0A8C8SUC3_BCL2A1-      ---gaaaatgaagaaacgctgaaaccatgtttggacactct---tgttat
K7G130_BCL2A1-01        ---gaaaacgaagagatactgaaaccatgtttggacacact---tgatat
A0A8C3FIW3_BCL2A1-      ---gaaaatgaagagagtctgaaaccatgtttggacacact---tgatat
A0A8C0G393_BCL2A1-      ---gaaaatgaagaaagtctgaaaccatgtttggacacact---tgatat
A0A452J3N6_BCL2A1-      ---gaaaatgaagagagtctgaaaccatgtttggacacatt---tgatat
A0A8C4W4P8_BCL2A1-      ---gaaaatgaagagagtctgaaaccatgtttggacacatt---tgatat
A0A8C3RME9_BCL2A1-      ---gaaaatgaagagagtctgaaaccatgtttggacacact---tgatat
A0A674K8Q6_BCL2A1-      ---gaaaatgaagagagtctgaaaccatgtttggacacact---tgatat
A0A8C6VPU0_BCL2A1-      ---gaagttgaaagcaacctgaggccttacatggactcact---ggggat
A0A8C5SDG4_BCL2A1-      ---gaagttgaaggcaacctgaggccttacgtggactcact---ggggat
A0A670YDS2_BCL2A1-      ---gaagttgaaggcaacctgaggccttacgtggactcact---ggggat
A0A8D0H8G3_BCL2A1-      ---aaagttgaagagagcttaagaccgtatttagacaacct---ggctat
A0A8D2Q8F9_BCL2A1-      ---gaagtggaagagaacctaagaccctatttggactccct---ggagat
A0A670JXJ0_BCL2A1-      ---gcgctgcgagcggagctgaagc-------------------------
A0A670JXJ0_BCL2A1-      ---gaagtggaagagaagataaagccactttggcactccat---caagat
A0A670JXJ0_BCL2A1-      ---gaagtggaagagaagataaagccactttggcactccat---caagat
F6S8G3_BCL2A1-01        ---gacgtggagaaggctctgaagccgtgcttcgacagtct---cgacgt
A0A8C5VB12_BCL2A1-      ---gaagtggaaaggagactggaaccgtgcctggacaattt---caacgt
A0A286XUI2_BCL2A1-      ---gaggtggagaggcggctgaaaccgtggctggacagaat---tgacgt
A0A8C2UN30_BCL2A1-      ---gaagtggaggagagcctgaagccgtggttggacagatg---cgatgt
A0A8C5L8K1_BCL2A1-      ---gaagtcgagaagaatctgaaaccatacctggagaactt---tgaggt
F6SFL4_BCL2A1-01        ---gaagtagaaaaggatatggaaacatgcttgagcacttt---ggacat
A0A4X2KFL7_BCL2A1-      ---gaagttgaaaaggatatggaaacatgcttgagcacttt---ggatat
A0A7N4P573_BCL2A1-      ---gaaggtga-------------------ttgctcacagt---aaatat
A0A7N4P573_BCL2A1-      ---gaagttgaaaaggatatggaaacattcttgagcacttt---ggacat
A0A7N4P573_BCL2A1-      ---gaagttgaaaaggatatggaaacattcttgagcacttt---ggacat
A0A7N4P573_BCL2A1-      ---gaagttgaaaaggatatggaaacattcttgagcacttt---ggacat
A0A8C0KQ53_BCL2A1-      ---caggtggaaaagaacctgaagccgtgcttggacagttt---tgacgt
A0A8C0MTY3_BCL2A1-      ---caggtggaaaagaacctgaagccgtgcttggacagttt---tgacgt
A0A8I3MYG9_BCL2A1-      ---caggtggaaaagaacctgaagccgtgcttggacagttt---tgacgt
M3YVH4_BCL2A1-01        ---gaggtggaacagaacttgagaccatgcttggacagctt---tgatgt
U6CQS8_BCL2A1-01        ---gaggtggaacagaacttgaaaccatgcttggacagctt---tgacgt
A0A452U285_BCL2A1-      ---gaggtggaaaagaacttgaaaccatgcctggacagttt---cgatgt
G1LIJ8_BCL2A1-01        ---gaggtggaaaagaacttgaaaccatgcctggacagttt---tgatgt
A0A452SIR9_BCL2A1-      ---gaggtggaaaagaacttgaaaccatgcctggacagttt---cgatgt
A0A452U285_BCL2A1-      ---gaggtggaaaagaacttgaaaccatgcctggacagttt---cgatgt
A0A5F9CXI7_BCL2A1-      ---ggagcg---------------------------actgc---gccagt
A0A5F9CXI7_BCL2A1-      ---ggagcg---------------------------actgc---gccagt
A0A5F9CXI7_BCL2A1-      ---gaagtggaagaggctctgcaaccgtacctgcacaatgt---gcctgt
A0A5F9CXI7_BCL2A1-      ---gaagtggaagaggctctgcaaccgtacctgcacaatgt---gcctgt
A0A8C8X938_BCL2A1-      tcagaagtcgaaaagaatctccatc--tttctgagcatgccagacgaagt
M3WHW2_BCL2A1-01        ---gaggtcgagaagaagttgaagccgtgcctggacaagtt---ccatgt
A0A667HQV5_BCL2A1-      ---gaggtcgagaagaagttgaagccgtgcctggacaagtt---ccacgt
A0A8C9KZ34_BCL2A1-      ---gaggtcgagaagcagctgaagccgtgcctggacaagtt---ccacgt
A0A8C8X938_BCL2A1-      ---gaggtcgagaagcagctgaagccgtgcctggacaagtt---ccacgt
A0A8C9KZ34_BCL2A1-      ---gaggtcgagaagcagctgaagccgtgcctggacaagtt---ccacgt
A0A8C0WAG3_BCL2A1-      ---gaagtggaaaagagtctgcagccatacttggacaaatg---tgatgt
A0A8C6QF32_BCL2A1-      ---gaagttgaaaagaatctgaaaccatacttggacaattt---tgatgt
A0A8C6R201_BCL2A1-      ---gaagttgaacagaatctgaaactatacttggacaattt---tgatgt
A0A8C6GN16_BCL2A1-      ---gaagttggaaagaacctgaagtcatacttggatgactt---tcacgt
G3V977_BCL2A1-01        ---gaagttgaaaagaatctgaagccatacttggatgactt---tcacgt
Q925A9_BCL2A1-01        ---gaagttgaaaagaatctgaagccatacttggatgactt---tcacgt
O55178_BCL2A1-01        ---gaagttggaaagaacctaaagtcatacttggatgactt---tcacgt
Q0P538_BCL2A1-01        ---gaagttggaaagaacctaaagtcatacttggatgactt---tcacgt
A0A8C6H5H7_BCL2A1-      ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
O55179_BCL2A1-01        ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
Q8K164_BCL2A1-01        ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
Q4FK02_BCL2A1-01        ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
O55177_BCL2A1-02        ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
Q497M6_BCL2A1-01        ---gaagttgaaaagaatctgaagtcatacttggatgactt---tcacgt
A0A8C2LQI3_BCL2A1-      ---gaagtcgaaaagaatctgaaactatacttggatgattt---tgatgt
A0A8C8U2B9_BCL2A1-      ---aaagtggaaaagaatctgaaactatacttggattattt---tgatgt
A0A8D2B7G1_BCL2A1-      ---gaagttgaaaataatctgaaaccatacttggacaattt---tgatgt
A0A8C5YJP3_BCL2A1-      ---gaagttgaaaagaatctgaaaccatacttggacaattt---tgatgt
I3MCZ7_BCL2A1-01        ---gaagttgaaaagaatctgaaaccattcttggacaattt---tgatgt
A0A8C9PIV7_BCL2A1-      ---gaagttgaaaagaatctgaaaccatacttggacaattt---tgatgt
A0A8D2IK51_BCL2A1-      ---gaagttgaaaagaatctgaaaccatacttggacaattt---tgatgt
A0A8C9DF25_BCL2A1-      ---gaagttgaaaagcatctgaaaccatgcttggacaattt---caatgt
A0A2K6EKG1_BCL2A1-      ---gaagtcgaaaagaatctgaaagcatgcttggacaatgt---taatgt
A0A8C6MJ03_BCL2A1-      ---gaagtggaaaggactttgaagcagtgcttggataagtt---tgatgt
A0A8B9YDG7_BCL2A1-      ------------------ctgaagca------------------------
A0A8B9YDG7_BCL2A1-      ---gaagtggaaaggactctgaagcagtgcttggataagtt---tgatgt
A0A8B9YDG7_BCL2A1-      ---gaagtggaaaggactctgaagcagtgcttggataagtt---tgatgt
A0A8B9YDG7_BCL2A1-      ---gaagtggaaaggactctgaagcagtgcttggataagtt---tgatgt
A0A452EK63_BCL2A1-      ---gaagtggaaaggactttgaagcagtgcttggataagtt---tgatgt
W5Q0N6_BCL2A1-01        ---gaagtggaaaggactctgaagcagtgcttggataagtt---tgatgt
A0A671FLY8_BCL2A1-      ---gaagtggaaaagaatttgaagccatgcttggacagctt---cgatgt
H0WZ23_BCL2A1-01        ---gaggttgaaaagagtctgaaaccatgcttagacaattt---taatgt
F7HXW0_BCL2A1-01        ---gaagtggaaaagagtctgaagtcatgcttggacaatgt---tgatat
F7HXW0_BCL2A1-02        ---gaagtggaaaagagtctgaagtcatgcttggacaatgt---tgatat
A0A2K6TLG6_BCL2A1-      ---gaagtggaagagagtctgaagccatgcttggacaacgt---tcatat
A0A2K6TLG6_BCL2A1-      ---gaagtggaagagagtctgaagccatgcttggacaacgt---tcatat
A0A2K6TLG6_BCL2A1-      ---gaagtggaagagagtctgaagccatgcttggacaacgt---tcatat
A0A2K5D2I1_BCL2A1-      ---gaagtggaaaagagtctgaagccatgcttggacaatgt---taatat
A0A2K5D2I1_BCL2A1-      ---gaagtggaaaagagtctgaagccatgcttggacaatgt---taatat
A0A2I3GQS0_BCL2A1-      ---gaagtggaaaagaatctgaagccgtgcttggacaatgt---taatgt
A0A2I3GQS0_BCL2A1-      ---gaagtggaaaagaatctgaagccgtgcttggacaatgt---taatgt
A0A2I3GQS0_BCL2A1-      ---gaagtggaaaagaatctgaagccgtgcttggacaatgt---taatgt
A0A2K5KAA3_BCL2A1-      ---gaagtggaaaagaatctgaagccgtgcttggacaatgt---taatgt
A0A8D2E7F6_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A8C9HCC9_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6AD27_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A0D9RRC3_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6LV19_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6PHF2_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5KHH8_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6DS18_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5KHH8_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5TMD1_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
F7E8V5_BCL2A1-01        ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5KAA3_BCL2A1-      ---gaagtggaaaagaatctgaagccgtgcttggacaatgt---taatgt
A0A2K6LV19_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6PHF2_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6AD27_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5KHH8_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K5TMD1_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
A0A2K6DS18_BCL2A1-      ---gaagtggaaaagaatctgaagccatgcttggacaatgt---taatgt
H2NNZ9_BCL2A1-01        ---gaagtggaaaagaatctgaagccatgcttggacaacgt---taatgt
B4E1X9_BCL2A1-03        ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2R8ZJ66_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2R8ZJ66_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
B4E1X9_BCL2A1-02        ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2I2YJV4_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2I2YJV4_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2R8ZJ66_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
A0A2I2YJV4_BCL2A1-      ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
B4E1X9_BCL2A1-01        ---gaagtggaaaagaatctgaagtcatgcttggacaatgt---taatgt
G3T8E6_BCL2A1-01        ---gaagttgaaaagaatttgaaaccctgcttggacaattt---tgttgt
A0A8C3WEA1_BCL2A1-      ---caagttgaaaagaatttgaaaccttgcttggacaattt---tgatgt
A0A8D1BRF8_BCL2A1-      -----agctgaa------------------------------------gc
A0A8D0Z1Y4_BCL2A1-      -----agctgaa------------------------------------gc
A0A8D1SK15_BCL2A1-      -----agctgaa------------------------------------gc
A0A4X1UP21_BCL2A1-      -----agctgaa------------------------------------gc
A0A8D1BRF8_BCL2A1-      -----agctgaa------------------------------------gc
A0A8D1YBS8_BCL2A1-      -----agctgaa------------------------------------gc
A0A4X1UP21_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A4X1UQW5_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D0Z1Y4_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1BRF8_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1SK15_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1YBS8_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
C7F841_BCL2A1-01        ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1KPD1_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1BRF8_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A4X1UP21_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1SK15_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D0Z1Y4_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8D1YBS8_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaattt---tgatgt
A0A8C0CSU7_BCL2A1-      ---gaagttgaaaagaatttgaaaccattcttggacaatat---tgatgt
A0A8C6FDW6_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaatat---tgatgt
A0A8C9BC20_BCL2A1-      ---gaagttgaaaagaatttgaaaccatgcttggacaatat---tgatgt
A0A5F5PK00_BCL2A1-      ---gaagtagagaagaatttgaaaccatgcttggacaattt---tcatgt
A0A8C4PQL1_BCL2A1-      ---gaagtagagaagaatttgaaaccatgcttggacaattt---tcatgt
A0A5F5PK00_BCL2A1-      ---gaagtagagaagaatttgaaaccatgcttggacaattt---tcatgt
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      ggtgtcggtggacgccgcccggacggtgttccagcaggtgatggagaagg
A0A8B9S513_BCL2A1-      tacctctgtagatgttgccaagcgaattttcaatggagtcatggaagaaa
A0A8C6ZVQ3_BCL2A1-      tgactctgtagatgttgccaagagaattttcaatggagtcatggaagaaa
A0A8C5X4L3_BCL2A1-      cacctctgtagctgctgccaagagaattttcaacggagtcatggaagaaa
H0ZCL9_BCL2A1-01        cacctctgtagcggctgccaagagaattttcaatggagtcatggatgaaa
A0A8C5J3C4_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8D2QAC0_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8C9MQN0_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggaagaaa
A0A8C3NVU4_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggaagaaa
A0A8D2PM01_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8C0UPM3_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8C0UPM3_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8C3U920_BCL2A1-      cacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A803V184_BCL2A1-      cacctcagtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A8C2UCW6_BCL2A1-      cacctccgttgatgttgccaagagaattttcaatggagtcatggaagaaa
G1N8C5_BCL2A1-01        cacctctgtagatgttgccaagagaattttcaatggagtcatggaagaaa
A0A8C3KTI3_BCL2A1-      tacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaa
A0A669PVQ4_BCL2A1-      tacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaa
A0A8B9CVY0_BCL2A1-      tacttctgtagatgttgccaagagaattttcaatggtgtcatggatgaga
A0A8B9E009_BCL2A1-      tacttctgtagatgttgccaagagaattttcaatggtgtcatggatgaga
A0A8C3BNR4_BCL2A1-      tacttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaa
A0A493SSZ7_BCL2A1-      cagttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaa
A0A8B9UZT1_BCL2A1-      cagttctgtagatgttgccaagagaattttcaatggtgtcatggatgaaa
A0A8C3K1C5_BCL2A1-      tacctcggtagctgttgccaagagaattttcaatggtgtcatggaagaaa
A0A8B9FJB5_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatggaagaaa
A0A672UHF9_BCL2A1-      tacctctgtagctgtagccaagagaattttcaatggtgtcatggaagaaa
A0A8C4U5U5_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatggaagaaa
A0A8B9Z3D5_BCL2A1-      tacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaa
A0A8B9RZD1_BCL2A1-      tacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaa
A0A663E5S6_BCL2A1-      tacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaa
A0A8C8AIP7_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaa
A0A663N622_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaa
A0A8C0EQC0_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaa
A0A8D0ELW8_BCL2A1-      tacctctgtagctgttgccaagagaattttcaatggtgtcatgcaagaaa
A0A8D0EB90_BCL2A1-      cacttctgttgacaaagccagtaaaatattcaacaaagtgatggaagagg
A0A7M4FFQ8_BCL2A1-      ttcatctatagaagttgccagaagaattttcacccaagttatggagcaag
A0A8C8SUC3_BCL2A1-      tacctctgtcgatgctgccagaagaattttcattaaagtcatggatgaag
K7G130_BCL2A1-01        tacctctgtagatgctgccagaagaattttcattcaagtcatggataaag
A0A8C3FIW3_BCL2A1-      taccactgtagatgctgccagaagaattttcactgaagtcgtggataaag
A0A8C0G393_BCL2A1-      tacctctgtagatgctgccagaagaattttcactcaagtcatggataaag
A0A452J3N6_BCL2A1-      tacctctgtagatgctgccagaagaattttcactcaagtcatggataaag
A0A8C4W4P8_BCL2A1-      tacctctgtagatgctgccagaagaattttcactcaagtcatggataaag
A0A8C3RME9_BCL2A1-      tacctctgtagatgctgccagaagaattttcactcaagtcatggaaaaag
A0A674K8Q6_BCL2A1-      tacctctgtagatgctgccagaagaattttcactgaagtcgtggataaag
A0A8C6VPU0_BCL2A1-      tcattccgtagaagaagccggcaacattttcaatcaagtgatggaaaacg
A0A8C5SDG4_BCL2A1-      tcattccatagaagaagctggcaacattttcaatcaagtgatggaaaacg
A0A670YDS2_BCL2A1-      tcattccatagaagaagctggcaacattttccatcaagtgatggaaaatg
A0A8D0H8G3_BCL2A1-      tcactctgtggatgctgcccggatcattttcaatcaagtcatggaaaaag
A0A8D2Q8F9_BCL2A1-      cagctccatcagtgatgctagcagaattttcagtcaagtgatggaagagg
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      cagttctgtcgaggaggccagtgacattttcagccaggtgatggctcagg
A0A670JXJ0_BCL2A1-      cagttctgtcgaggaggccagtgacattttcagccaggtgatggctcagg
F6S8G3_BCL2A1-01        tggctcggtaggggcagccagaagaatcttcggccaaattgtggaaaagg
A0A8C5VB12_BCL2A1-      cgcctccgtagagacggccagagccatcttcagtcgcgtgatggagcagg
A0A286XUI2_BCL2A1-      ggagtccatcgacactgcgaagtcgatattcaaccaagtgatggagaagg
A0A8C2UN30_BCL2A1-      ggcgtccgtcaacgctgccagggcgatattcacccaggtgatggagaagg
A0A8C5L8K1_BCL2A1-      gacctccatcgatgatgccagaatcatcttcaatcaagtgatggaaaagg
F6SFL4_BCL2A1-01        cgtttctgtagagtctgccagaagaattttcaatagtgttatgaagaagg
A0A4X2KFL7_BCL2A1-      tgcttctgtagattctgccagaagaattttcaaaagcgttatggaaaagg
A0A7N4P573_BCL2A1-      ca-------aga--gtctcag-agaattt----caatctt----------
A0A7N4P573_BCL2A1-      tacttctgtagattgtgccagaagaattttcaacagtgttatggaaaagg
A0A7N4P573_BCL2A1-      tacttctgtagattgtgccagaagaattttcaacagtgttatggaaaagg
A0A7N4P573_BCL2A1-      tacttctgtagattgtgccagaagaattttcaacagtgttatggaaaagg
A0A8C0KQ53_BCL2A1-      ggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaagg
A0A8C0MTY3_BCL2A1-      ggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaagg
A0A8I3MYG9_BCL2A1-      ggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaagg
M3YVH4_BCL2A1-01        ggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaagg
U6CQS8_BCL2A1-01        ggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaagg
A0A452U285_BCL2A1-      ggtgtccgtcgactccgccagaaccatattcaatcaggtcatggaaaagg
G1LIJ8_BCL2A1-01        ggtgtccgtcgactccgccagaaccatattcaatcaggtcatggaaaagg
A0A452SIR9_BCL2A1-      ggtgtccgtcgactccgccagaaccatattcaatcaggtcatggaaaagg
A0A452U285_BCL2A1-      ggtgtccgtcgactccgccagaaccatattcaatcaggtcatggaaaagg
A0A5F9CXI7_BCL2A1-      cccgcc--------------------------------------------
A0A5F9CXI7_BCL2A1-      cccgcc--------------------------------------------
A0A5F9CXI7_BCL2A1-      cgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaag
A0A5F9CXI7_BCL2A1-      cgcgtccgtcgagactgccaggacaattttcaaccaagtgatggagaaag
A0A8C8X938_BCL2A1-      cgagacagaagagatcatcagggacattttccggcaaggga---------
M3WHW2_BCL2A1-01        ggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaagg
A0A667HQV5_BCL2A1-      ggtgtcggtagacacggccaggacgatattccaccaagtgatggaaaagg
A0A8C9KZ34_BCL2A1-      ggggtcggtagacacggccaggacgatgttccaccaagtgatggagaagg
A0A8C8X938_BCL2A1-      ggggtcggtagacacggccaggacgatgttccaccaagtgatggagaagg
A0A8C9KZ34_BCL2A1-      ggggtcggtagacacggccaggacgatgttccaccaagtgatggagaagg
A0A8C0WAG3_BCL2A1-      ggcgtccgtagatactgccagaaccatattcaatcaagtgatggaaaagg
A0A8C6QF32_BCL2A1-      ggtatccatagatacagctagaacaatattcaatcaagtgatggaaaaag
A0A8C6R201_BCL2A1-      tgtacccacagatacagctagtacaatattcaatcaagtgatggaaaaag
A0A8C6GN16_BCL2A1-      ggaatccatagatactgccagaataatattcaaccaagtgatgaaaaaag
G3V977_BCL2A1-01        ggaatccatagatactgccagaataatattcaaccaagtgatggaaaaag
Q925A9_BCL2A1-01        ggaatccatagatactgccagaataatattcaaccaagtgatggaaaaag
O55178_BCL2A1-01        ggaatccatagataccaccagaataatattcaaccaagtgatggaaaaag
Q0P538_BCL2A1-01        ggaatccatagataccaccagaataatattcaaccaagtgatggaaaaag
A0A8C6H5H7_BCL2A1-      ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
O55179_BCL2A1-01        ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
Q8K164_BCL2A1-01        ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
Q4FK02_BCL2A1-01        ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
O55177_BCL2A1-02        ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
Q497M6_BCL2A1-01        ggaatccatagataccgccagaataatattcaaccaagtgatggaaaaag
A0A8C2LQI3_BCL2A1-      gagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaag
A0A8C8U2B9_BCL2A1-      gggatccattgatgctgccagaactatcttcaatcaagtgatggaaaaag
A0A8D2B7G1_BCL2A1-      ggtgtctgtagatactgccagaacaatattcaatcaagtgatggaaaagg
A0A8C5YJP3_BCL2A1-      ggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaagg
I3MCZ7_BCL2A1-01        ggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaagg
A0A8C9PIV7_BCL2A1-      ggtgtctgctgatactgccagaacaatattcaatcaagtgatggaaaagg
A0A8D2IK51_BCL2A1-      ggtgtctgctgatattgccagaacaatattcaatcaagtgatggaaaagg
A0A8C9DF25_BCL2A1-      tgcgtccatagatgctgccagaacagtgttcaatcaagtgatggaaaagg
A0A2K6EKG1_BCL2A1-      ggcgtccatagatgccgccagaacgatattcaatcaagtgatggaaaagg
A0A8C6MJ03_BCL2A1-      ggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaagg
A0A8B9YDG7_BCL2A1-      -gcgtctgcgggcgctg-------------------agcgctg-------
A0A8B9YDG7_BCL2A1-      ggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaagg
A0A8B9YDG7_BCL2A1-      ggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaagg
A0A8B9YDG7_BCL2A1-      ggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaagg
A0A452EK63_BCL2A1-      ggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaagg
W5Q0N6_BCL2A1-01        ggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaagg
A0A671FLY8_BCL2A1-      catgtccatagatactgccaggacaatattcaaccaagtgatggaaaagg
H0WZ23_BCL2A1-01        tgtatccatagatactgccagaacaatattcaatcaagtgatggaaaagg
F7HXW0_BCL2A1-01        tgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaagg
F7HXW0_BCL2A1-02        tgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaagg
A0A2K6TLG6_BCL2A1-      tgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaagg
A0A2K6TLG6_BCL2A1-      tgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaagg
A0A2K6TLG6_BCL2A1-      tgtgtccatggacaatgccagaacaatattcagtcaagtgatggaaaagg
A0A2K5D2I1_BCL2A1-      tgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaagg
A0A2K5D2I1_BCL2A1-      tgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaagg
A0A2I3GQS0_BCL2A1-      tgtgtccatagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2I3GQS0_BCL2A1-      tgtgtccatagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2I3GQS0_BCL2A1-      tgtgtccatagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2K5KAA3_BCL2A1-      tgcatccatagacactgccagaacaatattcaatcaagtgatggaaaagg
A0A8D2E7F6_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A8C9HCC9_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6AD27_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A0D9RRC3_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6LV19_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6PHF2_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5KHH8_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6DS18_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5KHH8_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5TMD1_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
F7E8V5_BCL2A1-01        tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5KAA3_BCL2A1-      tgcatccatagacactgccagaacaatattcaatcaagtgatggaaaagg
A0A2K6LV19_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6PHF2_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6AD27_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5KHH8_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K5TMD1_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
A0A2K6DS18_BCL2A1-      tgcatccatagacactgccagaacactattcaatcaagtgatggaaaagg
H2NNZ9_BCL2A1-01        tgtgtccgtagacactgccagaacactattcaaccaagtaatggaaaagg
B4E1X9_BCL2A1-03        tgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2R8ZJ66_BCL2A1-      tgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2R8ZJ66_BCL2A1-      tgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaagg
B4E1X9_BCL2A1-02        tgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2I2YJV4_BCL2A1-      tgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaagg
A0A2I2YJV4_BCL2A1-      tgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaagg
A0A2R8ZJ66_BCL2A1-      tgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaagg
A0A2I2YJV4_BCL2A1-      tgtgtccatagacactgccagaacactgttcaaccaagtgatggaaaagg
B4E1X9_BCL2A1-01        tgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaagg
G3T8E6_BCL2A1-01        catctccattgataccgcccaaacaatattcaagcaagtgatggaaaagg
A0A8C3WEA1_BCL2A1-      tgggtccatagacacggccaggataatattcaatcaggtgatggaaaagg
A0A8D1BRF8_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A8D0Z1Y4_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A8D1SK15_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A4X1UP21_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A8D1BRF8_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A8D1YBS8_BCL2A1-      agcgtctgcgggcggtg-------------------agcg----------
A0A4X1UP21_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A4X1UQW5_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D0Z1Y4_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1BRF8_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1SK15_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1YBS8_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
C7F841_BCL2A1-01        tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1KPD1_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1BRF8_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A4X1UP21_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1SK15_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D0Z1Y4_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8D1YBS8_BCL2A1-      tgtgtccatagacactgccagaataatattcaatcaagtgatggaaaagg
A0A8C0CSU7_BCL2A1-      tgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaaggg
A0A8C6FDW6_BCL2A1-      tgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaaggg
A0A8C9BC20_BCL2A1-      tgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaaggg
A0A5F5PK00_BCL2A1-      tgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagc
A0A8C4PQL1_BCL2A1-      tgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagc
A0A5F5PK00_BCL2A1-      tgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagc
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ----------------------------------------atggaaaagc
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      agtttgaagac-ggcgtggttaactgggggaggatcgtgaccgtattcgc
A0A8B9S513_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaatcatgaccatatttac
A0A8C6ZVQ3_BCL2A1-      attttgctgat-ggaaataccaactggggacgaatcacgaccatattcac
A0A8C5X4L3_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
H0ZCL9_BCL2A1-01        agtttgctgat-ggaaatactaactggggacgaatcatgaccatctttac
A0A8C5J3C4_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8D2QAC0_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C9MQN0_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C3NVU4_BCL2A1-      agttttctgat-ggaaatactaactggggacgaatcatgaccatatttac
A0A8D2PM01_BCL2A1-      agttttctgat-ggaaatactaactggggacgaatcatgaccatatttac
A0A8C0UPM3_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C0UPM3_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C3U920_BCL2A1-      agtttgctgat-ggaaatactaactggggaagaattatgaccatatttac
A0A803V184_BCL2A1-      agtttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C2UCW6_BCL2A1-      aatttgctgat-ggaaatacgaactggggacgaattacgaccatatttac
G1N8C5_BCL2A1-01        aatttgctgac-ggaaatactaactggggacgaattatgaccatatttac
A0A8C3KTI3_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A669PVQ4_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8B9CVY0_BCL2A1-      aatttgctgat-ggaaatactaattggggaagaattatgaccatatttac
A0A8B9E009_BCL2A1-      aatttgctgat-ggaaatactaattggggaagaattatgaccatatttac
A0A8C3BNR4_BCL2A1-      aatttgctgat-ggaaatactaattggggaagaattacgaccatatttac
A0A493SSZ7_BCL2A1-      aatttgctgat-ggaaatactaattggggaagaattacgaccatatttac
A0A8B9UZT1_BCL2A1-      aatttgctgat-ggaaatactaattggggaagaattacgaccatatttac
A0A8C3K1C5_BCL2A1-      aatttgctgac-ggaaatactaactggggacgaattatgaccatatttac
A0A8B9FJB5_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A672UHF9_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C4U5U5_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8B9Z3D5_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8B9RZD1_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A663E5S6_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C8AIP7_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A663N622_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8C0EQC0_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8D0ELW8_BCL2A1-      aatttgctgat-ggaaatactaactggggacgaattatgaccatatttac
A0A8D0EB90_BCL2A1-      aattttctgat-ggaaacaccaactgggggcgaattgtgacaatattcct
A0A7M4FFQ8_BCL2A1-      aatttgctgat-ggcaataccaactggggacggattttgacaatatttat
A0A8C8SUC3_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
K7G130_BCL2A1-01        aatttgatgat-ggaaacactaactgggggcggattttgacaatatttat
A0A8C3FIW3_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A8C0G393_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A452J3N6_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A8C4W4P8_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A8C3RME9_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A674K8Q6_BCL2A1-      aatttgctgat-ggaaacactaactggggacggattttgacaatatttat
A0A8C6VPU0_BCL2A1-      aatttgcggat-gggaaaattaactggggacgcattctgacgatattcct
A0A8C5SDG4_BCL2A1-      aatttgcggat-gggaaaattaactggggacgcattctgacgatattcct
A0A670YDS2_BCL2A1-      aatttgcggat-gggaaaattaactggggacgcattctgacgatattcct
A0A8D0H8G3_BCL2A1-      aatttgatgat-gggaacaccaactggggacggattttgacagtatttat
A0A8D2Q8F9_BCL2A1-      aatttgctgat-ggaaccaccaactggggacggattttgacaatattcct
A0A670JXJ0_BCL2A1-      -----gccgcctgggagccctgagcg------------------------
A0A670JXJ0_BCL2A1-      aatttgccgac-gggaacaccaactggggacggattttgacaatattcgt
A0A670JXJ0_BCL2A1-      aatttgccgac-gggaacaccaactggggacggattttgacaatattcgt
F6S8G3_BCL2A1-01        agttcgaggac-ggcatcgtcaactgggggcggattgtgacgatatttgt
A0A8C5VB12_BCL2A1-      agttcggggac-ggcgtcgtcaactggggaagggtcgtgaccgtgtttgc
A0A286XUI2_BCL2A1-      agttcgaggat-ggcatcattaactggggacggattgtgactatctttgc
A0A8C2UN30_BCL2A1-      agttcgaggac-ggcatcattaactgggggcggattgtgaccatatttgc
A0A8C5L8K1_BCL2A1-      aatttgaagat-gggatcattaactgggggcggatagtgaccatatttgc
F6SFL4_BCL2A1-01        aatttgaggat-ggcgtcattaactggggacggattgtcaccatatttgc
A0A4X2KFL7_BCL2A1-      aatttgaggat-ggcattattaactggggacgtattgtcaccatatttgc
A0A7N4P573_BCL2A1-      --tctaagcat--gcaggatgaaattgagacaga----------------
A0A7N4P573_BCL2A1-      aatttgaggat-ggcatcatcaactggggacggattgtcaccatatttgc
A0A7N4P573_BCL2A1-      aatttgaggat-ggcatcatcaactggggacggattgtcaccatatttgc
A0A7N4P573_BCL2A1-      aatttgaggat-ggcatcatcaactggggacggattgtcaccatatttgc
A0A8C0KQ53_BCL2A1-      aatttgaagac-ggcgtcattaactggggaaggatcgtgaccgtttttgc
A0A8C0MTY3_BCL2A1-      aatttgaagac-ggcgtcattaactggggaaggatcgtgaccgtttttgc
A0A8I3MYG9_BCL2A1-      aatttgaagac-ggcgtcattaactggggaaggatcgtgaccgtttttgc
M3YVH4_BCL2A1-01        aatttgaagac-ggcatcattaactgggggaggattgtgaccgtgtttgc
U6CQS8_BCL2A1-01        aatttgaagac-ggcatcattaactgggggaggattgtgaccgtatttgc
A0A452U285_BCL2A1-      aatttgaagac-ggcatcattaactggggaagaattgtgaccatatttgc
G1LIJ8_BCL2A1-01        aatttgaagac-ggcatcattaactggggaaggattgtgaccatatttgc
A0A452SIR9_BCL2A1-      aatttgaagac-ggcatcattaactggggaagaattgtgaccatatttgc
A0A452U285_BCL2A1-      aatttgaagac-ggcatcattaactggggaagaattgtgaccatatttgc
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      agtttgaggat-ggtgtgatcaactggggcaggattgtgaccatatttgc
A0A5F9CXI7_BCL2A1-      agtttgaggat-ggtgtgatcaactggggcaggattgtgaccatatttgc
A0A8C8X938_BCL2A1-      ------agacc-tgcttcgtcccacggtaccg------------------
M3WHW2_BCL2A1-01        aatttgaagac-ggcatcattaactggggcaggattgtgactatatttgc
A0A667HQV5_BCL2A1-      agtttgaagac-ggcatcattaactggggcaggattgtgactatatttgc
A0A8C9KZ34_BCL2A1-      aatttgaagac-ggcatcatcaactggggcaggattgtgactatatttgc
A0A8C8X938_BCL2A1-      aatttgaagac-ggcatcatcaactggggcaggattgtgactatatttgc
A0A8C9KZ34_BCL2A1-      aatttgaagac-ggcatcatcaactggggcaggattgtgactatatttgc
A0A8C0WAG3_BCL2A1-      aattcgaagac-ggcgtcattaactgggggaggattgtgaccatatttgc
A0A8C6QF32_BCL2A1-      aatttgaagat-ggtattattaactgggggaggattgtgaccatatttgc
A0A8C6R201_BCL2A1-      aatttgaagat-ggtatcattaactgggggaggattgtgaccatatttgc
A0A8C6GN16_BCL2A1-      agtttgaagat-ggcatcattaattggggaaagattgtgactatatttac
G3V977_BCL2A1-01        aatttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
Q925A9_BCL2A1-01        aatttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
O55178_BCL2A1-01        agtttgaagat-ggcatcattaattggggaaggattgtgactatatttgc
Q0P538_BCL2A1-01        agtttgaaaat-ggcatcattaattggggaaggattgtgactatatttgc
A0A8C6H5H7_BCL2A1-      agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
O55179_BCL2A1-01        agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
Q8K164_BCL2A1-01        agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
Q4FK02_BCL2A1-01        agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
O55177_BCL2A1-02        agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
Q497M6_BCL2A1-01        agtttgaagat-ggcatcattaactggggaaggattgtgactatatttgc
A0A8C2LQI3_BCL2A1-      aatttgaagat-ggcatcattaactgggggaggattgtgactgtatttgc
A0A8C8U2B9_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgactgtatttgc
A0A8D2B7G1_BCL2A1-      aatttgaagat-ggcatcatgaactggggaaggattgtgaccatatttgc
A0A8C5YJP3_BCL2A1-      aatttgaagat-ggcatcatgaactggggaaggattgtgaccatatttgc
I3MCZ7_BCL2A1-01        aatttgaagat-ggcatcatgaactggggaaggattgtgaccatatttgc
A0A8C9PIV7_BCL2A1-      aatttgaagat-ggcatcatgaactggggaaggattgtgaccatatttgc
A0A8D2IK51_BCL2A1-      aatttgaagat-ggcatcatgaactggggaaggattgtgaccatatttgc
A0A8C9DF25_BCL2A1-      aatttgaagat-ggcgtcattaactggggaaggattgtgaccgtatttgc
A0A2K6EKG1_BCL2A1-      aatttgaagat-ggcatcgttaactggggaaggattgtgaccgtgtttgc
A0A8C6MJ03_BCL2A1-      aatttgaagat-ggcgttgttaactggggcaggattgtaaccatattcgc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      aatttgaagat-ggcattgttaactggggcaggattgtaaccatattcgc
A0A8B9YDG7_BCL2A1-      aatttgaagat-ggcattgttaactggggcaggattgtaaccatattcgc
A0A8B9YDG7_BCL2A1-      aatttgaagat-ggcattgttaactggggcaggattgtaaccatattcgc
A0A452EK63_BCL2A1-      aatttgaagat-ggcattgttaactggggcaggattgtaaccatattcgc
W5Q0N6_BCL2A1-01        aatttgaagat-ggcattgttaactggggcaggattgtaaccatattcgc
A0A671FLY8_BCL2A1-      agtttgaagac-ggcgtcattaactggggaaggattgtgaccatattcgc
H0WZ23_BCL2A1-01        aatttgaagat-ggcatcattaactggggcaggattgtgacaatatttgc
F7HXW0_BCL2A1-01        aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
F7HXW0_BCL2A1-02        aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2K6TLG6_BCL2A1-      aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2K6TLG6_BCL2A1-      aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2K6TLG6_BCL2A1-      aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2K5D2I1_BCL2A1-      aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2K5D2I1_BCL2A1-      aatttgaagat-ggcattattaactggggaagaattgtaaccatatttgc
A0A2I3GQS0_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2I3GQS0_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2I3GQS0_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KAA3_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A8D2E7F6_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A8C9HCC9_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6AD27_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A0D9RRC3_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6LV19_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6PHF2_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KHH8_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6DS18_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KHH8_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5TMD1_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
F7E8V5_BCL2A1-01        agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KAA3_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6LV19_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6PHF2_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6AD27_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5KHH8_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K5TMD1_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2K6DS18_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
H2NNZ9_BCL2A1-01        agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
B4E1X9_BCL2A1-03        agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2R8ZJ66_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2R8ZJ66_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
B4E1X9_BCL2A1-02        agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2I2YJV4_BCL2A1-      agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2I2YJV4_BCL2A1-      agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2R8ZJ66_BCL2A1-      agtttgaagat-ggcatcattaactggggaagaattgtaaccatatttgc
A0A2I2YJV4_BCL2A1-      agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
B4E1X9_BCL2A1-01        agtttgaagac-ggcatcattaactggggaagaattgtaaccatatttgc
G3T8E6_BCL2A1-01        aatttgaagat-ggcatcattaactggggaagaattgtgaccatatttgc
A0A8C3WEA1_BCL2A1-      aatttgaagac-ggcatcatcaactggggaaggattgtgactgtatttgc
A0A8D1BRF8_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A8D0Z1Y4_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A8D1SK15_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A4X1UP21_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A8D1BRF8_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A8D1YBS8_BCL2A1-      -----------------------ccgaggagcggctgcg-ccagtcccgc
A0A4X1UP21_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A4X1UQW5_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D0Z1Y4_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1BRF8_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1SK15_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1YBS8_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
C7F841_BCL2A1-01        aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1KPD1_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1BRF8_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A4X1UP21_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1SK15_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D0Z1Y4_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8D1YBS8_BCL2A1-      aatttgaagat-ggcatcattaactggggaaggattgtgaccatatttgc
A0A8C0CSU7_BCL2A1-      aatttgaagat-ggcatcgttaactggggaaggattgtgaccatatttgc
A0A8C6FDW6_BCL2A1-      aatttgaagat-ggcatcgttaactggggaaggattgtgaccatatttgc
A0A8C9BC20_BCL2A1-      aatttgaagat-ggcatcgttaac---ggaaggattgtgaccatatttgc
A0A5F5PK00_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattatgaccatatttgc
A0A8C4PQL1_BCL2A1-      aatttgaagac-ggcatcattaactggggaagaattatgaccatatttgc
A0A5F5PK00_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattatgaccatatttgc
A0A5F5PK00_BCL2A1-      ------------------------------------atggcggcggcagc
A0A5F5PK00_BCL2A1-      aatttgaagat-ggcatcattaactggggaagaattatgaccatatttgc
A0A5F5PK00_BCL2A1-      ------------------------------------atgacc--------
                                                                          

A0A673TDC6_BCL2A1-      gttcgagggcgtcctcctc-aagaagctgctgcgggagcgagcggccccg
A0A8B9S513_BCL2A1-      atttggaggacttctcact-aagaagcttcaagagcatggagttcagctc
A0A8C6ZVQ3_BCL2A1-      ctttggaggacttctcacc-aagaagcttcaagagcacggagttcagctc
A0A8C5X4L3_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcacggggttcagctg
H0ZCL9_BCL2A1-01        atttggaggtcttctcacc-aagaagcttcaagagcatggggttcagctg
A0A8C5J3C4_BCL2A1-      atttggaggtgtcctcacc-aagaagcttcaagagcatggggttcagctg
A0A8D2QAC0_BCL2A1-      atttggaggtgtcctcacc-aagaagcttcaagagcatggggttcagctg
A0A8C9MQN0_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggggttcagctg
A0A8C3NVU4_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggggttcagctg
A0A8D2PM01_BCL2A1-      atttggaggtctcctcacc-aagaagcttcaagagcatggggttcagctg
A0A8C0UPM3_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggagttcagctg
A0A8C0UPM3_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggagttcagctg
A0A8C3U920_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggggttcagctg
A0A803V184_BCL2A1-      atttggaggtcttctcacc-aagaagcttcaagagcatggggttcagctg
A0A8C2UCW6_BCL2A1-      ttttggaggtcttctcacc-aagaagcttcaagagcacggagttcagctc
G1N8C5_BCL2A1-01        ttttggaggtcttctcacc-aagaagcttcaagagcagggagttcagctc
A0A8C3KTI3_BCL2A1-      ttttggaggtcttctcacc-aagaagcttcaagagcatggagttcagctc
A0A669PVQ4_BCL2A1-      ttttggaggtcttctcacc-aagaagcttcaagagcatggagttcagctc
A0A8B9CVY0_BCL2A1-      ttttgggggtcttctcact-aagaagcttcaagaacatggagttcagctc
A0A8B9E009_BCL2A1-      ttttgggggtcttctcact-aagaagcttcaagaacatggagttcagctc
A0A8C3BNR4_BCL2A1-      ttttggaggtcttctcact-aagaagcttcaagaacatggagttcagctc
A0A493SSZ7_BCL2A1-      ttttgggggtcttctcact-aagaagcttcaagaacatggagttcagctc
A0A8B9UZT1_BCL2A1-      ttttgggggtcttctcact-aagaagcttcaagaacatggagttcagctc
A0A8C3K1C5_BCL2A1-      atttggaggtcttctcact-aagaagcttcaagagcatggagtccagctg
A0A8B9FJB5_BCL2A1-      atttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A672UHF9_BCL2A1-      atttggaggtcttctcact-aagaagctccaagagcatggagttcagctc
A0A8C4U5U5_BCL2A1-      gtttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A8B9Z3D5_BCL2A1-      ctttggaggtcttctcact-aagaagcttcaagagcatggagttcaactc
A0A8B9RZD1_BCL2A1-      ctttgggggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A663E5S6_BCL2A1-      ctttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A8C8AIP7_BCL2A1-      atttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A663N622_BCL2A1-      gtttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A8C0EQC0_BCL2A1-      gtttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A8D0ELW8_BCL2A1-      gtttggaggtcttctcact-aagaagcttcaagagcatggagttcagctc
A0A8D0EB90_BCL2A1-      gtttggaggaattcttgcc-aaaaaactacaaaaacaaggagtcgttttg
A0A7M4FFQ8_BCL2A1-      gtttggaggaattgtcact-aagaggcttcaagagcatggagttcagctt
A0A8C8SUC3_BCL2A1-      gtttggtggaattctttct-aagaggcttcaagaacacagagttcagctt
K7G130_BCL2A1-01        gtttggaggaattctttct-aagaggcttcaagaacacaaagttcagctt
A0A8C3FIW3_BCL2A1-      gtttggaggaattctttct-aagaggcttcaagaacacaaagttcagctt
A0A8C0G393_BCL2A1-      gtttggaggaattatttct-aagaagcttcaagaacacagagttcagctt
A0A452J3N6_BCL2A1-      gtttggaggaattctttct-aagaagcttcaagaacacagagttcagctt
A0A8C4W4P8_BCL2A1-      gtttggaggaattctttct-aagaagcttcaagaacacagagttcagctt
A0A8C3RME9_BCL2A1-      gtttggaggaattctttct-aagaggcttcaagaacacagagttcagctt
A0A674K8Q6_BCL2A1-      gtttggaggaattctttct-aagaggcttcaagaacacaaagttcagctt
A0A8C6VPU0_BCL2A1-      gttcggtggaatcctggct-aaaaaactccaagga---------cctttg
A0A8C5SDG4_BCL2A1-      gttcggtggaatcctggcc-aaaaaactccaagga---------cctttg
A0A670YDS2_BCL2A1-      attcggtggaatcctggcc-aaaaaactccaagga---------cctttg
A0A8D0H8G3_BCL2A1-      gtttggaggaatcctctct-aagaagctaaaggaacttggagtccagctg
A0A8D2Q8F9_BCL2A1-      gtttggaggaatccttgca-aagaagctaaaacaacatggaattcctttg
A0A670JXJ0_BCL2A1-      --------------ccgcc-gagaagctgcgccag---------------
A0A670JXJ0_BCL2A1-      cttcgcaggaattatcgca-aagaagttgcgacagcacggagttcctttg
A0A670JXJ0_BCL2A1-      cttcgcaggaattatcgca-aagaagttgcgacagcacggagttcctttg
F6S8G3_BCL2A1-01        cttggggggcattctcacc-aagaagct-ccaaaggagcggagtcccgct
A0A8C5VB12_BCL2A1-      gttcggaggcgtcctcacc-aagagactcctgcgggagcgggcggccctg
A0A286XUI2_BCL2A1-      ttttgggggggtcatcctc-aagaaactcccacgagagccaatcgcccca
A0A8C2UN30_BCL2A1-      ttttgggggagtcatcctc-aagaaacttccgcgagagccgctggcccca
A0A8C5L8K1_BCL2A1-      ttttgggggtgttctcctg-aagaaacttccacgacagcagaccgacctt
F6SFL4_BCL2A1-01        ttttgggggaattctcatc-aagaagcttctgagacatagagctccactg
A0A4X2KFL7_BCL2A1-      ttttgggggaattctcatc-aagaaacttctgagacatagatctccactg
A0A7N4P573_BCL2A1-      ------agaaattatca---aggatatttttaa---acaaggc-------
A0A7N4P573_BCL2A1-      ttttgggggaattctcatt-aagaaacttctgagacacagagctccactg
A0A7N4P573_BCL2A1-      ttttgggggaattctcatt-aagaaacttctgagacacagagctccactg
A0A7N4P573_BCL2A1-      ttttgggggaattctcatt-aagaaacttctgagacacagagctccactg
A0A8C0KQ53_BCL2A1-      ctttgaaggaattctcacc-aagaaactcctcgagcagcgaatttcctcg
A0A8C0MTY3_BCL2A1-      ctttgaaggaattctcacc-aagaaactcctcgagcagcgaatttcctcg
A0A8I3MYG9_BCL2A1-      ctttgaaggaattctcacc-aagaaactcctcgagcagcgaatttcctcg
M3YVH4_BCL2A1-01        ctttgaaggcattctctcc-aagaagctcctccgggagcgaatttccccg
U6CQS8_BCL2A1-01        ctttgaaggcattctctcc-aagaagctcctccgggagcgaatttccccg
A0A452U285_BCL2A1-      gttcgaagggattctcacc-aagaaactcctccaggagcgaatctccccg
G1LIJ8_BCL2A1-01        gtttgaagggattctcacc-aagaaactcctccgggagcgaatttcccca
A0A452SIR9_BCL2A1-      gttcgaagggattctcacc-aagaaactcctccaggagcgaatctccccg
A0A452U285_BCL2A1-      gttcgaagggattctcacc-aagaaactcctccaggagcgaatctccccg
A0A5F9CXI7_BCL2A1-      -----------tactgacc-cagaa-------------------------
A0A5F9CXI7_BCL2A1-      -----------tactgacc-cagaa-------------------------
A0A5F9CXI7_BCL2A1-      attcgaaggggtcctggcc-aagaagctcctccaggagcaggctgttccg
A0A5F9CXI7_BCL2A1-      attcgaaggggtcctggcc-aagaagctcctccaggagcaggctgttccg
A0A8C8X938_BCL2A1-      gttccagaacaaccacatg-gacatgct------gagactgacgtccccc
M3WHW2_BCL2A1-01        gtttgagggcatcctcatc-aagaagcttctccaggagcggatcgtccca
A0A667HQV5_BCL2A1-      gtttgagggcatcctcatc-aagaagcttctccaggagcggatcgtccca
A0A8C9KZ34_BCL2A1-      gtttgagggcatcctcatc-aagaagcttctccaggagcggatcgtccca
A0A8C8X938_BCL2A1-      gtttgagggcatcctcatc-aagaagcttctccaggagcggatcgtccca
A0A8C9KZ34_BCL2A1-      gtttgagggcatcctcatc-aagaagcttctccaggagcggatcgtccca
A0A8C0WAG3_BCL2A1-      attcggaggagttctcatc-aagaaacttctacgagagcggattgcccca
A0A8C6QF32_BCL2A1-      ttttgggggtgttctcctc-aagaaacttccacaagagcagatggacttg
A0A8C6R201_BCL2A1-      ttttgggggtgttttcctc-aaggaacttccacaagagcagatggacttg
A0A8C6GN16_BCL2A1-      ctttgggggtgttctcctc-aaaaaacttccacaaga-------------
G3V977_BCL2A1-01        ctttgggggtgttctcctg-aaaaagcttccacaagagcagattgccctg
Q925A9_BCL2A1-01        ctttgggggtgttctcctg-aaaaagcttccacaagagcagattggcctg
O55178_BCL2A1-01        ctttgggggtgttctcctcaaaaaaacttccacaagagcagattgccctg
Q0P538_BCL2A1-01        ctttgggggtgttctcctcaaaaaaacttccacaagagcagattgccctg
A0A8C6H5H7_BCL2A1-      ctttgggggtgttctcctc-aaaaaacttccacaagagcagattgccctg
O55179_BCL2A1-01        ctttgggggtgttctcctc-aaaaaacttccacaagagcagattgccctg
Q8K164_BCL2A1-01        ctttgggggtgttctcctc-aaaaaacttccgcaagagcagattgccctg
Q4FK02_BCL2A1-01        ctttgggggtgttctcctc-aaaaaacttccgcaagagcagattgccctg
O55177_BCL2A1-02        ctttgggggtgttctcctc-aaaaaacttccgcaagagcagattgccctg
Q497M6_BCL2A1-01        ctttgggggtgttctcctc-aaaaaacttccgcaagagcagattgccctg
A0A8C2LQI3_BCL2A1-      ctttgggggtgttctcctc-aaaaaacttgcacaagagcagattggcttg
A0A8C8U2B9_BCL2A1-      ctttgggggtgttctcctc-aaaaaactcccacaagagcagattgacatg
A0A8D2B7G1_BCL2A1-      gtttggaggagttctgatc-aagaaacttttgcgagagcacattgcccct
A0A8C5YJP3_BCL2A1-      cttcggaggagttctggtc-aagaaacttctgcgagagcggattgcccct
I3MCZ7_BCL2A1-01        cttcggaggagttctggtc-aagaaacttctgcgagagcggattgcccct
A0A8C9PIV7_BCL2A1-      cttcggaggagttctggtc-aagaaacttctgcgagagaggattgcccct
A0A8D2IK51_BCL2A1-      cttcggaggagttctggtc-aagaaacttctgcgagagcggattgcccct
A0A8C9DF25_BCL2A1-      attcggaggtattctcatc-aagaaacttctacaggagcggactgccctg
A0A2K6EKG1_BCL2A1-      attcggaggtattctcatc-aagaaacttctacgagagcagattgccctg
A0A8C6MJ03_BCL2A1-      ctttgaaggtattcttatc-aagaaacttcagggcaagtgtattgcccca
A0A8B9YDG7_BCL2A1-      ---------------------aggagcggctgcgccag------------
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttacc-aagaaacttctgggcaagtgtattgcctca
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttacc-aagaaacttctgggcaagtgtattgcctca
A0A8B9YDG7_BCL2A1-      ctttgaaggtattcttacc-aagaaacttctgggcaagtgtattgcctca
A0A452EK63_BCL2A1-      ctttgaaggtattcttacc-aagaaacttctgagcaagcgtattgcctca
W5Q0N6_BCL2A1-01        ctttgaaggtattcttacc-aagaaacttctgagcaagcgtattgcctca
A0A671FLY8_BCL2A1-      atttgaaggtattctcatc-aagaaactgcttcgggagcagatcacccca
H0WZ23_BCL2A1-01        ctttggaggtattctcctc-aagaaacttctccaacagcgaattgccctg
F7HXW0_BCL2A1-01        atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
F7HXW0_BCL2A1-02        atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2K6TLG6_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2K6TLG6_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2K6TLG6_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2K5D2I1_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2K5D2I1_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgagagcgaattgccccg
A0A2I3GQS0_BCL2A1-      atttgaaggtattctcgtc-aagaaacttctacgacagcgaactgccccg
A0A2I3GQS0_BCL2A1-      atttgaaggtattctcgtc-aagaaacttctacgacagcgaactgccccg
A0A2I3GQS0_BCL2A1-      atttgaaggtattctcgtc-aagaaacttctacgacagcgaactgccccg
A0A2K5KAA3_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A8D2E7F6_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A8C9HCC9_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K6AD27_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A0D9RRC3_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K6LV19_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2K6PHF2_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2K5KHH8_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K6DS18_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K5KHH8_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K5TMD1_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
F7E8V5_BCL2A1-01        atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K5KAA3_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K6LV19_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2K6PHF2_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2K6AD27_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K5KHH8_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K5TMD1_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
A0A2K6DS18_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcgaattgccccg
H2NNZ9_BCL2A1-01        atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
B4E1X9_BCL2A1-03        atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2R8ZJ66_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcagattgccccg
A0A2R8ZJ66_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcagattgccccg
B4E1X9_BCL2A1-02        atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2I2YJV4_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2I2YJV4_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
A0A2R8ZJ66_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcagattgccccg
A0A2I2YJV4_BCL2A1-      atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
B4E1X9_BCL2A1-01        atttgaaggtattctcatc-aagaaacttctacgacagcaaattgccccg
G3T8E6_BCL2A1-01        atttggaggtattctcatc-aagaaacttctaagggagcgaattgcccca
A0A8C3WEA1_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcaaattgcctca
A0A8D1BRF8_BCL2A1-      ctcttaa---------------------------------------ccca
A0A8D0Z1Y4_BCL2A1-      ctcttaa---------------------------------------ccca
A0A8D1SK15_BCL2A1-      ctcttaa---------------------------------------ccca
A0A4X1UP21_BCL2A1-      ctcttaa---------------------------------------ccca
A0A8D1BRF8_BCL2A1-      ctcttaa---------------------------------------ccca
A0A8D1YBS8_BCL2A1-      ctcttaa---------------------------------------ccca
A0A4X1UP21_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A4X1UQW5_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D0Z1Y4_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1BRF8_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1SK15_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1YBS8_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
C7F841_BCL2A1-01        atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1KPD1_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1BRF8_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A4X1UP21_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1SK15_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D0Z1Y4_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8D1YBS8_BCL2A1-      atttgaaggtattctcatg-aagaaacttctgcgaaagcgaattgcccca
A0A8C0CSU7_BCL2A1-      atttgaaggtattctcatc-aagaaacttctaggagagcgaattgcccca
A0A8C6FDW6_BCL2A1-      atttgaaggcattctcatc-aagaaacttctaggagggcgaattgcccca
A0A8C9BC20_BCL2A1-      atttgaaggcattctcatc-aagaaacttctaggagggcgaattgcccca
A0A5F5PK00_BCL2A1-      atttgaaggtattctcatc-aagaaacttctaccagagcgaattgcccca
A0A8C4PQL1_BCL2A1-      atttgaaggtattctcatc-aagaaacttctaccagagcgaattgcccca
A0A5F5PK00_BCL2A1-      atttgaaggtattctcatc-aagaaacttctaccagagcgaattgcccca
A0A5F5PK00_BCL2A1-      tgtgagtggtgct-------aagcggcgcctg-cgggccgagctg-----
A0A5F5PK00_BCL2A1-      atttgaaggtattctcatc-aagaaacttctaccagagcgaattgcccca
A0A5F5PK00_BCL2A1-      ----gactgtattctcatc-aagaaacttctaccagagcgaattgcccca
                                                                          

A0A673TDC6_BCL2A1-      gacgtg-gacgcgcggacgg---tctcccacttcgtcgccgagttcgtcg
A0A8B9S513_BCL2A1-      acagga-gaggagaaggagcagatttcttatttcatcacagagtacatca
A0A8C6ZVQ3_BCL2A1-      actgga-gaggagaaggagcagatttcttacttcatcacagagtacatca
A0A8C5X4L3_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
H0ZCL9_BCL2A1-01        actgca-gaggagaaggagcagatttcttatttcatcacggagtacatca
A0A8C5J3C4_BCL2A1-      actgca-gaggagaaggagcagatctcttatttcatcacagagtacatca
A0A8D2QAC0_BCL2A1-      actgca-gaggagaaggagcagatctcttatttcatcacagagtacatca
A0A8C9MQN0_BCL2A1-      actgca-gaggagaaggagcagatctcttatttcatcacagagtacatca
A0A8C3NVU4_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A8D2PM01_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A8C0UPM3_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A8C0UPM3_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A8C3U920_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A803V184_BCL2A1-      actgca-gaggagaaggaggagatctcttatttcatcacagagtacatca
A0A8C2UCW6_BCL2A1-      accgga-gaggagaaggagcagatttcttatttcatcacagagtacatca
G1N8C5_BCL2A1-01        actgga-gaggagaaggagcagatttcttatttcatcacagagtacatca
A0A8C3KTI3_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacatca
A0A669PVQ4_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacatca
A0A8B9CVY0_BCL2A1-      actgga-gaggagaaggagcagatctcttatttcattacagagtacatca
A0A8B9E009_BCL2A1-      actgga-gaggagaaggagcagatctcttatttcattacagagtacatca
A0A8C3BNR4_BCL2A1-      actgga-gagaagaaggagcagatctcttatttcatcacagagtacatca
A0A493SSZ7_BCL2A1-      actgga-gagaagaaggagcagatctcttatttcatcacagagtacatca
A0A8B9UZT1_BCL2A1-      actgga-gagaagaaggagcagatctcttatttcatcacagagtacatca
A0A8C3K1C5_BCL2A1-      actgga-gaggagaaagagcagatttcttatttcatcacagagtacataa
A0A8B9FJB5_BCL2A1-      actgga-gaggaaaaggagcagatttcgtatttcatcacagagtacatca
A0A672UHF9_BCL2A1-      actgga-gaggaaaaggagcagatttcttatttcatcacagagtacataa
A0A8C4U5U5_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A8B9Z3D5_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A8B9RZD1_BCL2A1-      actgga-gaagagaaggagcagatttcttatttcatcacagagtacataa
A0A663E5S6_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A8C8AIP7_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A663N622_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A8C0EQC0_BCL2A1-      actgga-gaggagaaggagcagatttcttacttcatcacagagtacataa
A0A8D0ELW8_BCL2A1-      actgga-gaggagaaggagcagatttcttatttcatcacagagtacataa
A0A8D0EB90_BCL2A1-      acaaaa-gaaaatacaagagagatttctcacttcattgcagactatatca
A0A7M4FFQ8_BCL2A1-      acagga-gaaaataaagagcagatttcatatttcatcacagagtacatca
A0A8C8SUC3_BCL2A1-      accgaa-gataataaagagcagatttcttatttcatcacagactatatta
K7G130_BCL2A1-01        acagga-gataataaagagcagatttcttatttcatcacggagtacatta
A0A8C3FIW3_BCL2A1-      acagga-gataataaagagcagatttcttatttcatcaccgagtacatta
A0A8C0G393_BCL2A1-      acagga-gaaaataaaaagcagatttcttatttcatcacggagtacatta
A0A452J3N6_BCL2A1-      acagga-gaaaataaaaagcagatttcttatttcatcacagagtacatta
A0A8C4W4P8_BCL2A1-      acagga-gaaaataaaaagcagatttcttatttcatcacagagtacatta
A0A8C3RME9_BCL2A1-      acaggg-gataataaagagcagatttcttatttcatcacggagtacatta
A0A674K8Q6_BCL2A1-      acagga-gataataaagagcagatttcttatttcatcacggagtacatta
A0A8C6VPU0_BCL2A1-      gcaaaa-gaaaacttgaaacagatctcttatttcgtcacagactacattg
A0A8C5SDG4_BCL2A1-      gcaaaa-gaaaacttgaagcagatctcttatttcatcacagactatattg
A0A670YDS2_BCL2A1-      gcaaaa-gaaaacttgaaacagatctcctatttcatcacagactatattg
A0A8D0H8G3_BCL2A1-      actggt-gaaatggaagagcagatttcttgcttcatcactgaatacatca
A0A8D2Q8F9_BCL2A1-      acagca-gaaaacacagagcagctttcttgttttattacagactatattg
A0A670JXJ0_BCL2A1-      ------------------------tcgcggct------------------
A0A670JXJ0_BCL2A1-      acaaga-gaaaacgtggaaccgatttgccactgtgtcactgaat---tta
A0A670JXJ0_BCL2A1-      acaaga-gaaaacgtggaaccgatttgccactgtgtcactgaat---tta
F6S8G3_BCL2A1-01        gacgagagagactcgggaggagatttcttgtttcatcgcggagttcacca
A0A8C5VB12_BCL2A1-      gacccg-gacgcgtgcaagcagatttctcacctcatcgccgagttcgtag
A0A286XUI2_BCL2A1-      gatgtg-gacacttacaaggagatttcctacttcgtggctgagttcataa
A0A8C2UN30_BCL2A1-      gatgtg-gacacttacagggagatttctcactttgtggctgagttcgtag
A0A8C5L8K1_BCL2A1-      gatgtg-gacactaatgagcagatttcttcttttgtggctgaattcataa
F6SFL4_BCL2A1-01        actatg-ggcactcaggaagaaatttctcattttattgccgagttcataa
A0A4X2KFL7_BCL2A1-      actatg-agtactcatgaagaagtttcttattttattgctgagttcataa
A0A7N4P573_BCL2A1-      -----------------aaaacat-----gttttatccctcgatacaaat
A0A7N4P573_BCL2A1-      actatg-gacactcatgaagaaatttctcattttattgctgagttcataa
A0A7N4P573_BCL2A1-      actatg-gacactcatgaagaaatttctcattttattgctgagttcataa
A0A7N4P573_BCL2A1-      actatg-gacactcatgaagaaatttctcattttattgctgagttcataa
A0A8C0KQ53_BCL2A1-      gatgtg-gatgccgagaagg---tttcctacttcgtggcagagttcatca
A0A8C0MTY3_BCL2A1-      gatgtg-gatgccgagaagg---tttcctacttcgtggcagagttcatca
A0A8I3MYG9_BCL2A1-      gatgtg-gatgccgagaagg---tttcctacttcgtggcagagttcatca
M3YVH4_BCL2A1-01        gacgtg-gatgcttccaggg---tttcttactttgtggcagagttcatca
U6CQS8_BCL2A1-01        gacgtg-gatgcttccaggg---tttcttactttgtggcagagttcatca
A0A452U285_BCL2A1-      gatgtg-gacgcttctagga---tttcttacttcgtggcggagttcatca
G1LIJ8_BCL2A1-01        gatgtg-gacgcttctagga---tttcttacttcgtggcggagttcatca
A0A452SIR9_BCL2A1-      gatgtg-gacgcttctagga---tttcttacttcgtggcagagttcatca
A0A452U285_BCL2A1-      gatgtg-gacgcttctagga---tttcttacttcgtggcggagttcatca
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gatgtg-gacacgttcaagtccatcccttattttgtggctgagttcataa
A0A5F9CXI7_BCL2A1-      gatgtg-gacacgttcaagtccatcccttattttgtggctgagttcataa
A0A8C8X938_BCL2A1-      gacg------------aaat---ttcgttactt-----cccaggacgtcc
M3WHW2_BCL2A1-01        gacgcg-gatgcgtttaagg---tttcctactttgtcgccgagttcatca
A0A667HQV5_BCL2A1-      gacgcg-gatgcgtttaagg---tttcctactttgtcgccgagttcatca
A0A8C9KZ34_BCL2A1-      gacgcg-gatgcgttcaagg---tttcctacttcgttgccgagttcatca
A0A8C8X938_BCL2A1-      gacgcg-gatgcgttcaagg---tttcctacttcgttgccgagttcatca
A0A8C9KZ34_BCL2A1-      gacgcg-gatgcgttcaagg---tttcctacttcgttgccgagttcatca
A0A8C0WAG3_BCL2A1-      gatgtg-gatacttacatggagatttcttactttgtggctgagttcatag
A0A8C6QF32_BCL2A1-      gatgtg-gatacttacaagcaagtttcttattttgtggctgaattcataa
A0A8C6R201_BCL2A1-      gatgtg-gatacctacaagcaagtttcttgttttgtggctgaattcataa
A0A8C6GN16_BCL2A1-      ------------------------------ttttctggcagaattcataa
G3V977_BCL2A1-01        gatgtg-gatacttacaagcaagtttccagttttgtggcggaattcataa
Q925A9_BCL2A1-01        gatgtg-gatacttacaagcaagtttccagttttgtggcggaattcataa
O55178_BCL2A1-01        gatgta-cgtgcttacaaacaagtttccagttttggggcagaattcataa
Q0P538_BCL2A1-01        gatgta-cgtgcttacaaacaagtttccagttttggggcagaattcatca
A0A8C6H5H7_BCL2A1-      gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
O55179_BCL2A1-01        gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
Q8K164_BCL2A1-01        gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
Q4FK02_BCL2A1-01        gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
O55177_BCL2A1-02        gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
Q497M6_BCL2A1-01        gatgta-ggtgcttacaaacaagtttccagttttgtggcagaattcataa
A0A8C2LQI3_BCL2A1-      gatgtg-ggtgcttacaagcaagtttccaattttgtggctgaattcataa
A0A8C8U2B9_BCL2A1-      gatgca-gatgcttacaagcaagtttccagttttgtggctgaattcataa
A0A8D2B7G1_BCL2A1-      actgtg-gattctgaggaggagatctcttactttgtggctgagttcatta
A0A8C5YJP3_BCL2A1-      gctgtg-gattccgacgtggagatctcttactttgtggctgagttcatta
I3MCZ7_BCL2A1-01        gctgtg-gattccgatgaggagatctcttactttgtggctgagttcatta
A0A8C9PIV7_BCL2A1-      gctgtg-gattccgacgaggggatctcttactttgtggctgagttcatta
A0A8D2IK51_BCL2A1-      gctgtg-gattccgacgaggagatctcttactttgtggctgagttcatta
A0A8C9DF25_BCL2A1-      gatgtg-gatacttacaaggagatttcttattttattgctgagttcataa
A0A2K6EKG1_BCL2A1-      gatgtg-gatacttacaaggagatttcttattttattgctgagttcataa
A0A8C6MJ03_BCL2A1-      gacatg-gacatgtgcaaggacatttcttactttgtggcagagttcatca
A0A8B9YDG7_BCL2A1-      -------------------------tcccacctcttggc-----------
A0A8B9YDG7_BCL2A1-      gacatg-gacatgtgcaaggacatttcttactttgtggcggagttcatca
A0A8B9YDG7_BCL2A1-      gacatg-gacatgtgcaaggacatttcttactttgtggcggagttcatca
A0A8B9YDG7_BCL2A1-      gacatg-gacatgtgcaaggacatttcttactttgtggcggagttcatca
A0A452EK63_BCL2A1-      gacatg-gacatgtgcaaggacatttcttatttcgtggcggagtttatca
W5Q0N6_BCL2A1-01        gacatg-gacatgtgcaaggacatttcttatttcgtggcggagttcatca
A0A671FLY8_BCL2A1-      gatgtg-gatacttacaaggacatttcttactttgttgctgacttcataa
H0WZ23_BCL2A1-01        gatgtg-gatacttataaggagatttcttattttgttgctgagttcataa
F7HXW0_BCL2A1-01        gatgtg-gatacttacaaggagatctcacattttgttgctgagttcataa
F7HXW0_BCL2A1-02        gatgtg-gatacttacaaggagatctcacattttgttgctgagttcataa
A0A2K6TLG6_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgctgagttcataa
A0A2K6TLG6_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgctgagttcataa
A0A2K6TLG6_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgctgagttcataa
A0A2K5D2I1_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgctgagttcataa
A0A2K5D2I1_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgctgagttcataa
A0A2I3GQS0_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgcagagttcataa
A0A2I3GQS0_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgcagagttcataa
A0A2I3GQS0_BCL2A1-      gatgtg-gatacttacaaggagatttcgtattttgttgcagagttcataa
A0A2K5KAA3_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A8D2E7F6_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgctgagttcataa
A0A8C9HCC9_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6AD27_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A0D9RRC3_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6LV19_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6PHF2_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5KHH8_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6DS18_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5KHH8_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5TMD1_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
F7E8V5_BCL2A1-01        gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5KAA3_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6LV19_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6PHF2_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6AD27_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5KHH8_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K5TMD1_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
A0A2K6DS18_BCL2A1-      gatgtg-gatacttataaggagatttcgtattttgttgctgagttcataa
H2NNZ9_BCL2A1-01        gatgtg-gatacttacaaggagatttcatattttgttgcggagttcgtca
B4E1X9_BCL2A1-03        gatgtg-gatacctataaggagatttcatattttgttgcggagttcataa
A0A2R8ZJ66_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
A0A2R8ZJ66_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
B4E1X9_BCL2A1-02        gatgtg-gatacctataaggagatttcatattttgttgcggagttcataa
A0A2I2YJV4_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
A0A2I2YJV4_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
A0A2R8ZJ66_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
A0A2I2YJV4_BCL2A1-      gatgtg-gatacttataaggagatttcatattttgttgcggagttcataa
B4E1X9_BCL2A1-01        gatgtg-gatacctataaggagatttcatattttgttgcggagttcataa
G3T8E6_BCL2A1-01        gatgtg-gatacttacaagaagatttcttcttttgttgctgagttcatag
A0A8C3WEA1_BCL2A1-      gatgtg-gacacttacaaggagattccttactttgtcgcggagttcatca
A0A8D1BRF8_BCL2A1-      ga------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      ga------------------------------------------------
A0A8D1SK15_BCL2A1-      ga------------------------------------------------
A0A4X1UP21_BCL2A1-      ga------------------------------------------------
A0A8D1BRF8_BCL2A1-      ga------------------------------------------------
A0A8D1YBS8_BCL2A1-      ga------------------------------------------------
A0A4X1UP21_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A4X1UQW5_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D0Z1Y4_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1BRF8_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1SK15_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1YBS8_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
C7F841_BCL2A1-01        gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1KPD1_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1BRF8_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A4X1UP21_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1SK15_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D0Z1Y4_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8D1YBS8_BCL2A1-      gatgtg-gacacgtacaaggagatttcttactttgtcgccgagttcatca
A0A8C0CSU7_BCL2A1-      gatgtg-gacacttacaaggagatttcttactttgttgcagagttcataa
A0A8C6FDW6_BCL2A1-      gatgtg-gacacttacaaggagatttcctactttgttgcagagttcataa
A0A8C9BC20_BCL2A1-      gatgtg-gacacttacaaggagatttcttactttgttgcagagttcataa
A0A5F5PK00_BCL2A1-      gatgtg-gatacttacaaggagatttcttactttgttgctgagttcataa
A0A8C4PQL1_BCL2A1-      gatgtg-gatacttacaaggagatttcttactttgttgctgagttcataa
A0A5F5PK00_BCL2A1-      gatgtg-gatacttacaaggagatttcttactttgttgctgagttcataa
A0A5F5PK00_BCL2A1-      ----------------aagcagcgt-------------ctgcg-----gg
A0A5F5PK00_BCL2A1-      gatgtg-gatacttacaaggagatttcttactttgttgctgagttcataa
A0A5F5PK00_BCL2A1-      gatgtg-gatacttacaaggagatttcttactttgttgctgagttcataa
                                                                          

A0A673TDC6_BCL2A1-      tgaggcacacaggggagtggatccggcagaacggaggct-----------
A0A8B9S513_BCL2A1-      taaacaacaaagctgaatggatagatgcaaacggtggct-----------
A0A8C6ZVQ3_BCL2A1-      taaataacaaagctgagtggatagatgcgaatggtggct-----------
A0A8C5X4L3_BCL2A1-      taaacaacaaagctgaatggattgatgcgaacggtggct-----------
H0ZCL9_BCL2A1-01        taaacaacaaagctgaatggattgatgcgaatggtggct-----------
A0A8C5J3C4_BCL2A1-      taaacaacaaagccgattggattgatgcgaatggtggct-----------
A0A8D2QAC0_BCL2A1-      taaacaacaaagccgactggattgatgcgaatggtggct-----------
A0A8C9MQN0_BCL2A1-      taaacaacaaagccgaatggattgatgcgaatggtggct-----------
A0A8C3NVU4_BCL2A1-      taaacaacaaatctgaatggattgatgcaaacggtggct-----------
A0A8D2PM01_BCL2A1-      taaacaacaaatctgaatggattgatgccaatggtggct-----------
A0A8C0UPM3_BCL2A1-      taaacaacaaagctgaatggattgatgcaaatggtggct-----------
A0A8C0UPM3_BCL2A1-      taaacaacaaagctgaatggattgatgcaaatggtggct-----------
A0A8C3U920_BCL2A1-      tcaacaacaaatccgaatggattggtgcaaatggtggct-----------
A0A803V184_BCL2A1-      tcaacaacaaatccgaatggattgatgcaaatggtggct-----------
A0A8C2UCW6_BCL2A1-      taaacaacaaagccgcgtggatagatgcaaacggtggct-----------
G1N8C5_BCL2A1-01        taaataacaaagccgcatggatagatgcaaacggtggct-----------
A0A8C3KTI3_BCL2A1-      taaataacaaagccgcatggatagatgcaaacggtggct-----------
A0A669PVQ4_BCL2A1-      taaataacaaagccgcatggatagatgcaaacggtggct-----------
A0A8B9CVY0_BCL2A1-      taaacaacaaagccgaatggatagatgcaaatggtggct-----------
A0A8B9E009_BCL2A1-      taaacaacaaagccgaatggatagatgcaaatggtggct-----------
A0A8C3BNR4_BCL2A1-      taaacaacaaagccgaatggatagatgcaaatggtggct-----------
A0A493SSZ7_BCL2A1-      taaacaataaagccgaatggatagatgcaaatggtggct-----------
A0A8B9UZT1_BCL2A1-      taaacaacaaagccgaatggatagatgcaaatggtggct-----------
A0A8C3K1C5_BCL2A1-      tgaacaacaaagccgaatggatagatgcgaatggtggct-----------
A0A8B9FJB5_BCL2A1-      taaacaataaagccgaatggatagatgcaaacggtggct-----------
A0A672UHF9_BCL2A1-      taaacaacaaagccgaatggatagatgcaaatggtggct-----------
A0A8C4U5U5_BCL2A1-      taaacaacaaagctgaatggatagatgcgaacggtggct-----------
A0A8B9Z3D5_BCL2A1-      taaacaacaaagccgaatggatagatgcgaatggtggct-----------
A0A8B9RZD1_BCL2A1-      taaacaacaaagccgaatggatagatgcgaatggtggct-----------
A0A663E5S6_BCL2A1-      taaacaacaaagccgaatggatagatgcgaatggtggct-----------
A0A8C8AIP7_BCL2A1-      taaacaacaaagctgaatggatagatgcaaacggtggct-----------
A0A663N622_BCL2A1-      taaacaacaaagccgaatggatagatgcaaacggtggct-----------
A0A8C0EQC0_BCL2A1-      taaacaacaaagccgaatggatagatgcaaacggtggct-----------
A0A8D0ELW8_BCL2A1-      taaacaacaaagccgaatggatagatgcaaacggtggct-----------
A0A8D0EB90_BCL2A1-      ttaatactaaagcaaagtggatccatgaaaatggaggat-----------
A0A7M4FFQ8_BCL2A1-      tgaacaacaaggctgaatggatagaggcaaatggaggtt-----------
A0A8C8SUC3_BCL2A1-      taaacaacaaggctgagtggatagaggcaaatggaggtt-----------
K7G130_BCL2A1-01        taaacaccaaggctgaatggatagatgcaaatggaggct-----------
A0A8C3FIW3_BCL2A1-      taaacaacaaggctgagtggatagaggcaaatggaggtt-----------
A0A8C0G393_BCL2A1-      taaacaccaaggctgagtggatagaggcaaatggaggtt-----------
A0A452J3N6_BCL2A1-      taaacaccaaggctgagtggatagaggcaaatggaggtt-----------
A0A8C4W4P8_BCL2A1-      taaacaccaaggctgagtggatagaggcaaatggaggtt-----------
A0A8C3RME9_BCL2A1-      taaacaacaaagctgagtggatagaggcaaatggaggtt-----------
A0A674K8Q6_BCL2A1-      taaacaacaaggctgagtggatagaggcaaatggaggtt-----------
A0A8C6VPU0_BCL2A1-      tgagcaccaaaggaaagtggatcagtgagaatggaggat-----------
A0A8C5SDG4_BCL2A1-      tgagcaccaaaggaaagtggatcagtgagaatggaggat-----------
A0A670YDS2_BCL2A1-      tgagcaccaaaggaaagtggatcagtgagaatggaggat-----------
A0A8D0H8G3_BCL2A1-      taaggaccaaagctgactggatagaagagaacggaggct-----------
A0A8D2Q8F9_BCL2A1-      taaacaccaaagctaagtggatcaatgaaaatggaggat-----------
A0A670JXJ0_BCL2A1-      ---------------cgtg-------------cgcggca-----------
A0A670JXJ0_BCL2A1-      taaacaccaaagctacgtggatcagcgaaaatggaggct-----------
A0A670JXJ0_BCL2A1-      taaacaccaaagctacgtggatcagcgaaaatggaggct-----------
F6S8G3_BCL2A1-01        cccaccacgccggagagtggataaggcagaacggaggct-----------
A0A8C5VB12_BCL2A1-      tgagccacacgggagagtggattcggcagaacggaggct-----------
A0A286XUI2_BCL2A1-      tgagccgcatgggaggctggatacggcagaacggaggct-----------
A0A8C2UN30_BCL2A1-      tgaaccacacgggagactggatccggcagaacggaggct-----------
A0A8C5L8K1_BCL2A1-      cgaataacacaggagaatggatacggcagaacggaggct-----------
F6SFL4_BCL2A1-01        tgaacaatatagcagagtggataagacaaaatggaggat-----------
A0A4X2KFL7_BCL2A1-      tgaacaacatagcagagtggataagacaaaacggaggat-----------
A0A7N4P573_BCL2A1-      tcaata--gtaactacatggatatggtcaggt------------------
A0A7N4P573_BCL2A1-      tgaacaacatagcagaatggataagacaaaatggaggat-----------
A0A7N4P573_BCL2A1-      tgaacaacatagcagaatggataagacaaaatggaggatgggtgattgct
A0A7N4P573_BCL2A1-      tgaacaacatagcagaatggataagacaaaatggaggatg----------
A0A8C0KQ53_BCL2A1-      cgagaaacatgagagactggataagacaaaacggaggct-----------
A0A8C0MTY3_BCL2A1-      cgagaaacatgagagactggataagacaaaacggaggct-----------
A0A8I3MYG9_BCL2A1-      cgagaaacatgagagactggataagacaaaacggaggct-----------
M3YVH4_BCL2A1-01        cgacaaacatgagggagtggataagacagaacggaggct-----------
U6CQS8_BCL2A1-01        cgacaaacatgagggagtggataagacaaaacggaggct-----------
A0A452U285_BCL2A1-      cgacaaacatgagagagtggataaggcagaacggaggct-----------
G1LIJ8_BCL2A1-01        cgacaaacatgagagagtggataaggcagaacggaggct-----------
A0A452SIR9_BCL2A1-      cgacaaacatgagagagtggataaggcagaacggaggct-----------
A0A452U285_BCL2A1-      cgacaaacatgagagagtggataaggcagaacggaggct-----------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      cgaggaggatgggagaatggataaggcaaaacggaggct-----------
A0A5F9CXI7_BCL2A1-      cgaggaggatgggagaatggataaggcaaaacggaggct-----------
A0A8C8X938_BCL2A1-      tggaatatccttcagcctggag-----aggatgaggtcc-----------
M3WHW2_BCL2A1-01        cgaaacacacgggagaatggatccggcaaaacggaggct-----------
A0A667HQV5_BCL2A1-      cgaaacacacgggagaatggatccggcaaaacggaggct-----------
A0A8C9KZ34_BCL2A1-      cgaaacacacgggagaatggatccggcaaaacggaggct-----------
A0A8C8X938_BCL2A1-      cgaaacacacgggagaatggatccggcaaaacggaggct-----------
A0A8C9KZ34_BCL2A1-      cgaaacacacgggagaatggatccggcaaaacggaggct-----------
A0A8C0WAG3_BCL2A1-      tgaataacacaggagaatggataaagcaaaacggaggct-----------
A0A8C6QF32_BCL2A1-      tgaataacacaggagaatggatacgtcaaaatggaggtt-----------
A0A8C6R201_BCL2A1-      agaataacacaggagaatggatacgtcaaaatggaggtt-----------
A0A8C6GN16_BCL2A1-      tgaataacacaggagaatggatatggcaggatggagact-----------
G3V977_BCL2A1-01        tgaataacacaggagaatggatacagcagaatggaggct-----------
Q925A9_BCL2A1-01        tgaataacacaggagaatggatacagcagaatggaggct-----------
O55178_BCL2A1-01        tgaataa-------------------------------------------
Q0P538_BCL2A1-01        tgaataa-------------------------------------------
A0A8C6H5H7_BCL2A1-      tgaataacacaggagaatggatacggcggaatggaggtt-----------
O55179_BCL2A1-01        tgaataacacaggagaatggatacggcggaatggaggtt-----------
Q8K164_BCL2A1-01        tcaataacacaggagaatggatacggcggaatggaggtt-----------
Q4FK02_BCL2A1-01        tcaataacacaggagaatggatacggcggaatggaggtt-----------
O55177_BCL2A1-02        tcaataacacaggagaatggatacggcggaatggaggtt-----------
Q497M6_BCL2A1-01        tcaataacacaggagaatggatacggcggaatggaggtt-----------
A0A8C2LQI3_BCL2A1-      tgaataacacagcagagtggatacgtcagaatggaggct-----------
A0A8C8U2B9_BCL2A1-      tgaataacacaggagaatggatacggcagaatggaggct-----------
A0A8D2B7G1_BCL2A1-      tgaataatgcaggagaatggataaggcaaaacggaggct-----------
A0A8C5YJP3_BCL2A1-      tgaataatgcaggagaatggataaggcaaaatggaggct-----------
I3MCZ7_BCL2A1-01        tgaataatgcaggagaatggataaggcaaaatggaggct-----------
A0A8C9PIV7_BCL2A1-      tgaataatgcaggagaatggataaggcaaaatggaggct-----------
A0A8D2IK51_BCL2A1-      tgaataatgcaggagaatggataaggcaaaatggaggct-----------
A0A8C9DF25_BCL2A1-      tgaataacacaggagaatggatacggcaaaacggaggct-----------
A0A2K6EKG1_BCL2A1-      cgaataacgcaggagagtggatacggcagaacggaggct-----------
A0A8C6MJ03_BCL2A1-      ccgaaaacacaggagagtggataaggcaaaatggaggct-----------
A0A8B9YDG7_BCL2A1-      ccagaa--------------------------------------------
A0A8B9YDG7_BCL2A1-      ccgaaaatacaggagagtggataaagcaaaatggaggct-----------
A0A8B9YDG7_BCL2A1-      ccgaaaatacaggagagtggataaagcaaaatggaggct-----------
A0A8B9YDG7_BCL2A1-      ccgaaaatacaggagagtggataaagcaaaatggaggct-----------
A0A452EK63_BCL2A1-      ccgaaaacacaggagagtggataaggcaaaacggaggct-----------
W5Q0N6_BCL2A1-01        ccaaaaacacaggagagtggataaggcaaaacggaggct-----------
A0A671FLY8_BCL2A1-      cggaacacacaggagaatggataaggcagaacggaggct-----------
H0WZ23_BCL2A1-01        tgaattacacaggagaatggataaggcaaaatggaggct-----------
F7HXW0_BCL2A1-01        tgaataacacaggagaatggataagacaaaacggaggct-----------
F7HXW0_BCL2A1-02        tgaataacacaggagaatggataagacaaaacggaggctg----------
A0A2K6TLG6_BCL2A1-      tgaataacacaggagaatggataagacgaaacggaggctg----------
A0A2K6TLG6_BCL2A1-      tgaataacacaggagaatggataagacgaaacggaggctg----------
A0A2K6TLG6_BCL2A1-      tgaataacacaggagaatggataagacgaaacggaggctg----------
A0A2K5D2I1_BCL2A1-      tgaataacacaggagaatggataagtcaaaacggaggctg----------
A0A2K5D2I1_BCL2A1-      tgaataacacaggagaatggataagtcaaaacggaggctg----------
A0A2I3GQS0_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2I3GQS0_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2I3GQS0_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K5KAA3_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A8D2E7F6_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A8C9HCC9_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K6AD27_BCL2A1-      tgaataacactggagaatggataaggcaaaacggaggct-----------
A0A0D9RRC3_BCL2A1-      cgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K6LV19_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K6PHF2_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K5KHH8_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K6DS18_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K5KHH8_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K5TMD1_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
F7E8V5_BCL2A1-01        tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2K5KAA3_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2K6LV19_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2K6PHF2_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2K6AD27_BCL2A1-      tgaataacactggagaatggataaggcaaaacggaggctg----------
A0A2K5KHH8_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2K5TMD1_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
A0A2K6DS18_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
H2NNZ9_BCL2A1-01        tgaataacacaggaggatggataaagcaaaacggaggctg----------
B4E1X9_BCL2A1-03        tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2R8ZJ66_BCL2A1-      tgaataacacaggagaatggataagacaaaacggaggct-----------
A0A2R8ZJ66_BCL2A1-      tgaataacacaggagaatggataagacaaaacggaggct-----------
B4E1X9_BCL2A1-02        tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2I2YJV4_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2I2YJV4_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggct-----------
A0A2R8ZJ66_BCL2A1-      tgaataacacaggagaatggataagacaaaacggaggctg----------
A0A2I2YJV4_BCL2A1-      tgaataacacaggagaatggataaggcaaaacggaggctg----------
B4E1X9_BCL2A1-01        tgaataacacaggagaatggataaggcaaaacggaggctg----------
G3T8E6_BCL2A1-01        tggataacacagcagagtggataaggcaaaacggaggct-----------
A0A8C3WEA1_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A4X1UQW5_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D0Z1Y4_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1BRF8_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1SK15_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1YBS8_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
C7F841_BCL2A1-01        ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1KPD1_BCL2A1-      ccaaaaacacaggagagtggataaggcaaaacggaggct-----------
A0A8D1BRF8_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A4X1UP21_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1SK15_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D0Z1Y4_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8D1YBS8_BCL2A1-      ccaaaaacacaggacagtggataaggcaaaacggaggct-----------
A0A8C0CSU7_BCL2A1-      ccaaaaacacaggagaatggataaggcagaacggaggct-----------
A0A8C6FDW6_BCL2A1-      ccaaaaacacaggagaatggataaggcagaatggaggct-----------
A0A8C9BC20_BCL2A1-      ccaaaaacacaggagaatggataaggcagaatggaggct-----------
A0A5F5PK00_BCL2A1-      cgaaaaacacaggagaatggataaggcaaaatggaggct-----------
A0A8C4PQL1_BCL2A1-      cgaaaaacacaggagaatggataaggcaaaatggaggct-----------
A0A5F5PK00_BCL2A1-      cgaaaaacacaggagaatggataaggcaaaatggaggct-----------
A0A5F5PK00_BCL2A1-      cgatgagcgccgaggaacggctacgccagtctcgcctcttgactcaga--
A0A5F5PK00_BCL2A1-      cgaaaaacacaggagaatggataaggcaaaatggaggct-----------
A0A5F5PK00_BCL2A1-      cgaaaaacacaggagaatggataaggcaaaatggaggct-----------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      cacagtaaatatcaagagtctcagagaatttcaatctttctaagcatgca
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      ggatgaaattgagacagaagaaattatcaaggatatttttaaacaaggca
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      aaacatgttttatccctcgatacaaattcaatagtaactacatggatatg
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      -------tattttcagctgaagaaattttttcacttcccaaaacatcctg
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      gtcaggttattttcagctgaagaaattttttcacttcccaaaacatcctg
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      gaacattcatcagcctggtgatgatgaagtacgggaggaggctttgtcta
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      gaacattcatcagcctggtgatgatgaagtacgggaggaggctttgtcta
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --ggg------------tg-------------------------------
A0A8B9S513_BCL2A1-      --ggg------------aa-------------------------------
A0A8C6ZVQ3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C5X4L3_BCL2A1-      --ggg------------aa-------------------------------
H0ZCL9_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C5J3C4_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2QAC0_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9MQN0_BCL2A1-      --ggg------------aa-------------------------------
A0A8C3NVU4_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2PM01_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0UPM3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0UPM3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C3U920_BCL2A1-      --ggg------------aa-------------------------------
A0A803V184_BCL2A1-      --ggg------------aa-------------------------------
A0A8C2UCW6_BCL2A1-      --ggg------------aa-------------------------------
G1N8C5_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C3KTI3_BCL2A1-      --ggg------------aa-------------------------------
A0A669PVQ4_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9CVY0_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9E009_BCL2A1-      --ggg------------aa-------------------------------
A0A8C3BNR4_BCL2A1-      --ggg------------aa-------------------------------
A0A493SSZ7_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9UZT1_BCL2A1-      --ggg------------aa-------------------------------
A0A8C3K1C5_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9FJB5_BCL2A1-      --ggg------------aa-------------------------------
A0A672UHF9_BCL2A1-      --ggg------------aa-------------------------------
A0A8C4U5U5_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9Z3D5_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9RZD1_BCL2A1-      --ggg------------aa-------------------------------
A0A663E5S6_BCL2A1-      --ggg------------aa-------------------------------
A0A8C8AIP7_BCL2A1-      --ggg------------aa-------------------------------
A0A663N622_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0EQC0_BCL2A1-      --ggg------------aa-------------------------------
A0A8D0ELW8_BCL2A1-      --ggg------------aa-------------------------------
A0A8D0EB90_BCL2A1-      --ggg------------ta-------------------------------
A0A7M4FFQ8_BCL2A1-      --ggg------------aa-------------------------------
A0A8C8SUC3_BCL2A1-      --ggg------------tg-------------------------------
K7G130_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C3FIW3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0G393_BCL2A1-      --ggg------------aa-------------------------------
A0A452J3N6_BCL2A1-      --ggg------------aa-------------------------------
A0A8C4W4P8_BCL2A1-      --ggg------------ta-------------------------------
A0A8C3RME9_BCL2A1-      --ggg------------ta-------------------------------
A0A674K8Q6_BCL2A1-      --ggg------------ta-------------------------------
A0A8C6VPU0_BCL2A1-      --ggg------------ac-------------------------------
A0A8C5SDG4_BCL2A1-      --ggg------------ac-------------------------------
A0A670YDS2_BCL2A1-      --ggg------------ac-------------------------------
A0A8D0H8G3_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2Q8F9_BCL2A1-      --ggg------------ta-------------------------------
A0A670JXJ0_BCL2A1-      --agg------------tgttggagcatcctaaataccaagcttctcaga
A0A670JXJ0_BCL2A1-      --ggg------------tgttggagcatcctaaataccaagcttctcaga
A0A670JXJ0_BCL2A1-      --g-----------------------------------------------
F6S8G3_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C5VB12_BCL2A1-      --ggg------------ag-------------------------------
A0A286XUI2_BCL2A1-      --ggg------------ac-------------------------------
A0A8C2UN30_BCL2A1-      --ggg------------aa-------------------------------
A0A8C5L8K1_BCL2A1-      --ggg------------aa-------------------------------
F6SFL4_BCL2A1-01        --ggg------------aa-------------------------------
A0A4X2KFL7_BCL2A1-      --ggg------------aa-------------------------------
A0A7N4P573_BCL2A1-      ccggg------------gg-------------------------------
A0A7N4P573_BCL2A1-      --ggg------------aa-------------------------------
A0A7N4P573_BCL2A1-      ccggg------------gg-------------------------------
A0A7N4P573_BCL2A1-      --ggg------------gg-------------------------------
A0A8C0KQ53_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0MTY3_BCL2A1-      --ggg------------aa-------------------------------
A0A8I3MYG9_BCL2A1-      --ggg------------aa-------------------------------
M3YVH4_BCL2A1-01        --ggg------------ag-------------------------------
U6CQS8_BCL2A1-01        --ggg------------ag-------------------------------
A0A452U285_BCL2A1-      --ggtccctcctcccgccc-------------------------------
G1LIJ8_BCL2A1-01        --ggg------------aa-------------------------------
A0A452SIR9_BCL2A1-      --ggg------------aa-------------------------------
A0A452U285_BCL2A1-      --ggg------------aa-------------------------------
A0A5F9CXI7_BCL2A1-      ---gg------------tg-------------------------------
A0A5F9CXI7_BCL2A1-      ---gg------------tg-------------------------------
A0A5F9CXI7_BCL2A1-      --ggg------------tg-------------------------------
A0A5F9CXI7_BCL2A1-      --ggg------------tg-------------------------------
A0A8C8X938_BCL2A1-      --ggg------------ag-------------------------------
M3WHW2_BCL2A1-01        --ggg------------aa-------------------------------
A0A667HQV5_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9KZ34_BCL2A1-      --gg--------------a-------------------------------
A0A8C8X938_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9KZ34_BCL2A1-      --ggg------------aa-------------------------------
A0A8C0WAG3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C6QF32_BCL2A1-      --ggg------------aa-------------------------------
A0A8C6R201_BCL2A1-      --ggg------------ta-------------------------------
A0A8C6GN16_BCL2A1-      --ggg------------ta-------------------------------
G3V977_BCL2A1-01        --ggg------------aa-------------------------------
Q925A9_BCL2A1-01        --ggg------------aa-------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --ggg------------aa-------------------------------
O55179_BCL2A1-01        --ggg------------aa-------------------------------
Q8K164_BCL2A1-01        --ggg------------aa-------------------------------
Q4FK02_BCL2A1-01        --ggg------------aa-------------------------------
O55177_BCL2A1-02        --ggg------------aa-------------------------------
Q497M6_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C2LQI3_BCL2A1-      --ggg------------aa-------------------------------
A0A8C8U2B9_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2B7G1_BCL2A1-      --ggg------------aa-------------------------------
A0A8C5YJP3_BCL2A1-      --ggg------------aa-------------------------------
I3MCZ7_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C9PIV7_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2IK51_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9DF25_BCL2A1-      --ggg------------aa-------------------------------
A0A2K6EKG1_BCL2A1-      --ggg------------aa-------------------------------
A0A8C6MJ03_BCL2A1-      --ggg------------aa-------------------------------
A0A8B9YDG7_BCL2A1-      ---gg---tgtttacccat-------------------------------
A0A8B9YDG7_BCL2A1-      --ggg---tgtttacccat-------------------------------
A0A8B9YDG7_BCL2A1-      --ggg---tgtttacccat-------------------------------
A0A8B9YDG7_BCL2A1-      --ggg------------aa-------------------------------
A0A452EK63_BCL2A1-      --ggg------------aa-------------------------------
W5Q0N6_BCL2A1-01        --ggg------------aa-------------------------------
A0A671FLY8_BCL2A1-      --ggg------------aa-------------------------------
H0WZ23_BCL2A1-01        --ggg------------aa-------------------------------
F7HXW0_BCL2A1-01        --ggg------------aa-------------------------------
F7HXW0_BCL2A1-02        --ggg------------ga-------------------------------
A0A2K6TLG6_BCL2A1-      --gg-------------gg-------------------------------
A0A2K6TLG6_BCL2A1-      --gg-------------aa-------------------------------
A0A2K6TLG6_BCL2A1-      --gg-------------ac-------------------------------
A0A2K5D2I1_BCL2A1-      --gg-------------aa-------------------------------
A0A2K5D2I1_BCL2A1-      --ggc------------ga-------------------------------
A0A2I3GQS0_BCL2A1-      --ggg------------ga-------------------------------
A0A2I3GQS0_BCL2A1-      --ggg------------aa-------------------------------
A0A2I3GQS0_BCL2A1-      --ggg------------aa-------------------------------
A0A2K5KAA3_BCL2A1-      --ggg------------aa-------------------------------
A0A8D2E7F6_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9HCC9_BCL2A1-      --ggg------------aa-------------------------------
A0A2K6AD27_BCL2A1-      --ggg------------aa-------------------------------
A0A0D9RRC3_BCL2A1-      --ggg------------aa-------------------------------
A0A2K6LV19_BCL2A1-      --ggg------------aa-------------------------------
A0A2K6PHF2_BCL2A1-      --ggg------------aa-------------------------------
A0A2K5KHH8_BCL2A1-      --ggg------------aa-------------------------------
A0A2K6DS18_BCL2A1-      --ggg------------aa-------------------------------
A0A2K5KHH8_BCL2A1-      --ggg------------aa-------------------------------
A0A2K5TMD1_BCL2A1-      --ggg------------aa-------------------------------
F7E8V5_BCL2A1-01        --ggg------------aa-------------------------------
A0A2K5KAA3_BCL2A1-      --ggg------------ga-------------------------------
A0A2K6LV19_BCL2A1-      --ggg------------ga-------------------------------
A0A2K6PHF2_BCL2A1-      --ggg------------ga-------------------------------
A0A2K6AD27_BCL2A1-      --ggg------------ga-------------------------------
A0A2K5KHH8_BCL2A1-      --ggg------------ga-------------------------------
A0A2K5TMD1_BCL2A1-      --ggg------------ga-------------------------------
A0A2K6DS18_BCL2A1-      --ggg------------ga-------------------------------
H2NNZ9_BCL2A1-01        --ggg------------ga-------------------------------
B4E1X9_BCL2A1-03        --ggg------------ta-------------------------------
A0A2R8ZJ66_BCL2A1-      --ggg------------aa-------------------------------
A0A2R8ZJ66_BCL2A1-      --ggg------------aa-------------------------------
B4E1X9_BCL2A1-02        --ggg------------aa-------------------------------
A0A2I2YJV4_BCL2A1-      --ggg------------aa-------------------------------
A0A2I2YJV4_BCL2A1-      --ggg------------aa-------------------------------
A0A2R8ZJ66_BCL2A1-      --ggg------------ga-------------------------------
A0A2I2YJV4_BCL2A1-      --ggg------------ga-------------------------------
B4E1X9_BCL2A1-01        --ggg------------ga-------------------------------
G3T8E6_BCL2A1-01        --ggg------------aa-------------------------------
A0A8C3WEA1_BCL2A1-      --ggg---------------------------------------------
A0A8D1BRF8_BCL2A1-      --agg------------tg-------------------------------
A0A8D0Z1Y4_BCL2A1-      --agg------------tg-------------------------------
A0A8D1SK15_BCL2A1-      --agg------------tg-------------------------------
A0A4X1UP21_BCL2A1-      --agg------------tg-------------------------------
A0A8D1BRF8_BCL2A1-      --agg------------tg-------------------------------
A0A8D1YBS8_BCL2A1-      --agg------------tg-------------------------------
A0A4X1UP21_BCL2A1-      --ggg---------------------------------------------
A0A4X1UQW5_BCL2A1-      --ggg---------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --ggg---------------------------------------------
A0A8D1BRF8_BCL2A1-      --ggg---------------------------------------------
A0A8D1SK15_BCL2A1-      --ggg---------------------------------------------
A0A8D1YBS8_BCL2A1-      --ggg---------------------------------------------
C7F841_BCL2A1-01        --ggg---------------------------------------------
A0A8D1KPD1_BCL2A1-      --ggg---------------------------------------------
A0A8D1BRF8_BCL2A1-      --ggg------------tg-------------------------------
A0A4X1UP21_BCL2A1-      --ggg------------tg-------------------------------
A0A8D1SK15_BCL2A1-      --ggg------------tg-------------------------------
A0A8D0Z1Y4_BCL2A1-      --ggg------------tg-------------------------------
A0A8D1YBS8_BCL2A1-      --ggg------------tg-------------------------------
A0A8C0CSU7_BCL2A1-      --ggg------------aa-------------------------------
A0A8C6FDW6_BCL2A1-      --ggg------------aa-------------------------------
A0A8C9BC20_BCL2A1-      --ggg------------aa-------------------------------
A0A5F5PK00_BCL2A1-      --ggg------------tg-------------------------------
A0A8C4PQL1_BCL2A1-      --ggg------------aa-------------------------------
A0A5F5PK00_BCL2A1-      --ggg------------aa-------------------------------
A0A5F5PK00_BCL2A1-      --agg------------tg-------------------------------
A0A5F5PK00_BCL2A1-      --ggg------------tg-------------------------------
A0A5F5PK00_BCL2A1-      --ggg------------tg-------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      gaattgcagtcttcctaagcatgtcggatgaggtccagacagaagaaatc
A0A670JXJ0_BCL2A1-      gaattgcagtcttcctaagcatgtcggatgaggtccagacagaagaaatc
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      ------attgc-------------c-------cacagtcaatatcagaag
A0A8B9S513_BCL2A1-      ------aacgg-------ctt---c-------c----tga-----caaag
A0A8C6ZVQ3_BCL2A1-      ------aatgg-------ctt---c-------c----tgt-----cgaag
A0A8C5X4L3_BCL2A1-      ------aacgg-------ctt---c-------c----taa-----caaag
H0ZCL9_BCL2A1-01        ------aatgg-------ctt---c-------c----taa-----ctaag
A0A8C5J3C4_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8D2QAC0_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8C9MQN0_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C3NVU4_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8D2PM01_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C0UPM3_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C0UPM3_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C3U920_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A803V184_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C2UCW6_BCL2A1-      ------aacgg-------ttt---c-------c----taa-----caaag
G1N8C5_BCL2A1-01        ------aatgg-------ttt---c-------c----taa-----caaag
A0A8C3KTI3_BCL2A1-      ------aacgg-------ttt---c-------c----taa-----caaag
A0A669PVQ4_BCL2A1-      ------aacgg-------ttt---c-------c----taa-----caaag
A0A8B9CVY0_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8B9E009_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C3BNR4_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A493SSZ7_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8B9UZT1_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C3K1C5_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8B9FJB5_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A672UHF9_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----tgaag
A0A8C4U5U5_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8B9Z3D5_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8B9RZD1_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A663E5S6_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----caaag
A0A8C8AIP7_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----tgaag
A0A663N622_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8C0EQC0_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8D0ELW8_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----cgaag
A0A8D0EB90_BCL2A1-      ------agtaa-------ttc---t----------tatgc-----tcaaa
A0A7M4FFQ8_BCL2A1-      ------aatgg-------ctt---c-------c----tta-----tgaag
A0A8C8SUC3_BCL2A1-      ------a---g-------ttt---cacttgctc----ttg-----ctcta
K7G130_BCL2A1-01        ------aacgg-------ctt---c-------c----tac-----ctatg
A0A8C3FIW3_BCL2A1-      ------aacgg-------ctt---c-------c----tac-----ctatg
A0A8C0G393_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----ctatg
A0A452J3N6_BCL2A1-      ------aatgg-------ctt---c-------c----taa-----ctatg
A0A8C4W4P8_BCL2A1-      ------a---g-------ttt---c-------a----gtg-----ctgta
A0A8C3RME9_BCL2A1-      ------a---g-------ttt---c-------a----gtg-----ctgta
A0A674K8Q6_BCL2A1-      ------a---g-------ttt---c-------a----gtg-----ctgta
A0A8C6VPU0_BCL2A1-      ------aatgg-------ctt---t-------a----taa-----caaaa
A0A8C5SDG4_BCL2A1-      ------aatgg-------ctt---t-------a----taa-----caaaa
A0A670YDS2_BCL2A1-      ------aatgg-------ctt---t-------a----taa-----caaaa
A0A8D0H8G3_BCL2A1-      ------aatgg-------ctt---t-------g----tgg-----caaag
A0A8D2Q8F9_BCL2A1-      ---------ag-------att---t-------c-----------------
A0A670JXJ0_BCL2A1-      attaaggacat-------ttt---c-------cagcatgg-----caaag
A0A670JXJ0_BCL2A1-      attaaggacat-------ttt---c-------cagcatgg-----caaag
A0A670JXJ0_BCL2A1-      -----ggacag-------ctt---c-------c-----------------
F6S8G3_BCL2A1-01        ------aatgg-------att---t-------t----taa-----ataag
A0A8C5VB12_BCL2A1-      ------cacgg-------ctt---c-------g----tga-----agaag
A0A286XUI2_BCL2A1-      ------aacgg-------ctt---c-------g----tgc-----ggaag
A0A8C2UN30_BCL2A1-      ------aacgg-------ctt---t-------g----tga-----ggaag
A0A8C5L8K1_BCL2A1-      ------aacgg-------ctt---t-------a----taa-----agaag
F6SFL4_BCL2A1-01        ------aatgg-------ctt---t-------g----taa-----agaac
A0A4X2KFL7_BCL2A1-      ------aatgg-------ctt---c-------g----taa-----agaat
A0A7N4P573_BCL2A1-      ------tctggatctcatctt---c-------a----tgc-----caggt
A0A7N4P573_BCL2A1-      ------aatgg-------ctt---c-------a----taa-----agaac
A0A7N4P573_BCL2A1-      ------tctggatctcatctt---c-------a----tgc-----caggt
A0A7N4P573_BCL2A1-      ------tctggatctcatctt---c-------a----tgc-----caggt
A0A8C0KQ53_BCL2A1-      ------aacgg-------ctt---t-------g----tga-----agaag
A0A8C0MTY3_BCL2A1-      ------aacgg-------ctt---t-------g----tga-----agaag
A0A8I3MYG9_BCL2A1-      ------aacgg-------ctt---t-------g----tga-----agaag
M3YVH4_BCL2A1-01        ------gatgg-------ctt---t-------g----taa-----agaag
U6CQS8_BCL2A1-01        ------gacgg-------ctt---t-------g----taa-----agaag
A0A452U285_BCL2A1-      ------tctgc-------cag---t-------g----tga-----agggc
G1LIJ8_BCL2A1-01        ------gacgg-------ctt---t-------g----taa-----agaag
A0A452SIR9_BCL2A1-      ------gatgg-------ctt---t-------g----taa-----agaag
A0A452U285_BCL2A1-      ------gatgg-------ctt---t-------g----taa-----agaag
A0A5F9CXI7_BCL2A1-      ------attgc-------cca---c-------c----ggc-----agtat
A0A5F9CXI7_BCL2A1-      ------attgc-------cca---c-------c----ggc-----agtat
A0A5F9CXI7_BCL2A1-      ------attgc-------cca---c-------c----ggc-----agtat
A0A5F9CXI7_BCL2A1-      ------attgc-------cca---c-------c----ggc-----agtat
A0A8C8X938_BCL2A1-      ------gaagc-------cttgtcc-------a----cag-----gggga
M3WHW2_BCL2A1-01        ------aacgg-------ctt---t-------g----taa-----ggaag
A0A667HQV5_BCL2A1-      ------aacgg-------ctt---t-------g----taa-----ggaag
A0A8C9KZ34_BCL2A1-      ------ggcgt-------ttc---c---------------------gaag
A0A8C8X938_BCL2A1-      ------aacgg-------ctt---t-------g----taa-----ggaag
A0A8C9KZ34_BCL2A1-      ------aacgg-------ctt---t-------g----taa-----ggaag
A0A8C0WAG3_BCL2A1-      ------aatgg-------ctt---t-------a----taa-----agaag
A0A8C6QF32_BCL2A1-      ------gatgg-------ctt---c-------a----taa-----ggaaa
A0A8C6R201_BCL2A1-      ------tatgg-------ctt---c-------a----taa-----ggaag
A0A8C6GN16_BCL2A1-      ------tct----------tt---c-------a----aaaaatccagagg
G3V977_BCL2A1-01        ------gatgg-------ctt---c-------a----caa-----agaag
Q925A9_BCL2A1-01        ------gatgg-------ctt---c-------a----caa-----agaag
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ------gatgg-------ctt---c-------a----taa-----agaag
O55179_BCL2A1-01        ------gatgg-------ctt---c-------a----taa-----agaag
Q8K164_BCL2A1-01        ------gatgg-------ctt---c-------a----taa-----agaag
Q4FK02_BCL2A1-01        ------gatgg-------ctt---c-------a----taa-----agaag
O55177_BCL2A1-02        ------gatgg-------ctt---c-------a----taa-----agaag
Q497M6_BCL2A1-01        ------gatgg-------ctt---c-------a----taa-----agaag
A0A8C2LQI3_BCL2A1-      ------gatgg-------ctt---c-------a----tga-----agaag
A0A8C8U2B9_BCL2A1-      ------gatgg-------ctt---c-------a----tga-----agaag
A0A8D2B7G1_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C5YJP3_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
I3MCZ7_BCL2A1-01        ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C9PIV7_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8D2IK51_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C9DF25_BCL2A1-      ------cacgg-------ctt---c-------g----taa-----agaag
A0A2K6EKG1_BCL2A1-      ------cacgg-------ctt---c-------g----taa-----agaag
A0A8C6MJ03_BCL2A1-      ------aatgg-------ttt---t-------g----taa-----agaag
A0A8B9YDG7_BCL2A1-      ------aatga-------ata---t--------------c-----aaaag
A0A8B9YDG7_BCL2A1-      ------aatga-------ata---t--------------c-----aaaag
A0A8B9YDG7_BCL2A1-      ------aatga-------ata---t--------------c-----aaaag
A0A8B9YDG7_BCL2A1-      ------aatgg-------gtt---t-------g----taa-----agaag
A0A452EK63_BCL2A1-      ------aatgg-------gtt---t-------g----taa-----agaag
W5Q0N6_BCL2A1-01        ------aatgg-------ttt---t-------g----taa-----agaag
A0A671FLY8_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
H0WZ23_BCL2A1-01        ------catgg-------ctt---t-------g----taa-----agaag
F7HXW0_BCL2A1-01        ------aatgg-------ctt---t-------g----taa-----agaag
F7HXW0_BCL2A1-02        ------aatgg-------c---------------------------acag
A0A2K6TLG6_BCL2A1-      ------aa------------------------a----tgg-----aacag
A0A2K6TLG6_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5D2I1_BCL2A1-      ------aatgg-------c---------------------------acag
A0A2I3GQS0_BCL2A1-      ------aatgg-------c--------------------------ataat
A0A2I3GQS0_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2I3GQS0_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5KAA3_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8D2E7F6_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C9HCC9_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K6AD27_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A0D9RRC3_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K6LV19_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K6PHF2_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5KHH8_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K6DS18_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5KHH8_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5TMD1_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
F7E8V5_BCL2A1-01        ------aatgg-------ctt---t-------g----taa-----agaag
A0A2K5KAA3_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K6LV19_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K6PHF2_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K6AD27_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K5KHH8_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K5TMD1_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2K6DS18_BCL2A1-      ------aatgg-------c--------------------------acaat
H2NNZ9_BCL2A1-01        ------aatgg-------c--------------------------acaat
B4E1X9_BCL2A1-03        ------tgtgt-------gat---g-------g----aaa-----aattc
A0A2R8ZJ66_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2R8ZJ66_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
B4E1X9_BCL2A1-02        ------aatgg-------ctt---t-------g----taa-----agaag
A0A2I2YJV4_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2I2YJV4_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A2R8ZJ66_BCL2A1-      ------aatgg-------c--------------------------acaat
A0A2I2YJV4_BCL2A1-      ------aatgg-------c--------------------------acaat
B4E1X9_BCL2A1-01        ------aatgg-------c--------------------------acaat
G3T8E6_BCL2A1-01        ------aatgg-------ctt---t-------g----tga-----agaag
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D0Z1Y4_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D1SK15_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A4X1UP21_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D1BRF8_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D1YBS8_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A4X1UP21_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D1SK15_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D0Z1Y4_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8D1YBS8_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8C0CSU7_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C6FDW6_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A8C9BC20_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A5F5PK00_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A8C4PQL1_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A5F5PK00_BCL2A1-      ------aatgg-------ctt---t-------g----taa-----agaag
A0A5F5PK00_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A5F5PK00_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
A0A5F5PK00_BCL2A1-      ------attgc-------cca---c-------a----gtc-----agtat
                                                                          

A0A673TDC6_BCL2A1-      tct-----------------------------------------------
A0A8B9S513_BCL2A1-      ttt-----------------------------------------------
A0A8C6ZVQ3_BCL2A1-      ttt-----------------------------------------------
A0A8C5X4L3_BCL2A1-      ttt-----------------------------------------------
H0ZCL9_BCL2A1-01        ttt-----------------------------------------------
A0A8C5J3C4_BCL2A1-      ttt-----------------------------------------------
A0A8D2QAC0_BCL2A1-      ttt-----------------------------------------------
A0A8C9MQN0_BCL2A1-      ttt-----------------------------------------------
A0A8C3NVU4_BCL2A1-      ttt-----------------------------------------------
A0A8D2PM01_BCL2A1-      ttt-----------------------------------------------
A0A8C0UPM3_BCL2A1-      ttt-----------------------------------------------
A0A8C0UPM3_BCL2A1-      ttt-----------------------------------------------
A0A8C3U920_BCL2A1-      ttt-----------------------------------------------
A0A803V184_BCL2A1-      ttt-----------------------------------------------
A0A8C2UCW6_BCL2A1-      ttt-----------------------------------------------
G1N8C5_BCL2A1-01        ttt-----------------------------------------------
A0A8C3KTI3_BCL2A1-      ttt-----------------------------------------------
A0A669PVQ4_BCL2A1-      ttt-----------------------------------------------
A0A8B9CVY0_BCL2A1-      ttt-----------------------------------------------
A0A8B9E009_BCL2A1-      ttt-----------------------------------------------
A0A8C3BNR4_BCL2A1-      ttt-----------------------------------------------
A0A493SSZ7_BCL2A1-      ttt-----------------------------------------------
A0A8B9UZT1_BCL2A1-      ttt-----------------------------------------------
A0A8C3K1C5_BCL2A1-      ttt-----------------------------------------------
A0A8B9FJB5_BCL2A1-      ttt-----------------------------------------------
A0A672UHF9_BCL2A1-      ttt-----------------------------------------------
A0A8C4U5U5_BCL2A1-      ttt-----------------------------------------------
A0A8B9Z3D5_BCL2A1-      ttt-----------------------------------------------
A0A8B9RZD1_BCL2A1-      ttt-----------------------------------------------
A0A663E5S6_BCL2A1-      ttt-----------------------------------------------
A0A8C8AIP7_BCL2A1-      ttt-----------------------------------------------
A0A663N622_BCL2A1-      ttt-----------------------------------------------
A0A8C0EQC0_BCL2A1-      ttt-----------------------------------------------
A0A8D0ELW8_BCL2A1-      ttt-----------------------------------------------
A0A8D0EB90_BCL2A1-      ttt-----------------------------------------------
A0A7M4FFQ8_BCL2A1-      ttt-ga--------------------------------------------
A0A8C8SUC3_BCL2A1-      tttctc--------------------------------------------
K7G130_BCL2A1-01        ttt-ga--------------------------------------------
A0A8C3FIW3_BCL2A1-      ttt-ga--------------------------------------------
A0A8C0G393_BCL2A1-      ttt-ga--------------------------------------------
A0A452J3N6_BCL2A1-      ttt-ga--------------------------------------------
A0A8C4W4P8_BCL2A1-      ttt-ta--------------------------------------------
A0A8C3RME9_BCL2A1-      ttt-ta--------------------------------------------
A0A674K8Q6_BCL2A1-      ttt-ta--------------------------------------------
A0A8C6VPU0_BCL2A1-      ttt-ga--------------------------------------------
A0A8C5SDG4_BCL2A1-      ttt-ga--------------------------------------------
A0A670YDS2_BCL2A1-      ttt-ga--------------------------------------------
A0A8D0H8G3_BCL2A1-      ttt-ga--------------------------------------------
A0A8D2Q8F9_BCL2A1-      --t-gctcagtttttcattac-----------------------------
A0A670JXJ0_BCL2A1-      agt-gcttcattccgcattacaagccccggagcagccacatggacatggt
A0A670JXJ0_BCL2A1-      agt-gcttcattccgcattacaagccccggagcagccacatggacatggt
A0A670JXJ0_BCL2A1-      -----------------ttgcaa---------------------------
F6S8G3_BCL2A1-01        ttt-----------------------------------------------
A0A8C5VB12_BCL2A1-      ttt-----------------------------------------------
A0A286XUI2_BCL2A1-      ttt-----------------------------------------------
A0A8C2UN30_BCL2A1-      ttt-----------------------------------------------
A0A8C5L8K1_BCL2A1-      ttt-----------------------------------------------
F6SFL4_BCL2A1-01        ttt-----------------------------------------------
A0A4X2KFL7_BCL2A1-      ttt-----------------------------------------------
A0A7N4P573_BCL2A1-      ctt-----------------------------------------------
A0A7N4P573_BCL2A1-      ttt-----------------------------------------------
A0A7N4P573_BCL2A1-      ctt-----------------------------------------------
A0A7N4P573_BCL2A1-      ctt-----------------------------------------------
A0A8C0KQ53_BCL2A1-      ttc-----------------------------------------------
A0A8C0MTY3_BCL2A1-      ttc-----------------------------------------------
A0A8I3MYG9_BCL2A1-      ttc-----------------------------------------------
M3YVH4_BCL2A1-01        ttc-----------------------------------------------
U6CQS8_BCL2A1-01        ttc-----------------------------------------------
A0A452U285_BCL2A1-      tgc-----------------------------------------------
G1LIJ8_BCL2A1-01        ttc-----------------------------------------------
A0A452SIR9_BCL2A1-      ttc-----------------------------------------------
A0A452U285_BCL2A1-      ttc-----------------------------------------------
A0A5F9CXI7_BCL2A1-      cag-----------------------------------------------
A0A5F9CXI7_BCL2A1-      cag-----------------------------------------------
A0A5F9CXI7_BCL2A1-      cag-----------------------------------------------
A0A5F9CXI7_BCL2A1-      cag-----------------------------------------------
A0A8C8X938_BCL2A1-      ctt-----------------------------------------------
M3WHW2_BCL2A1-01        ttc-----------------------------------------------
A0A667HQV5_BCL2A1-      ttc-----------------------------------------------
A0A8C9KZ34_BCL2A1-      tgt-----------------------------------------------
A0A8C8X938_BCL2A1-      ttc-----------------------------------------------
A0A8C9KZ34_BCL2A1-      ttc-----------------------------------------------
A0A8C0WAG3_BCL2A1-      ttt-----------------------------------------------
A0A8C6QF32_BCL2A1-      ttt-----------------------------------------------
A0A8C6R201_BCL2A1-      ttt-----------------------------------------------
A0A8C6GN16_BCL2A1-      ttt-----------------------------------------------
G3V977_BCL2A1-01        ttt-----------------------------------------------
Q925A9_BCL2A1-01        ttt-----------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ttt-----------------------------------------------
O55179_BCL2A1-01        ttt-----------------------------------------------
Q8K164_BCL2A1-01        ttt-----------------------------------------------
Q4FK02_BCL2A1-01        ttt-----------------------------------------------
O55177_BCL2A1-02        ttt-----------------------------------------------
Q497M6_BCL2A1-01        ttt-----------------------------------------------
A0A8C2LQI3_BCL2A1-      ttt-----------------------------------------------
A0A8C8U2B9_BCL2A1-      ttt-----------------------------------------------
A0A8D2B7G1_BCL2A1-      ttt-----------------------------------------------
A0A8C5YJP3_BCL2A1-      ttt-----------------------------------------------
I3MCZ7_BCL2A1-01        ttt-----------------------------------------------
A0A8C9PIV7_BCL2A1-      ttt-----------------------------------------------
A0A8D2IK51_BCL2A1-      ttt-----------------------------------------------
A0A8C9DF25_BCL2A1-      ttt-----------------------------------------------
A0A2K6EKG1_BCL2A1-      ttt-----------------------------------------------
A0A8C6MJ03_BCL2A1-      ttt-----------------------------------------------
A0A8B9YDG7_BCL2A1-      tcc-----------------------------------------------
A0A8B9YDG7_BCL2A1-      tcc-----------------------------------------------
A0A8B9YDG7_BCL2A1-      tcc-----------------------------------------------
A0A8B9YDG7_BCL2A1-      ttt-----------------------------------------------
A0A452EK63_BCL2A1-      ttt-----------------------------------------------
W5Q0N6_BCL2A1-01        ttt-----------------------------------------------
A0A671FLY8_BCL2A1-      ttt-----------------------------------------------
H0WZ23_BCL2A1-01        ttt-----------------------------------------------
F7HXW0_BCL2A1-01        ttt-----------------------------------------------
F7HXW0_BCL2A1-02        tct-----------------------------------------------
A0A2K6TLG6_BCL2A1-      tct-----------------------------------------------
A0A2K6TLG6_BCL2A1-      ttt-----------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ttt-----------------------------------------------
A0A2K5D2I1_BCL2A1-      tct-----------------------------------------------
A0A2I3GQS0_BCL2A1-      cac-----------------------------------------------
A0A2I3GQS0_BCL2A1-      ttt-----------------------------------------------
A0A2I3GQS0_BCL2A1-      ttt-----------------------------------------------
A0A2K5KAA3_BCL2A1-      ttt-----------------------------------------------
A0A8D2E7F6_BCL2A1-      ttt-----------------------------------------------
A0A8C9HCC9_BCL2A1-      ttt-----------------------------------------------
A0A2K6AD27_BCL2A1-      ttt-----------------------------------------------
A0A0D9RRC3_BCL2A1-      ttt-----------------------------------------------
A0A2K6LV19_BCL2A1-      ttt-----------------------------------------------
A0A2K6PHF2_BCL2A1-      ttt-----------------------------------------------
A0A2K5KHH8_BCL2A1-      ctt-----------------------------------------------
A0A2K6DS18_BCL2A1-      ttt-----------------------------------------------
A0A2K5KHH8_BCL2A1-      ttt-----------------------------------------------
A0A2K5TMD1_BCL2A1-      ttt-----------------------------------------------
F7E8V5_BCL2A1-01        ttt-----------------------------------------------
A0A2K5KAA3_BCL2A1-      cac-----------------------------------------------
A0A2K6LV19_BCL2A1-      cac-----------------------------------------------
A0A2K6PHF2_BCL2A1-      cac-----------------------------------------------
A0A2K6AD27_BCL2A1-      cac-----------------------------------------------
A0A2K5KHH8_BCL2A1-      cac-----------------------------------------------
A0A2K5TMD1_BCL2A1-      cac-----------------------------------------------
A0A2K6DS18_BCL2A1-      cac-----------------------------------------------
H2NNZ9_BCL2A1-01        cac-----------------------------------------------
B4E1X9_BCL2A1-03        ttc-----------------------------------------------
A0A2R8ZJ66_BCL2A1-      ttt-----------------------------------------------
A0A2R8ZJ66_BCL2A1-      ttt-----------------------------------------------
B4E1X9_BCL2A1-02        ttt-----------------------------------------------
A0A2I2YJV4_BCL2A1-      ttt-----------------------------------------------
A0A2I2YJV4_BCL2A1-      ttt-----------------------------------------------
A0A2R8ZJ66_BCL2A1-      cac-----------------------------------------------
A0A2I2YJV4_BCL2A1-      cac-----------------------------------------------
B4E1X9_BCL2A1-01        cac-----------------------------------------------
G3T8E6_BCL2A1-01        ttt-----------------------------------------------
A0A8C3WEA1_BCL2A1-      --a-----------------------------------------------
A0A8D1BRF8_BCL2A1-      cta-----------------------------------------------
A0A8D0Z1Y4_BCL2A1-      cta-----------------------------------------------
A0A8D1SK15_BCL2A1-      cta-----------------------------------------------
A0A4X1UP21_BCL2A1-      cta-----------------------------------------------
A0A8D1BRF8_BCL2A1-      cta-----------------------------------------------
A0A8D1YBS8_BCL2A1-      cta-----------------------------------------------
A0A4X1UP21_BCL2A1-      --a-----------------------------------------------
A0A4X1UQW5_BCL2A1-      --a-----------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --a-----------------------------------------------
A0A8D1BRF8_BCL2A1-      --a-----------------------------------------------
A0A8D1SK15_BCL2A1-      --a-----------------------------------------------
A0A8D1YBS8_BCL2A1-      --a-----------------------------------------------
C7F841_BCL2A1-01        --a-----------------------------------------------
A0A8D1KPD1_BCL2A1-      --a-----------------------------------------------
A0A8D1BRF8_BCL2A1-      cta-----------------------------------------------
A0A4X1UP21_BCL2A1-      cta-----------------------------------------------
A0A8D1SK15_BCL2A1-      cta-----------------------------------------------
A0A8D0Z1Y4_BCL2A1-      cta-----------------------------------------------
A0A8D1YBS8_BCL2A1-      cta-----------------------------------------------
A0A8C0CSU7_BCL2A1-      ttt-----------------------------------------------
A0A8C6FDW6_BCL2A1-      ttt-----------------------------------------------
A0A8C9BC20_BCL2A1-      ttt-----------------------------------------------
A0A5F5PK00_BCL2A1-      caa-----------------------------------------------
A0A8C4PQL1_BCL2A1-      ttt-----------------------------------------------
A0A5F5PK00_BCL2A1-      ttt-----------------------------------------------
A0A5F5PK00_BCL2A1-      caa-----------------------------------------------
A0A5F5PK00_BCL2A1-      caa-----------------------------------------------
A0A5F5PK00_BCL2A1-      caa-----------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      gaagctagcttcctacgaagaaattgctttgctccccttgacttcctgga
A0A670JXJ0_BCL2A1-      gaagctagcttcctacgaagaaattgctttgctccccttgacttcctgga
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      -------------------------------aa-----------------
A0A8B9S513_BCL2A1-      ------------------------------gaa-----------------
A0A8C6ZVQ3_BCL2A1-      ------------------------------gaa-----------------
A0A8C5X4L3_BCL2A1-      ------------------------------gaa-----------------
H0ZCL9_BCL2A1-01        ------------------------------gaa-----------------
A0A8C5J3C4_BCL2A1-      ------------------------------gaa-----------------
A0A8D2QAC0_BCL2A1-      ------------------------------gaa-----------------
A0A8C9MQN0_BCL2A1-      ------------------------------gaa-----------------
A0A8C3NVU4_BCL2A1-      ------------------------------gaa-----------------
A0A8D2PM01_BCL2A1-      ------------------------------gaa-----------------
A0A8C0UPM3_BCL2A1-      ------------------------------gaa-----------------
A0A8C0UPM3_BCL2A1-      ------------------------------gaa-----------------
A0A8C3U920_BCL2A1-      ------------------------------gaa-----------------
A0A803V184_BCL2A1-      ------------------------------gaa-----------------
A0A8C2UCW6_BCL2A1-      ------------------------------gaa-----------------
G1N8C5_BCL2A1-01        ------------------------------gaa-----------------
A0A8C3KTI3_BCL2A1-      ------------------------------gaa-----------------
A0A669PVQ4_BCL2A1-      ------------------------------gaa-----------------
A0A8B9CVY0_BCL2A1-      ------------------------------gaa-----------------
A0A8B9E009_BCL2A1-      ------------------------------gaa-----------------
A0A8C3BNR4_BCL2A1-      ------------------------------gaa-----------------
A0A493SSZ7_BCL2A1-      ------------------------------gaa-----------------
A0A8B9UZT1_BCL2A1-      ------------------------------gaa-----------------
A0A8C3K1C5_BCL2A1-      ------------------------------gaa-----------------
A0A8B9FJB5_BCL2A1-      ------------------------------gaa-----------------
A0A672UHF9_BCL2A1-      ------------------------------gaa-----------------
A0A8C4U5U5_BCL2A1-      ------------------------------gaa-----------------
A0A8B9Z3D5_BCL2A1-      ------------------------------gaa-----------------
A0A8B9RZD1_BCL2A1-      ------------------------------gaa-----------------
A0A663E5S6_BCL2A1-      ------------------------------gaa-----------------
A0A8C8AIP7_BCL2A1-      ------------------------------gaa-----------------
A0A663N622_BCL2A1-      ------------------------------gaa-----------------
A0A8C0EQC0_BCL2A1-      ------------------------------gaa-----------------
A0A8D0ELW8_BCL2A1-      ------------------------------gaa-----------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      -----------------------------gggt-----------------
A0A8C8SUC3_BCL2A1-      -----------------------------tgtt-----------------
K7G130_BCL2A1-01        -----------------------------agaa-----------------
A0A8C3FIW3_BCL2A1-      -----------------------------ggaa-----------------
A0A8C0G393_BCL2A1-      -----------------------------ggaa-----------------
A0A452J3N6_BCL2A1-      -----------------------------ggaa-----------------
A0A8C4W4P8_BCL2A1-      -----------------------------taac-----------------
A0A8C3RME9_BCL2A1-      -----------------------------taac-----------------
A0A674K8Q6_BCL2A1-      -----------------------------taac-----------------
A0A8C6VPU0_BCL2A1-      -----------------------------ggat-----------------
A0A8C5SDG4_BCL2A1-      -----------------------------ggat-----------------
A0A670YDS2_BCL2A1-      -----------------------------ggat-----------------
A0A8D0H8G3_BCL2A1-      -----------------------------ggag-----------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      acatccatcagccggctgaaaatgacatcaggg-----------------
A0A670JXJ0_BCL2A1-      acatccatcagccggctgaaaatgacatcaggg-----------------
A0A670JXJ0_BCL2A1-      ---------agttgggtga----------agag-----------------
F6S8G3_BCL2A1-01        ------------------------------gaa-c---------------
A0A8C5VB12_BCL2A1-      ------------------------------gaa-c----cc---------
A0A286XUI2_BCL2A1-      ------------------------------gag-c----cc---------
A0A8C2UN30_BCL2A1-      ------------------------------gag-c----cc---------
A0A8C5L8K1_BCL2A1-      ------------------------------gaa-c----cc---------
F6SFL4_BCL2A1-01        ------------------------------gaa-c----ct---------
A0A4X2KFL7_BCL2A1-      ------------------------------gaa-c----ct---------
A0A7N4P573_BCL2A1-      ------------------------------gga-tttgacc---------
A0A7N4P573_BCL2A1-      ------------------------------gaa-c----cc---------
A0A7N4P573_BCL2A1-      ------------------------------gga-tttgacc---------
A0A7N4P573_BCL2A1-      ------------------------------gga-tttgacc---------
A0A8C0KQ53_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C0MTY3_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8I3MYG9_BCL2A1-      ------------------------------gaa-c----cc---------
M3YVH4_BCL2A1-01        ------------------------------gag-c----cc---------
U6CQS8_BCL2A1-01        ------------------------------gag-c----cc---------
A0A452U285_BCL2A1-      ------------------------------aag-c----gg---------
G1LIJ8_BCL2A1-01        ------------------------------gaa-c----cc---------
A0A452SIR9_BCL2A1-      ------------------------------gaa-c----cc---------
A0A452U285_BCL2A1-      ------------------------------gaa-c----cc---------
A0A5F9CXI7_BCL2A1-      ------------------------------aaa-t----cc---------
A0A5F9CXI7_BCL2A1-      ------------------------------aaa-t----cc---------
A0A5F9CXI7_BCL2A1-      ------------------------------aaa-t----cc---------
A0A5F9CXI7_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8C8X938_BCL2A1-      ------------------------------gat-c----tc---------
M3WHW2_BCL2A1-01        ------------------------------gaa-c----cc---------
A0A667HQV5_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C9KZ34_BCL2A1-      ------------------------------gaagc----ac---------
A0A8C8X938_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C9KZ34_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C0WAG3_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C6QF32_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C6R201_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C6GN16_BCL2A1-      ------------------------------taa-a----tttttttggat
G3V977_BCL2A1-01        ------------------------------gaa-c----ct---------
Q925A9_BCL2A1-01        ------------------------------gaa-c----ct---------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ------------------------------gaa-c----cc---------
O55179_BCL2A1-01        ------------------------------gaa-c----cc---------
Q8K164_BCL2A1-01        ------------------------------gaa-c----cc---------
Q4FK02_BCL2A1-01        ------------------------------gaa-c----cc---------
O55177_BCL2A1-02        ------------------------------gaa-c----cc---------
Q497M6_BCL2A1-01        ------------------------------gaa-c----cc---------
A0A8C2LQI3_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C8U2B9_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8D2B7G1_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C5YJP3_BCL2A1-      ------------------------------gaa-c----ct---------
I3MCZ7_BCL2A1-01        ------------------------------gaa-c----ct---------
A0A8C9PIV7_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8D2IK51_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C9DF25_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K6EKG1_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C6MJ03_BCL2A1-      ------------------------------gaa-a----tc---------
A0A8B9YDG7_BCL2A1-      ------------------------------aaa-a----ga---------
A0A8B9YDG7_BCL2A1-      ------------------------------aaa-a----ga---------
A0A8B9YDG7_BCL2A1-      ------------------------------aaa-a----ga---------
A0A8B9YDG7_BCL2A1-      ------------------------------gaa-a----cc---------
A0A452EK63_BCL2A1-      ------------------------------gaa-a----cc---------
W5Q0N6_BCL2A1-01        ------------------------------gaa-a----cc---------
A0A671FLY8_BCL2A1-      ------------------------------gga-c----cc---------
H0WZ23_BCL2A1-01        ------------------------------gaa-c----ct---------
F7HXW0_BCL2A1-01        ------------------------------gaa-c----ct---------
F7HXW0_BCL2A1-02        ------------------------------cat-g----ct---------
A0A2K6TLG6_BCL2A1-      ------------------------------cat-g----ct---------
A0A2K6TLG6_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K5D2I1_BCL2A1-      ------------------------------cct-g----ct---------
A0A2I3GQS0_BCL2A1-      ------------------------------atg-c----ct---------
A0A2I3GQS0_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2I3GQS0_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K5KAA3_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8D2E7F6_BCL2A1-      ------------------------------gaa-c----ct---------
A0A8C9HCC9_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K6AD27_BCL2A1-      ------------------------------gaa-c----ct---------
A0A0D9RRC3_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K6LV19_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K6PHF2_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K5KHH8_BCL2A1-      ------------------------------gag-c----ct---------
A0A2K6DS18_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K5KHH8_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2K5TMD1_BCL2A1-      ------------------------------gaa-c----ct---------
F7E8V5_BCL2A1-01        ------------------------------gaa-c----ct---------
A0A2K5KAA3_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K6LV19_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K6PHF2_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K6AD27_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K5KHH8_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K5TMD1_BCL2A1-      ------------------------------atg-c----ct---------
A0A2K6DS18_BCL2A1-      ------------------------------atg-c----ct---------
H2NNZ9_BCL2A1-01        ------------------------------acg-c----ct---------
B4E1X9_BCL2A1-03        ------------------------------att-g----tt---------
A0A2R8ZJ66_BCL2A1-      ------------------------------gaa-c----at---------
A0A2R8ZJ66_BCL2A1-      ------------------------------gaa-c----at---------
B4E1X9_BCL2A1-02        ------------------------------gaa-c----ct---------
A0A2I2YJV4_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2I2YJV4_BCL2A1-      ------------------------------gaa-c----ct---------
A0A2R8ZJ66_BCL2A1-      ------------------------------acg-c----ct---------
A0A2I2YJV4_BCL2A1-      ------------------------------acg-c----ct---------
B4E1X9_BCL2A1-01        ------------------------------aca-c----ct---------
G3T8E6_BCL2A1-01        ------------------------------gaa-c----ct---------
A0A8C3WEA1_BCL2A1-      ------------------------------aaa-t---------------
A0A8D1BRF8_BCL2A1-      ------------------------------aag-t----cc---------
A0A8D0Z1Y4_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8D1SK15_BCL2A1-      ------------------------------aaa-t----cc---------
A0A4X1UP21_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8D1BRF8_BCL2A1-      ------------------------------aag-t----cc---------
A0A8D1YBS8_BCL2A1-      ------------------------------aag-t----cc---------
A0A4X1UP21_BCL2A1-      ------------------------------aaa-t---------------
A0A4X1UQW5_BCL2A1-      ------------------------------aaa-t---------------
A0A8D0Z1Y4_BCL2A1-      ------------------------------aaa-t---------------
A0A8D1BRF8_BCL2A1-      ------------------------------aaa-t---------------
A0A8D1SK15_BCL2A1-      ------------------------------aaa-t---------------
A0A8D1YBS8_BCL2A1-      ------------------------------aaa-t---------------
C7F841_BCL2A1-01        ------------------------------aaa-t---------------
A0A8D1KPD1_BCL2A1-      ------------------------------aaa-t---------------
A0A8D1BRF8_BCL2A1-      ------------------------------aag-t----cc---------
A0A4X1UP21_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8D1SK15_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8D0Z1Y4_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8D1YBS8_BCL2A1-      ------------------------------aag-t----cc---------
A0A8C0CSU7_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C6FDW6_BCL2A1-      ------------------------------gaa-c----cc---------
A0A8C9BC20_BCL2A1-      ------------------------------gaa-c----cc---------
A0A5F5PK00_BCL2A1-      ------------------------------aaa-t----cc---------
A0A8C4PQL1_BCL2A1-      ------------------------------gaa-c----cc---------
A0A5F5PK00_BCL2A1-      ------------------------------gaa-c----cc---------
A0A5F5PK00_BCL2A1-      ------------------------------aaa-t----cc---------
A0A5F5PK00_BCL2A1-      ------------------------------aaa-t----cc---------
A0A5F5PK00_BCL2A1-      ------------------------------aaa-t----cc---------
                                                                          

A0A673TDC6_BCL2A1-      ---------------caggatttccatctttc------------------
A0A8B9S513_BCL2A1-      ---------------aggagatcactac----------------------
A0A8C6ZVQ3_BCL2A1-      ---------------aggagatcactac----------------------
A0A8C5X4L3_BCL2A1-      ---------------agaagatcactac----------------------
H0ZCL9_BCL2A1-01        ---------------agaagatcactac----------------------
A0A8C5J3C4_BCL2A1-      ---------------agaagatcactac----------------------
A0A8D2QAC0_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C9MQN0_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C3NVU4_BCL2A1-      ---------------agaagatcactac----------------------
A0A8D2PM01_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C0UPM3_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C0UPM3_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C3U920_BCL2A1-      ---------------agaagatcactac----------------------
A0A803V184_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C2UCW6_BCL2A1-      ---------------agaagatcaccac----------------------
G1N8C5_BCL2A1-01        ---------------agaagatcaccac----------------------
A0A8C3KTI3_BCL2A1-      ---------------agaagatcaccac----------------------
A0A669PVQ4_BCL2A1-      ---------------agaagatcaccac----------------------
A0A8B9CVY0_BCL2A1-      ---------------agaagatcactac----------------------
A0A8B9E009_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C3BNR4_BCL2A1-      ---------------agaagatcactac----------------------
A0A493SSZ7_BCL2A1-      ---------------agaagatcactac----------------------
A0A8B9UZT1_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C3K1C5_BCL2A1-      ---------------agaagatcactac----------------------
A0A8B9FJB5_BCL2A1-      ---------------agaagatcacgac----------------------
A0A672UHF9_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C4U5U5_BCL2A1-      ---------------agaagatcactac----------------------
A0A8B9Z3D5_BCL2A1-      ---------------agaagatcactac----------------------
A0A8B9RZD1_BCL2A1-      ---------------agaagatcactac----------------------
A0A663E5S6_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C8AIP7_BCL2A1-      ---------------agaagatcactac----------------------
A0A663N622_BCL2A1-      ---------------agaagatcactac----------------------
A0A8C0EQC0_BCL2A1-      ---------------agaagatcactac----------------------
A0A8D0ELW8_BCL2A1-      ---------------agaagatcactac----------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      ---------------cagaaatcgtggc----------------------
A0A8C8SUC3_BCL2A1-      ---------------ggttaatcattgt----------------------
K7G130_BCL2A1-01        ---------------aaacaatcgtggc----------------------
A0A8C3FIW3_BCL2A1-      ---------------aaacgatcatggc----------------------
A0A8C0G393_BCL2A1-      ---------------aaacgatcatggc----------------------
A0A452J3N6_BCL2A1-      ---------------aaacgatcatggc----------------------
A0A8C4W4P8_BCL2A1-      ---------------catttttcactgc----------------------
A0A8C3RME9_BCL2A1-      ---------------catttttcactgc----------------------
A0A674K8Q6_BCL2A1-      ---------------catttttcactgt----------------------
A0A8C6VPU0_BCL2A1-      ---------------aggagctcctggg----------------------
A0A8C5SDG4_BCL2A1-      ---------------agaaactcctggg----------------------
A0A670YDS2_BCL2A1-      ---------------agaaactcctggg----------------------
A0A8D0H8G3_BCL2A1-      ---------------aaaagtccctggc----------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      ---------------aagaagccttgtcagcggcagagggtctggatctc
A0A670JXJ0_BCL2A1-      ---------------aagaagccttgtcagcggcagagggtctggatctc
A0A670JXJ0_BCL2A1-      ---------------aagagtccctggc----------------------
F6S8G3_BCL2A1-01        ----------aaaaga-------ccgtctggt------------------
A0A8C5VB12_BCL2A1-      ----------ag---g------cctgcctggc------------------
A0A286XUI2_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A8C2UN30_BCL2A1-      ----------aa---a------tttggctggc------------------
A0A8C5L8K1_BCL2A1-      ----------ac---c------tctggctggc------------------
F6SFL4_BCL2A1-01        ----------aa---tacagtg------tggc------------------
A0A4X2KFL7_BCL2A1-      ----------aa---tatggtg------tggc------------------
A0A7N4P573_BCL2A1-      ----------aa---cagggaaaccgcctggg------------------
A0A7N4P573_BCL2A1-      ----------aa---tatggta------tggc------------------
A0A7N4P573_BCL2A1-      ----------aa---cagggaaaccgcctggg------------------
A0A7N4P573_BCL2A1-      ----------aa---cagggaaaccgcctggg------------------
A0A8C0KQ53_BCL2A1-      ----------aa---g------tctggatggc------------------
A0A8C0MTY3_BCL2A1-      ----------aa---g------tctggatggc------------------
A0A8I3MYG9_BCL2A1-      ----------aa---g------tctggatggc------------------
M3YVH4_BCL2A1-01        ----------aa---g------tccggctggc------------------
U6CQS8_BCL2A1-01        ----------aa---g------tccggctggc------------------
A0A452U285_BCL2A1-      ----------ag---g------gc--------------------------
G1LIJ8_BCL2A1-01        ----------aa---g------tctggctggc------------------
A0A452SIR9_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A452U285_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A5F9CXI7_BCL2A1-      ----------ca---gagaatctccatcttcc------------------
A0A5F9CXI7_BCL2A1-      ----------ca---gagaatctccatcttcc------------------
A0A5F9CXI7_BCL2A1-      ----------ca---gagaatctccatcttcc------------------
A0A5F9CXI7_BCL2A1-      ----------ca---gagaatctccatcttcc------------------
A0A8C8X938_BCL2A1-      ----------at---c------tttg--tgcc------------------
M3WHW2_BCL2A1-01        ----------aa---g------tctggctggc------------------
A0A667HQV5_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C9KZ34_BCL2A1-      ----------aa---g------c---------------------------
A0A8C8X938_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C9KZ34_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C0WAG3_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C6QF32_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C6R201_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C6GN16_BCL2A1-      tatcggtgtact---a------tgtgccagtc------------------
G3V977_BCL2A1-01        ----------aa---a------tctggctggc------------------
Q925A9_BCL2A1-01        ----------aa---a------tctggctggc------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ----------aa---a------tctggctggc------------------
O55179_BCL2A1-01        ----------aa---a------tctggctggc------------------
Q8K164_BCL2A1-01        ----------aa---a------tctggctggc------------------
Q4FK02_BCL2A1-01        ----------aa---a------tctggctggc------------------
O55177_BCL2A1-02        ----------aa---a------tctggctggc------------------
Q497M6_BCL2A1-01        ----------aa---a------tctggctggc------------------
A0A8C2LQI3_BCL2A1-      ----------aa---a------tctggctggg------------------
A0A8C8U2B9_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A8D2B7G1_BCL2A1-      ----------aa---a------tcgggctggt------------------
A0A8C5YJP3_BCL2A1-      ----------aa---a------tctggctggt------------------
I3MCZ7_BCL2A1-01        ----------aa---a------tctggctggt------------------
A0A8C9PIV7_BCL2A1-      ----------aa---a------tctggctggt------------------
A0A8D2IK51_BCL2A1-      ----------aa---a------tctggctggt------------------
A0A8C9DF25_BCL2A1-      ----------ag---a------cctggctggc------------------
A0A2K6EKG1_BCL2A1-      ----------ag---a------cctgcctggc------------------
A0A8C6MJ03_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A8B9YDG7_BCL2A1-      ----------gt---g------tccatctttc------------------
A0A8B9YDG7_BCL2A1-      ----------gt---g------tccatctttc------------------
A0A8B9YDG7_BCL2A1-      ----------gt---g------tccatctttc------------------
A0A8B9YDG7_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A452EK63_BCL2A1-      ----------aa---a------tctggctggc------------------
W5Q0N6_BCL2A1-01        ----------aa---a------tctggctggc------------------
A0A671FLY8_BCL2A1-      ----------aa---a------tctggctggc------------------
H0WZ23_BCL2A1-01        ----------aactctggctactctggctggc------------------
F7HXW0_BCL2A1-01        ----------aa---a------tctggctgga------------------
F7HXW0_BCL2A1-02        ----------ta---t------gctagt---a------------------
A0A2K6TLG6_BCL2A1-      ----------ta---t------gctag-----------------------
A0A2K6TLG6_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K5D2I1_BCL2A1-      ----------tg---t------gctggtggag------------------
A0A2I3GQS0_BCL2A1-      ----------at---g-------ctggtagag------------------
A0A2I3GQS0_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2I3GQS0_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K5KAA3_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A8D2E7F6_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A8C9HCC9_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K6AD27_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A0D9RRC3_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K6LV19_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K6PHF2_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K5KHH8_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K6DS18_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K5KHH8_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2K5TMD1_BCL2A1-      ----------aa---a------tctggctgga------------------
F7E8V5_BCL2A1-01        ----------aa---a------tctggctgga------------------
A0A2K5KAA3_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K6LV19_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K6PHF2_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K6AD27_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K5KHH8_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K5TMD1_BCL2A1-      ----------at---g-------ctagtagag------------------
A0A2K6DS18_BCL2A1-      ----------at---g-------ctagtagag------------------
H2NNZ9_BCL2A1-01        ----------at---g-------ctggtagag------------------
B4E1X9_BCL2A1-03        ----------ct---t------tcctgtgaaa------------------
A0A2R8ZJ66_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2R8ZJ66_BCL2A1-      ----------aa---a------tctggctgga------------------
B4E1X9_BCL2A1-02        ----------aa---a------tctggctgga------------------
A0A2I2YJV4_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2I2YJV4_BCL2A1-      ----------aa---a------tctggctgga------------------
A0A2R8ZJ66_BCL2A1-      ----------at---g-------ctggtagag------------------
A0A2I2YJV4_BCL2A1-      ----------at---g-------ctggtagag------------------
B4E1X9_BCL2A1-01        ----------at---g-------ctggtagag------------------
G3T8E6_BCL2A1-01        ----------ag---g------tctggctggc------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D0Z1Y4_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D1SK15_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A4X1UP21_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D1BRF8_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D1YBS8_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A4X1UP21_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D1SK15_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D0Z1Y4_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8D1YBS8_BCL2A1-      ----------aa---aagaatttccatctttc------------------
A0A8C0CSU7_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A8C6FDW6_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A8C9BC20_BCL2A1-      ----------aa---g------tctggctggc------------------
A0A5F5PK00_BCL2A1-      ----------aa---aaggatttccatctttc------------------
A0A8C4PQL1_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A5F5PK00_BCL2A1-      ----------aa---a------tctggctggc------------------
A0A5F5PK00_BCL2A1-      ----------aa---aaggatttccatctttc------------------
A0A5F5PK00_BCL2A1-      ----------aa---aaggatttccatctttc------------------
A0A5F5PK00_BCL2A1-      ----------aa---aaggatttccatctttc------------------
                                                                          

A0A673TDC6_BCL2A1-      -----------------tgagcat--------------------------
A0A8B9S513_BCL2A1-      -----------------tgtctct--------------------------
A0A8C6ZVQ3_BCL2A1-      -----------------tatctct--------------------------
A0A8C5X4L3_BCL2A1-      -----------------tgtcttt--------------------------
H0ZCL9_BCL2A1-01        -----------------tgtcctt--------------------------
A0A8C5J3C4_BCL2A1-      -----------------tgtcctt--------------------------
A0A8D2QAC0_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C9MQN0_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C3NVU4_BCL2A1-      -----------------tgtcttt--------------------------
A0A8D2PM01_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C0UPM3_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C0UPM3_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C3U920_BCL2A1-      -----------------tgtcttt--------------------------
A0A803V184_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C2UCW6_BCL2A1-      -----------------tgtcttt--------------------------
G1N8C5_BCL2A1-01        -----------------tatcttt--------------------------
A0A8C3KTI3_BCL2A1-      -----------------tatcttt--------------------------
A0A669PVQ4_BCL2A1-      -----------------tatcttt--------------------------
A0A8B9CVY0_BCL2A1-      -----------------tgtcttt--------------------------
A0A8B9E009_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C3BNR4_BCL2A1-      -----------------tgtcttt--------------------------
A0A493SSZ7_BCL2A1-      -----------------tgtcttt--------------------------
A0A8B9UZT1_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C3K1C5_BCL2A1-      -----------------tgtcttt--------------------------
A0A8B9FJB5_BCL2A1-      -----------------tgtcttt--------------------------
A0A672UHF9_BCL2A1-      -----------------tgtcttt--------------------------
A0A8C4U5U5_BCL2A1-      -----------------tatcttt--------------------------
A0A8B9Z3D5_BCL2A1-      -----------------tatcttt--------------------------
A0A8B9RZD1_BCL2A1-      -----------------tatcttt--------------------------
A0A663E5S6_BCL2A1-      -----------------tatcttt--------------------------
A0A8C8AIP7_BCL2A1-      -----------------tatcttt--------------------------
A0A663N622_BCL2A1-      -----------------tatcttt--------------------------
A0A8C0EQC0_BCL2A1-      -----------------tatcttt--------------------------
A0A8D0ELW8_BCL2A1-      -----------------tatcttt--------------------------
A0A8D0EB90_BCL2A1-      -----------------t--------------------------------
A0A7M4FFQ8_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C8SUC3_BCL2A1-      -----------------tat------------------------------
K7G130_BCL2A1-01        -----------------tgtcatt--------------------------
A0A8C3FIW3_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C0G393_BCL2A1-      -----------------tgtcctt--------------------------
A0A452J3N6_BCL2A1-      -----------------tgtcctt--------------------------
A0A8C4W4P8_BCL2A1-      -----------------tatct----------------------------
A0A8C3RME9_BCL2A1-      -----------------tgtct----------------------------
A0A674K8Q6_BCL2A1-      -----------------tgtct----------------------------
A0A8C6VPU0_BCL2A1-      -----------------tatcctt--------------------------
A0A8C5SDG4_BCL2A1-      -----------------tatcctt--------------------------
A0A670YDS2_BCL2A1-      -----------------tatcctt--------------------------
A0A8D0H8G3_BCL2A1-      -----------------tgtcctt--------------------------
A0A8D2Q8F9_BCL2A1-      -----------------tagtttt--------------------------
A0A670JXJ0_BCL2A1-      atcctcgtgccaggacttggttttgaccaaaccggcaacagactgggaag
A0A670JXJ0_BCL2A1-      atcctcgtgccaggacttggttttgaccaaaccggcaacagactgggaag
A0A670JXJ0_BCL2A1-      -----------------tggccttg-------------------------
F6S8G3_BCL2A1-01        -----------------cggtgtt--------------------------
A0A8C5VB12_BCL2A1-      -----------------tgacttt--------------------------
A0A286XUI2_BCL2A1-      -----------------tgacttt--------------------------
A0A8C2UN30_BCL2A1-      -----------------tgacctt--------------------------
A0A8C5L8K1_BCL2A1-      -----------------tggtgct--------------------------
F6SFL4_BCL2A1-01        -----------------cgaactt--------------------------
A0A4X2KFL7_BCL2A1-      -----------------caaactt--------------------------
A0A7N4P573_BCL2A1-      -----------------aaggggg--------------------------
A0A7N4P573_BCL2A1-      -----------------caaactt--------------------------
A0A7N4P573_BCL2A1-      -----------------aaggggg--------------------------
A0A7N4P573_BCL2A1-      -----------------aaggggg--------------------------
A0A8C0KQ53_BCL2A1-      -----------------tgacttt--------------------------
A0A8C0MTY3_BCL2A1-      -----------------tgacttt--------------------------
A0A8I3MYG9_BCL2A1-      -----------------tgacttt--------------------------
M3YVH4_BCL2A1-01        -----------------tgacctt--------------------------
U6CQS8_BCL2A1-01        -----------------tgacctt--------------------------
A0A452U285_BCL2A1-      ----------------------cc--------------------------
G1LIJ8_BCL2A1-01        -----------------tgacttt--------------------------
A0A452SIR9_BCL2A1-      -----------------tgacttt--------------------------
A0A452U285_BCL2A1-      -----------------tgacttt--------------------------
A0A5F9CXI7_BCL2A1-      -----------------tgagcat--------------------------
A0A5F9CXI7_BCL2A1-      -----------------tgagcat--------------------------
A0A5F9CXI7_BCL2A1-      -----------------tgagcat--------------------------
A0A5F9CXI7_BCL2A1-      -----------------tgagcat--------------------------
A0A8C8X938_BCL2A1-      -----------------gggtct---------------------------
M3WHW2_BCL2A1-01        -----------------tgacctt--------------------------
A0A667HQV5_BCL2A1-      -----------------tgacctt--------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      -----------------tgacctt--------------------------
A0A8C9KZ34_BCL2A1-      -----------------tgacctt--------------------------
A0A8C0WAG3_BCL2A1-      -----------------tgacttt--------------------------
A0A8C6QF32_BCL2A1-      -----------------tgacttt--------------------------
A0A8C6R201_BCL2A1-      -----------------tgacttt--------------------------
A0A8C6GN16_BCL2A1-      -----------------tgctttg--------------------------
G3V977_BCL2A1-01        -----------------tgacttt--------------------------
Q925A9_BCL2A1-01        -----------------tgacttt--------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      -----------------tgacttt--------------------------
O55179_BCL2A1-01        -----------------tgacttt--------------------------
Q8K164_BCL2A1-01        -----------------tgacttt--------------------------
Q4FK02_BCL2A1-01        -----------------tgacttt--------------------------
O55177_BCL2A1-02        -----------------tgacttt--------------------------
Q497M6_BCL2A1-01        -----------------tgacttt--------------------------
A0A8C2LQI3_BCL2A1-      -----------------tgacttt--------------------------
A0A8C8U2B9_BCL2A1-      -----------------tgacctt--------------------------
A0A8D2B7G1_BCL2A1-      -----------------tgacttt--------------------------
A0A8C5YJP3_BCL2A1-      -----------------tgacttt--------------------------
I3MCZ7_BCL2A1-01        -----------------tgacttt--------------------------
A0A8C9PIV7_BCL2A1-      -----------------tgacttt--------------------------
A0A8D2IK51_BCL2A1-      -----------------tgacttt--------------------------
A0A8C9DF25_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6EKG1_BCL2A1-      -----------------tgacttt--------------------------
A0A8C6MJ03_BCL2A1-      -----------------tga------------------------------
A0A8B9YDG7_BCL2A1-      -----------------tgagcat--------------------------
A0A8B9YDG7_BCL2A1-      -----------------tgagcat--------------------------
A0A8B9YDG7_BCL2A1-      -----------------tgagcat--------------------------
A0A8B9YDG7_BCL2A1-      -----------------tga------------------------------
A0A452EK63_BCL2A1-      -----------------tga------------------------------
W5Q0N6_BCL2A1-01        -----------------tga------------------------------
A0A671FLY8_BCL2A1-      -----------------tgacttt--------------------------
H0WZ23_BCL2A1-01        -----------------tgacttt--------------------------
F7HXW0_BCL2A1-01        -----------------tgacttt--------------------------
F7HXW0_BCL2A1-02        -----------------tcagtgg--------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -----------------tgacttt--------------------------
A0A2K5D2I1_BCL2A1-      -----------------tcagtgg--------------------------
A0A2I3GQS0_BCL2A1-      -----------------tcagtgg--------------------------
A0A2I3GQS0_BCL2A1-      -----------------tgacttt--------------------------
A0A2I3GQS0_BCL2A1-      -----------------tgacttt--------------------------
A0A2K5KAA3_BCL2A1-      -----------------tgacttt--------------------------
A0A8D2E7F6_BCL2A1-      -----------------tgacttt--------------------------
A0A8C9HCC9_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6AD27_BCL2A1-      -----------------tgacttt--------------------------
A0A0D9RRC3_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6LV19_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6PHF2_BCL2A1-      -----------------tgacttt--------------------------
A0A2K5KHH8_BCL2A1-      -----------------tgacttt--------------------------
A0A2K6DS18_BCL2A1-      -----------------tgacttt--------------------------
A0A2K5KHH8_BCL2A1-      -----------------tgacttt--------------------------
A0A2K5TMD1_BCL2A1-      -----------------tgacttt--------------------------
F7E8V5_BCL2A1-01        -----------------tgacttt--------------------------
A0A2K5KAA3_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K6LV19_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K6PHF2_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K6AD27_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K5KHH8_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K5TMD1_BCL2A1-      -----------------tcagtgg--------------------------
A0A2K6DS18_BCL2A1-      -----------------tcagtgg--------------------------
H2NNZ9_BCL2A1-01        -----------------tcagtgg--------------------------
B4E1X9_BCL2A1-03        -----------------t--------------------------------
A0A2R8ZJ66_BCL2A1-      -----------------tgacttt--------------------------
A0A2R8ZJ66_BCL2A1-      -----------------tgacttt--------------------------
B4E1X9_BCL2A1-02        -----------------tgacttt--------------------------
A0A2I2YJV4_BCL2A1-      -----------------tgacttt--------------------------
A0A2I2YJV4_BCL2A1-      -----------------tgacttt--------------------------
A0A2R8ZJ66_BCL2A1-      -----------------tcagtgg--------------------------
A0A2I2YJV4_BCL2A1-      -----------------tcagtgg--------------------------
B4E1X9_BCL2A1-01        -----------------tcagtgg--------------------------
G3T8E6_BCL2A1-01        -----------------tgacttt--------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -----------------tgagcat--------------------------
A0A8D0Z1Y4_BCL2A1-      -----------------tgagcat--------------------------
A0A8D1SK15_BCL2A1-      -----------------tgagcat--------------------------
A0A4X1UP21_BCL2A1-      -----------------tgagcat--------------------------
A0A8D1BRF8_BCL2A1-      -----------------tgagcat--------------------------
A0A8D1YBS8_BCL2A1-      -----------------tgagcat--------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -----------------tgagcat--------------------------
A0A4X1UP21_BCL2A1-      -----------------tgagcat--------------------------
A0A8D1SK15_BCL2A1-      -----------------tgagcat--------------------------
A0A8D0Z1Y4_BCL2A1-      -----------------tgagcat--------------------------
A0A8D1YBS8_BCL2A1-      -----------------tgagcat--------------------------
A0A8C0CSU7_BCL2A1-      -----------------tgacttt--------------------------
A0A8C6FDW6_BCL2A1-      -----------------tgacttt--------------------------
A0A8C9BC20_BCL2A1-      -----------------tgacttt--------------------------
A0A5F5PK00_BCL2A1-      -----------------tgagcat--------------------------
A0A8C4PQL1_BCL2A1-      -----------------tgacttt--------------------------
A0A5F5PK00_BCL2A1-      -----------------tgacttt--------------------------
A0A5F5PK00_BCL2A1-      -----------------tgagcat--------------------------
A0A5F5PK00_BCL2A1-      -----------------tgagcat--------------------------
A0A5F5PK00_BCL2A1-      -----------------tgagcat--------------------------
                                                                          

A0A673TDC6_BCL2A1-      ---------------------------------------g----------
A0A8B9S513_BCL2A1-      ---------------------------------------c----------
A0A8C6ZVQ3_BCL2A1-      ---------------------------------------c----------
A0A8C5X4L3_BCL2A1-      ---------------------------------------c----------
H0ZCL9_BCL2A1-01        ---------------------------------------c----------
A0A8C5J3C4_BCL2A1-      ---------------------------------------c----------
A0A8D2QAC0_BCL2A1-      ---------------------------------------c----------
A0A8C9MQN0_BCL2A1-      ---------------------------------------c----------
A0A8C3NVU4_BCL2A1-      ---------------------------------------c----------
A0A8D2PM01_BCL2A1-      ---------------------------------------c----------
A0A8C0UPM3_BCL2A1-      ---------------------------------------c----------
A0A8C0UPM3_BCL2A1-      ---------------------------------------c----------
A0A8C3U920_BCL2A1-      ---------------------------------------c----------
A0A803V184_BCL2A1-      ---------------------------------------c----------
A0A8C2UCW6_BCL2A1-      ---------------------------------------c----------
G1N8C5_BCL2A1-01        ---------------------------------------c----------
A0A8C3KTI3_BCL2A1-      ---------------------------------------c----------
A0A669PVQ4_BCL2A1-      ---------------------------------------c----------
A0A8B9CVY0_BCL2A1-      ---------------------------------------c----------
A0A8B9E009_BCL2A1-      ---------------------------------------c----------
A0A8C3BNR4_BCL2A1-      ---------------------------------------c----------
A0A493SSZ7_BCL2A1-      ---------------------------------------c----------
A0A8B9UZT1_BCL2A1-      ---------------------------------------c----------
A0A8C3K1C5_BCL2A1-      ---------------------------------------c----------
A0A8B9FJB5_BCL2A1-      ---------------------------------------c----------
A0A672UHF9_BCL2A1-      ---------------------------------------c----------
A0A8C4U5U5_BCL2A1-      ---------------------------------------c----------
A0A8B9Z3D5_BCL2A1-      ---------------------------------------c----------
A0A8B9RZD1_BCL2A1-      ---------------------------------------c----------
A0A663E5S6_BCL2A1-      ---------------------------------------c----------
A0A8C8AIP7_BCL2A1-      ---------------------------------------c----------
A0A663N622_BCL2A1-      ---------------------------------------c----------
A0A8C0EQC0_BCL2A1-      ---------------------------------------c----------
A0A8D0ELW8_BCL2A1-      ---------------------------------------c----------
A0A8D0EB90_BCL2A1-      ---------------------------------------a----------
A0A7M4FFQ8_BCL2A1-      ---------------------------------------a----------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        ---------------------------------------a----------
A0A8C3FIW3_BCL2A1-      ---------------------------------------a----------
A0A8C0G393_BCL2A1-      ---------------------------------------a----------
A0A452J3N6_BCL2A1-      ---------------------------------------a----------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      ---------------------------------------a----------
A0A8C5SDG4_BCL2A1-      ---------------------------------------a----------
A0A670YDS2_BCL2A1-      ---------------------------------------a----------
A0A8D0H8G3_BCL2A1-      ---------------------------------------a----------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      aggaaaggggtactatgatacatacctgaacaggtgcaga----------
A0A670JXJ0_BCL2A1-      aggaaaggggtactatgatacatacctgaacaggtgcaga----------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        ---------------------------------------a----------
A0A8C5VB12_BCL2A1-      ---------------------------------------t----------
A0A286XUI2_BCL2A1-      ---------------------------------------t----------
A0A8C2UN30_BCL2A1-      ---------------------------------------c----------
A0A8C5L8K1_BCL2A1-      ---------------------------------------t----------
F6SFL4_BCL2A1-01        ---------------------------------------c----------
A0A4X2KFL7_BCL2A1-      ---------------------------------------c----------
A0A7N4P573_BCL2A1-      ---------------------------------------a----------
A0A7N4P573_BCL2A1-      ---------------------------------------c----------
A0A7N4P573_BCL2A1-      ---------------------------------------a----------
A0A7N4P573_BCL2A1-      ---------------------------------------a----------
A0A8C0KQ53_BCL2A1-      ---------------------------------------t----------
A0A8C0MTY3_BCL2A1-      ---------------------------------------t----------
A0A8I3MYG9_BCL2A1-      ---------------------------------------t----------
M3YVH4_BCL2A1-01        ---------------------------------------t----------
U6CQS8_BCL2A1-01        ---------------------------------------t----------
A0A452U285_BCL2A1-      ---------------------------------------c----------
G1LIJ8_BCL2A1-01        ---------------------------------------t----------
A0A452SIR9_BCL2A1-      ---------------------------------------t----------
A0A452U285_BCL2A1-      ---------------------------------------t----------
A0A5F9CXI7_BCL2A1-      ---------------------------------------g----------
A0A5F9CXI7_BCL2A1-      ---------------------------------------g----------
A0A5F9CXI7_BCL2A1-      ---------------------------------------g----------
A0A5F9CXI7_BCL2A1-      ---------------------------------------g----------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        ---------------------------------------t----------
A0A667HQV5_BCL2A1-      ---------------------------------------t----------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      ---------------------------------------t----------
A0A8C9KZ34_BCL2A1-      ---------------------------------------t----------
A0A8C0WAG3_BCL2A1-      ---------------------------------------t----------
A0A8C6QF32_BCL2A1-      ---------------------------------------t----------
A0A8C6R201_BCL2A1-      ---------------------------------------t----------
A0A8C6GN16_BCL2A1-      ---------------------------------------taaggctataa
G3V977_BCL2A1-01        ---------------------------------------t----------
Q925A9_BCL2A1-01        ---------------------------------------t----------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ---------------------------------------t----------
O55179_BCL2A1-01        ---------------------------------------t----------
Q8K164_BCL2A1-01        ---------------------------------------t----------
Q4FK02_BCL2A1-01        ---------------------------------------t----------
O55177_BCL2A1-02        ---------------------------------------t----------
Q497M6_BCL2A1-01        ---------------------------------------t----------
A0A8C2LQI3_BCL2A1-      ---------------------------------------t----------
A0A8C8U2B9_BCL2A1-      ---------------------------------------t----------
A0A8D2B7G1_BCL2A1-      ---------------------------------------t----------
A0A8C5YJP3_BCL2A1-      ---------------------------------------t----------
I3MCZ7_BCL2A1-01        ---------------------------------------t----------
A0A8C9PIV7_BCL2A1-      ---------------------------------------t----------
A0A8D2IK51_BCL2A1-      ---------------------------------------t----------
A0A8C9DF25_BCL2A1-      ---------------------------------------t----------
A0A2K6EKG1_BCL2A1-      ---------------------------------------t----------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ---------------------------------------g----------
A0A8B9YDG7_BCL2A1-      ---------------------------------------g----------
A0A8B9YDG7_BCL2A1-      ---------------------------------------g----------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      ---------------------------------------t----------
H0WZ23_BCL2A1-01        ---------------------------------------t----------
F7HXW0_BCL2A1-01        ---------------------------------------t----------
F7HXW0_BCL2A1-02        ---------------------------------------c----------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      ---------------------------------------t----------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ---------------------------------------t----------
A0A2K5D2I1_BCL2A1-      ---------------------------------------c----------
A0A2I3GQS0_BCL2A1-      ---------------------------------------c----------
A0A2I3GQS0_BCL2A1-      ---------------------------------------t----------
A0A2I3GQS0_BCL2A1-      ---------------------------------------t----------
A0A2K5KAA3_BCL2A1-      ---------------------------------------t----------
A0A8D2E7F6_BCL2A1-      ---------------------------------------t----------
A0A8C9HCC9_BCL2A1-      ---------------------------------------t----------
A0A2K6AD27_BCL2A1-      ---------------------------------------t----------
A0A0D9RRC3_BCL2A1-      ---------------------------------------t----------
A0A2K6LV19_BCL2A1-      ---------------------------------------t----------
A0A2K6PHF2_BCL2A1-      ---------------------------------------t----------
A0A2K5KHH8_BCL2A1-      ---------------------------------------t----------
A0A2K6DS18_BCL2A1-      ---------------------------------------t----------
A0A2K5KHH8_BCL2A1-      ---------------------------------------t----------
A0A2K5TMD1_BCL2A1-      ---------------------------------------t----------
F7E8V5_BCL2A1-01        ---------------------------------------t----------
A0A2K5KAA3_BCL2A1-      ---------------------------------------c----------
A0A2K6LV19_BCL2A1-      ---------------------------------------c----------
A0A2K6PHF2_BCL2A1-      ---------------------------------------c----------
A0A2K6AD27_BCL2A1-      ---------------------------------------c----------
A0A2K5KHH8_BCL2A1-      ---------------------------------------c----------
A0A2K5TMD1_BCL2A1-      ---------------------------------------c----------
A0A2K6DS18_BCL2A1-      ---------------------------------------c----------
H2NNZ9_BCL2A1-01        ---------------------------------------c----------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      ---------------------------------------t----------
A0A2R8ZJ66_BCL2A1-      ---------------------------------------t----------
B4E1X9_BCL2A1-02        ---------------------------------------t----------
A0A2I2YJV4_BCL2A1-      ---------------------------------------t----------
A0A2I2YJV4_BCL2A1-      ---------------------------------------t----------
A0A2R8ZJ66_BCL2A1-      ---------------------------------------c----------
A0A2I2YJV4_BCL2A1-      ---------------------------------------c----------
B4E1X9_BCL2A1-01        ---------------------------------------c----------
G3T8E6_BCL2A1-01        ---------------------------------------t----------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ---------------------------------------g----------
A0A8D0Z1Y4_BCL2A1-      ---------------------------------------g----------
A0A8D1SK15_BCL2A1-      ---------------------------------------g----------
A0A4X1UP21_BCL2A1-      ---------------------------------------g----------
A0A8D1BRF8_BCL2A1-      ---------------------------------------g----------
A0A8D1YBS8_BCL2A1-      ---------------------------------------g----------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ---------------------------------------g----------
A0A4X1UP21_BCL2A1-      ---------------------------------------g----------
A0A8D1SK15_BCL2A1-      ---------------------------------------g----------
A0A8D0Z1Y4_BCL2A1-      ---------------------------------------g----------
A0A8D1YBS8_BCL2A1-      ---------------------------------------g----------
A0A8C0CSU7_BCL2A1-      ---------------------------------------t----------
A0A8C6FDW6_BCL2A1-      ---------------------------------------t----------
A0A8C9BC20_BCL2A1-      ---------------------------------------t----------
A0A5F5PK00_BCL2A1-      ---------------------------------------g----------
A0A8C4PQL1_BCL2A1-      ---------------------------------------t----------
A0A5F5PK00_BCL2A1-      ---------------------------------------t----------
A0A5F5PK00_BCL2A1-      ---------------------------------------g----------
A0A5F5PK00_BCL2A1-      ---------------------------------------g----------
A0A5F5PK00_BCL2A1-      ---------------------------------------g----------
                                                                          

A0A673TDC6_BCL2A1-      ---------caagacgaagtcga--------gaccgaagagatcatcagg
A0A8B9S513_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8C6ZVQ3_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C5X4L3_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
H0ZCL9_BCL2A1-01        ---------tccaaaattacagc--------cc-----------------
A0A8C5J3C4_BCL2A1-      ---------tccaaaatcacagc--------cc-----------------
A0A8D2QAC0_BCL2A1-      ---------tccaaaatcacagc--------cc-----------------
A0A8C9MQN0_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C3NVU4_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8D2PM01_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C0UPM3_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C0UPM3_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C3U920_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A803V184_BCL2A1-      ---------tccaaaattacagc--------cc-----------------
A0A8C2UCW6_BCL2A1-      ---------tctacaattacaga--------ca-----------------
G1N8C5_BCL2A1-01        ---------tctacaattacaga--------ca-----------------
A0A8C3KTI3_BCL2A1-      ---------tccacaattacaga--------ca-----------------
A0A669PVQ4_BCL2A1-      ---------tctacaattacaga--------ca-----------------
A0A8B9CVY0_BCL2A1-      ---------tccaaaattacaga--------ca-----------------
A0A8B9E009_BCL2A1-      ---------tccaaaattacaga--------ca-----------------
A0A8C3BNR4_BCL2A1-      ---------tccaaaattacaga--------ct-----------------
A0A493SSZ7_BCL2A1-      ---------tccaaaattacaga--------ct-----------------
A0A8B9UZT1_BCL2A1-      ---------tccaaaattacaga--------ct-----------------
A0A8C3K1C5_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8B9FJB5_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A672UHF9_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8C4U5U5_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8B9Z3D5_BCL2A1-      ---------tccaaaatcacagc--------ca-----------------
A0A8B9RZD1_BCL2A1-      ---------tccaaaatcacagc--------ca-----------------
A0A663E5S6_BCL2A1-      ---------tccaaaatcacagc--------ca-----------------
A0A8C8AIP7_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A663N622_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8C0EQC0_BCL2A1-      ---------tcaaaaattacagc--------ca-----------------
A0A8D0ELW8_BCL2A1-      ---------tccaaaattacagc--------ca-----------------
A0A8D0EB90_BCL2A1-      ---------tttaacacca-------------------------------
A0A7M4FFQ8_BCL2A1-      ---------tttgatgtgaaggc--------aa-----------------
A0A8C8SUC3_BCL2A1-      -------------gagttagaggcgcttcatac-----------------
K7G130_BCL2A1-01        ---------ttcaacattaaagc--------aa-----------------
A0A8C3FIW3_BCL2A1-      ---------ttcaacattaaagc--------aa-----------------
A0A8C0G393_BCL2A1-      ---------ttcaatattaaagc--------aa-----------------
A0A452J3N6_BCL2A1-      ---------ttcaatattaaagc--------aa-----------------
A0A8C4W4P8_BCL2A1-      -------------agatcagaag--------aa-----------------
A0A8C3RME9_BCL2A1-      -------------agatcagaag--------aa-----------------
A0A674K8Q6_BCL2A1-      -------------agatcaggag--------aa-----------------
A0A8C6VPU0_BCL2A1-      ---------tccactctgaagac--------aa-----------------
A0A8C5SDG4_BCL2A1-      ---------tccactctgaagac--------aa-----------------
A0A670YDS2_BCL2A1-      ---------tctactctgaagac--------aa-----------------
A0A8D0H8G3_BCL2A1-      ---------tttgacattaagac--------aa-----------------
A0A8D2Q8F9_BCL2A1-      ------------catcctcaatg---------------------------
A0A670JXJ0_BCL2A1-      ---------cagcatcccaaagg--------aa-----------------
A0A670JXJ0_BCL2A1-      ---------cagcatcccaaagg--------aa-----------------
A0A670JXJ0_BCL2A1-      ---------cactacatcaagac--------aa-----------------
F6S8G3_BCL2A1-01        ---------gcggatatttcgat--------ga-----------------
A0A8C5VB12_BCL2A1-      ---------ctggaagtcttggg--------ga-----------------
A0A286XUI2_BCL2A1-      ---------gtgggagttatggg--------ac-----------------
A0A8C2UN30_BCL2A1-      ---------gtgggagttctggg--------ac-----------------
A0A8C5L8K1_BCL2A1-      ---------ctggatgttgcagg--------ac-----------------
F6SFL4_BCL2A1-01        ---------acagatatttcaac--------aa-----------------
A0A4X2KFL7_BCL2A1-      ---------acggatatttcaac--------aa-----------------
A0A7N4P573_BCL2A1-      ---------agggatactatgac--------ac-----------------
A0A7N4P573_BCL2A1-      ---------acagatatttcaac--------aa-----------------
A0A7N4P573_BCL2A1-      ---------agggatactatgac--------ac-----------------
A0A7N4P573_BCL2A1-      ---------agggatactatgac--------ac-----------------
A0A8C0KQ53_BCL2A1-      ---------ctggaagttctggg--------aa-----------------
A0A8C0MTY3_BCL2A1-      ---------ctggaagttctggg--------aa-----------------
A0A8I3MYG9_BCL2A1-      ---------ctggaagttctggg--------aa-----------------
M3YVH4_BCL2A1-01        ---------ctggaagttatagg--------aa-----------------
U6CQS8_BCL2A1-01        ---------ctggaagttacagg--------aa-----------------
A0A452U285_BCL2A1-      ---------cggcaggtctgaga--------gg-----------------
G1LIJ8_BCL2A1-01        ---------ctggaagttacggg--------ga-----------------
A0A452SIR9_BCL2A1-      ---------ctggaagttacggg--------ga-----------------
A0A452U285_BCL2A1-      ---------ctggaagttatggg--------ga-----------------
A0A5F9CXI7_BCL2A1-      ---------ccggatgaaatcga--------gacagaagagatcatcaag
A0A5F9CXI7_BCL2A1-      ---------ccggatgaaatcga--------gacagaagagatcatcaag
A0A5F9CXI7_BCL2A1-      ---------ccggatgaaatcga--------gacagaagagatcatcaag
A0A5F9CXI7_BCL2A1-      ---------ccggatgaaatcga--------gacagaagagatcatcaag
A0A8C8X938_BCL2A1-      ----------tgggtttgacaag--------ca-----------------
M3WHW2_BCL2A1-01        ---------ctggaagttacagg--------aa-----------------
A0A667HQV5_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A8C9KZ34_BCL2A1-      --------------agcgagggg--------ac-----------------
A0A8C8X938_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A8C9KZ34_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A8C0WAG3_BCL2A1-      ---------ctggaagtcataga--------aa-----------------
A0A8C6QF32_BCL2A1-      ---------ctggaagtcatggg--------ac-----------------
A0A8C6R201_BCL2A1-      ---------ctggaagtcatggg--------ac-----------------
A0A8C6GN16_BCL2A1-      tatctcacacagtaaattataag--------aa-----------------
G3V977_BCL2A1-01        ---------ctgcagatgacagg--------ga-----------------
Q925A9_BCL2A1-01        ---------ctgcagatgacagg--------ga-----------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ---------ctgcagatgacagg--------ac-----------------
O55179_BCL2A1-01        ---------ctgcagatgacagg--------ac-----------------
Q8K164_BCL2A1-01        ---------ctgcagatgacagg--------ac-----------------
Q4FK02_BCL2A1-01        ---------ctgcagatgacagg--------ac-----------------
O55177_BCL2A1-02        ---------ctgcagatgacagg--------ac-----------------
Q497M6_BCL2A1-01        ---------ctgcagatgacagg--------ac-----------------
A0A8C2LQI3_BCL2A1-      ---------ctggaaacgatagg--------gc-----------------
A0A8C8U2B9_BCL2A1-      ---------ctggaaatgacagg--------ac-----------------
A0A8D2B7G1_BCL2A1-      ---------ctgggaattacagg--------gc-----------------
A0A8C5YJP3_BCL2A1-      ---------ctgggagttacagg--------gc-----------------
I3MCZ7_BCL2A1-01        ---------ctgggagttacagg--------gc-----------------
A0A8C9PIV7_BCL2A1-      ---------ctgggagttacagg--------gc-----------------
A0A8D2IK51_BCL2A1-      ---------ctgggagttacagg--------gc-----------------
A0A8C9DF25_BCL2A1-      ---------ctggaagttacagg--------ga-----------------
A0A2K6EKG1_BCL2A1-      ---------ctggaagttacggg--------ga-----------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ---------ccagatgaaattga--------gacagaggagatcatcaag
A0A8B9YDG7_BCL2A1-      ---------ccagatgaaattga--------gacagaggagatcatcaag
A0A8B9YDG7_BCL2A1-      ---------ccagatgaaattga--------gacagaggagatcatcaag
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      ---------ctggaagttacagg--------ca-----------------
H0WZ23_BCL2A1-01        ---------ctggaagttacaag--------aa-----------------
F7HXW0_BCL2A1-01        ---------ctagaagttacagg--------aa-----------------
F7HXW0_BCL2A1-02        ---------ccagaagaagagga--------aa-----------------
A0A2K6TLG6_BCL2A1-      ----------tggagtcagcgca--------ga-----------------
A0A2K6TLG6_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K5D2I1_BCL2A1-      ---------ccagaaggagagga--------aa-----------------
A0A2I3GQS0_BCL2A1-      ---------ccacaag-aagagg--------a------------------
A0A2I3GQS0_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2I3GQS0_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K5KAA3_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A8D2E7F6_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A8C9HCC9_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K6AD27_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A0D9RRC3_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K6LV19_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K6PHF2_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K5KHH8_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K6DS18_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K5KHH8_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2K5TMD1_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
F7E8V5_BCL2A1-01        ---------ctagaagttacagg--------aa-----------------
A0A2K5KAA3_BCL2A1-      ---------ccacaagaagaaga--------aa-----------------
A0A2K6LV19_BCL2A1-      ---------ccataggaagaaga--------aa-----------------
A0A2K6PHF2_BCL2A1-      ---------ccacaagaagaaga--------aa-----------------
A0A2K6AD27_BCL2A1-      ---------ccacaggaagaaga--------aa-----------------
A0A2K5KHH8_BCL2A1-      ---------ccacaggaagaaga--------aa-----------------
A0A2K5TMD1_BCL2A1-      ---------ccac---aagaaga--------aa-----------------
A0A2K6DS18_BCL2A1-      ---------ccacaagaagaaga--------aa-----------------
H2NNZ9_BCL2A1-01        ---------ccacaagaagagga--------aa-----------------
B4E1X9_BCL2A1-03        --------------agaaattga--------ga-----------------
A0A2R8ZJ66_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
A0A2R8ZJ66_BCL2A1-      ---------ctagaagttacagg--------aa-----------------
B4E1X9_BCL2A1-02        ---------ctagaagttacagg--------aa-----------------
A0A2I2YJV4_BCL2A1-      ---------ctagaagttacggg--------aa-----------------
A0A2I2YJV4_BCL2A1-      ---------ctagaagttacggg--------aa-----------------
A0A2R8ZJ66_BCL2A1-      ---------ccacaagaagagga--------aa-----------------
A0A2I2YJV4_BCL2A1-      ---------ccacaagaagagga--------aa-----------------
B4E1X9_BCL2A1-01        ---------ccacaagaagagga--------aa-----------------
G3T8E6_BCL2A1-01        ---------ctggaagttacagg--------aa-----------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D0Z1Y4_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D1SK15_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A4X1UP21_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D1BRF8_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D1YBS8_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A4X1UP21_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D1SK15_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D0Z1Y4_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8D1YBS8_BCL2A1-      ---------ccagatgaaatcga--------gacggaagagatcatcagg
A0A8C0CSU7_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A8C6FDW6_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A8C9BC20_BCL2A1-      ---------ctggaagttacagg--------aa-----------------
A0A5F5PK00_BCL2A1-      ---------caagatgaaattga--------gacagaagagatcatcagg
A0A8C4PQL1_BCL2A1-      ---------ctggaagttactgg--------aa-----------------
A0A5F5PK00_BCL2A1-      ---------ctggaagttactgg--------aa-----------------
A0A5F5PK00_BCL2A1-      ---------caagatgaaattga--------gacagaagagatcatcagg
A0A5F5PK00_BCL2A1-      ---------caagatgaaattga--------gacagaagagatcatcagg
A0A5F5PK00_BCL2A1-      ---------caagatgaaattga--------gacagaagagatcatcagg
                                                                          

A0A673TDC6_BCL2A1-      gacatcttccggcaagggaaggcctgcttcnnnnnnnnnnnnnnnnnnnn
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        ------------------------------ag------------------
A0A8C5VB12_BCL2A1-      ------------------------------ag------------------
A0A286XUI2_BCL2A1-      ------------------------------ag------------------
A0A8C2UN30_BCL2A1-      ------------------------------ag------------------
A0A8C5L8K1_BCL2A1-      ------------------------------ac------------------
F6SFL4_BCL2A1-01        ------------------------------ag------------------
A0A4X2KFL7_BCL2A1-      ------------------------------ag------------------
A0A7N4P573_BCL2A1-      ------------------------------tt------------------
A0A7N4P573_BCL2A1-      ------------------------------ag------------------
A0A7N4P573_BCL2A1-      ------------------------------tt------------------
A0A7N4P573_BCL2A1-      ------------------------------tt------------------
A0A8C0KQ53_BCL2A1-      ------------------------------ca------------------
A0A8C0MTY3_BCL2A1-      ------------------------------ca------------------
A0A8I3MYG9_BCL2A1-      ------------------------------ca------------------
M3YVH4_BCL2A1-01        ------------------------------ag------------------
U6CQS8_BCL2A1-01        ------------------------------ag------------------
A0A452U285_BCL2A1-      ------------------------------ag------------------
G1LIJ8_BCL2A1-01        ------------------------------ag------------------
A0A452SIR9_BCL2A1-      ------------------------------ag------------------
A0A452U285_BCL2A1-      ------------------------------ag------------------
A0A5F9CXI7_BCL2A1-      gatatcttccagcaaggcaaagtctgctttat------------------
A0A5F9CXI7_BCL2A1-      gatatcttccagcaaggcaaagtctgctttat------------------
A0A5F9CXI7_BCL2A1-      gatatcttccagcaaggcaaagtctgctttat------------------
A0A5F9CXI7_BCL2A1-      gatatcttccagcaaggcaaagtctgctttat------------------
A0A8C8X938_BCL2A1-      ------------------------------tg------------------
M3WHW2_BCL2A1-01        ------------------------------ag------------------
A0A667HQV5_BCL2A1-      ------------------------------ag------------------
A0A8C9KZ34_BCL2A1-      ------------------------------ag------------------
A0A8C8X938_BCL2A1-      ------------------------------ag------------------
A0A8C9KZ34_BCL2A1-      ------------------------------ag------------------
A0A8C0WAG3_BCL2A1-      ------------------------------ag------------------
A0A8C6QF32_BCL2A1-      ------------------------------ag------------------
A0A8C6R201_BCL2A1-      ------------------------------ag------------------
A0A8C6GN16_BCL2A1-      ------------------------------aaaaaaaaaaaaaaagaaga
G3V977_BCL2A1-01        ------------------------------ag------------------
Q925A9_BCL2A1-01        ------------------------------ag------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      ------------------------------ag------------------
O55179_BCL2A1-01        ------------------------------ag------------------
Q8K164_BCL2A1-01        ------------------------------ag------------------
Q4FK02_BCL2A1-01        ------------------------------ag------------------
O55177_BCL2A1-02        ------------------------------ag------------------
Q497M6_BCL2A1-01        ------------------------------ag------------------
A0A8C2LQI3_BCL2A1-      ------------------------------ag------------------
A0A8C8U2B9_BCL2A1-      ------------------------------ag------------------
A0A8D2B7G1_BCL2A1-      ------------------------------ag------------------
A0A8C5YJP3_BCL2A1-      ------------------------------ag------------------
I3MCZ7_BCL2A1-01        ------------------------------ag------------------
A0A8C9PIV7_BCL2A1-      ------------------------------ag------------------
A0A8D2IK51_BCL2A1-      ------------------------------ag------------------
A0A8C9DF25_BCL2A1-      ------------------------------ag------------------
A0A2K6EKG1_BCL2A1-      ------------------------------ag------------------
A0A8C6MJ03_BCL2A1-      ---cttttctg---------------------------------------
A0A8B9YDG7_BCL2A1-      gacattttccgacaaggcaaaacctgctttat------------------
A0A8B9YDG7_BCL2A1-      gacattttccgacaaggcaaaacctgctttat------------------
A0A8B9YDG7_BCL2A1-      gacattttccgacaaggcaaaacctgctttat------------------
A0A8B9YDG7_BCL2A1-      ---cttttctg---------------------------------------
A0A452EK63_BCL2A1-      ---cttttctg---------------------------------------
W5Q0N6_BCL2A1-01        ---cttttctg---------------------------------------
A0A671FLY8_BCL2A1-      ------------------------------ag------------------
H0WZ23_BCL2A1-01        ------------------------------ag------------------
F7HXW0_BCL2A1-01        ------------------------------ag------------------
F7HXW0_BCL2A1-02        ------------------------------at------------------
A0A2K6TLG6_BCL2A1-      ------------------------------ag------------------
A0A2K6TLG6_BCL2A1-      ------------------------------ag------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      ------------------------------ag------------------
A0A2K5D2I1_BCL2A1-      ------------------------------at------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      ------------------------------ag------------------
A0A2I3GQS0_BCL2A1-      ------------------------------ag------------------
A0A2K5KAA3_BCL2A1-      ------------------------------ag------------------
A0A8D2E7F6_BCL2A1-      ------------------------------ag------------------
A0A8C9HCC9_BCL2A1-      ------------------------------ag------------------
A0A2K6AD27_BCL2A1-      ------------------------------ag------------------
A0A0D9RRC3_BCL2A1-      ------------------------------ag------------------
A0A2K6LV19_BCL2A1-      ------------------------------ag------------------
A0A2K6PHF2_BCL2A1-      ------------------------------ag------------------
A0A2K5KHH8_BCL2A1-      ------------------------------ag------------------
A0A2K6DS18_BCL2A1-      ------------------------------ag------------------
A0A2K5KHH8_BCL2A1-      ------------------------------ag------------------
A0A2K5TMD1_BCL2A1-      ------------------------------ag------------------
F7E8V5_BCL2A1-01        ------------------------------ag------------------
A0A2K5KAA3_BCL2A1-      ------------------------------at------------------
A0A2K6LV19_BCL2A1-      ------------------------------at------------------
A0A2K6PHF2_BCL2A1-      ------------------------------at------------------
A0A2K6AD27_BCL2A1-      ------------------------------at------------------
A0A2K5KHH8_BCL2A1-      ------------------------------at------------------
A0A2K5TMD1_BCL2A1-      ------------------------------at------------------
A0A2K6DS18_BCL2A1-      ------------------------------at------------------
H2NNZ9_BCL2A1-01        ------------------------------at------------------
B4E1X9_BCL2A1-03        ------------------------------at------------------
A0A2R8ZJ66_BCL2A1-      ------------------------------ag------------------
A0A2R8ZJ66_BCL2A1-      ------------------------------ag------------------
B4E1X9_BCL2A1-02        ------------------------------ag------------------
A0A2I2YJV4_BCL2A1-      ------------------------------ag------------------
A0A2I2YJV4_BCL2A1-      ------------------------------ag------------------
A0A2R8ZJ66_BCL2A1-      ------------------------------at------------------
A0A2I2YJV4_BCL2A1-      ------------------------------at------------------
B4E1X9_BCL2A1-01        ------------------------------at------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D0Z1Y4_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D1SK15_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A4X1UP21_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D1BRF8_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D1YBS8_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A4X1UP21_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D1SK15_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D0Z1Y4_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8D1YBS8_BCL2A1-      gacattttccaacaaggcaagacctgttttat------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gacattttccaacaaggcaaaacctgctttat------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gacattttccaacaaggcaaaacctgctttat------------------
A0A5F5PK00_BCL2A1-      gacattttccaacaaggcaaaacctgctttat------------------
A0A5F5PK00_BCL2A1-      gacattttccaacaaggcaaaacctgctttat------------------
                                                                          

A0A673TDC6_BCL2A1-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      cgacgtttagggagtctgagagtgctggcatccaaggcaccagcattgat
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcacttcccacggtttcagt
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        -------a---tc---------------------------------ttgg
A0A8C5VB12_BCL2A1-      -------g---tc---------------------------------tgtg
A0A286XUI2_BCL2A1-      -------c---tc---------------------------------tgtg
A0A8C2UN30_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8C5L8K1_BCL2A1-      -------a---tc---------------------------------tggg
F6SFL4_BCL2A1-01        -------a--------------------------------------tctg
A0A4X2KFL7_BCL2A1-      -------a--------------------------------------tctg
A0A7N4P573_BCL2A1-      -------a--------------------------------------cctg
A0A7N4P573_BCL2A1-      -------a--------------------------------------tctg
A0A7N4P573_BCL2A1-      -------a--------------------------------------cctg
A0A7N4P573_BCL2A1-      -------a--------------------------------------cctg
A0A8C0KQ53_BCL2A1-      -------g---tg---------------------------------tgtg
A0A8C0MTY3_BCL2A1-      -------g---tg---------------------------------tgtg
A0A8I3MYG9_BCL2A1-      -------g---tg---------------------------------tgtg
M3YVH4_BCL2A1-01        -------a---tc---------------------------------tgtg
U6CQS8_BCL2A1-01        -------a---tc---------------------------------tgtg
A0A452U285_BCL2A1-      -------a---gc---------------------------------tgc-
G1LIJ8_BCL2A1-01        -------a---tc---------------------------------tgtg
A0A452SIR9_BCL2A1-      -------a---tc---------------------------------tgtg
A0A452U285_BCL2A1-      -------a---tc---------------------------------tgtg
A0A5F9CXI7_BCL2A1-      -------c---ccccgctaccggttgcagagcaatcacatggatatggtg
A0A5F9CXI7_BCL2A1-      -------c---ccccgctaccggttgcagagcaatcacatggatatggtg
A0A5F9CXI7_BCL2A1-      -------c---ccccgctaccggttgcagagcaatcacatggatatggtg
A0A5F9CXI7_BCL2A1-      -------c---ccccgctaccggttgcagagcaatcacatggatatggtg
A0A8C8X938_BCL2A1-      -------gcaacc---------------------------------ggct
M3WHW2_BCL2A1-01        -------a---tc---------------------------------tgta
A0A667HQV5_BCL2A1-      -------a---tc---------------------------------tgca
A0A8C9KZ34_BCL2A1-      -------aacctc---------------------------------cctg
A0A8C8X938_BCL2A1-      -------a---tc---------------------------------tgta
A0A8C9KZ34_BCL2A1-      -------a---tc---------------------------------tgta
A0A8C0WAG3_BCL2A1-      -------a---tc---------------------------------tacg
A0A8C6QF32_BCL2A1-      -------a---tc---------------------------------tggg
A0A8C6R201_BCL2A1-      -------a---tc---------------------------------tggg
A0A8C6GN16_BCL2A1-      gggctgca---tc---------------------------------tgtt
G3V977_BCL2A1-01        -------a---tc---------------------------------tggg
Q925A9_BCL2A1-01        -------a---tc---------------------------------tggg
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      -------a---tc---------------------------------tggg
O55179_BCL2A1-01        -------a---tc---------------------------------tggg
Q8K164_BCL2A1-01        -------a---tc---------------------------------tggg
Q4FK02_BCL2A1-01        -------t---tc---------------------------------tggg
O55177_BCL2A1-02        -------t---tc---------------------------------tggg
Q497M6_BCL2A1-01        -------t---tc---------------------------------tggg
A0A8C2LQI3_BCL2A1-      -------a---tc---------------------------------tggg
A0A8C8U2B9_BCL2A1-      -------a---tc---------------------------------tggg
A0A8D2B7G1_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8C5YJP3_BCL2A1-      -------a---tc---------------------------------tgtg
I3MCZ7_BCL2A1-01        -------a---tc---------------------------------tgtg
A0A8C9PIV7_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8D2IK51_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8C9DF25_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6EKG1_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8C6MJ03_BCL2A1-      -------------------------------------------------g
A0A8B9YDG7_BCL2A1-      -------c---cctcggtaccagttgcagagcaatcacatggatatggtg
A0A8B9YDG7_BCL2A1-      -------c---cctcggtaccagttgcagagcaatcacatggatatggtg
A0A8B9YDG7_BCL2A1-      -------c---cctcggtaccagttgcagagcaatcacatggatatggtg
A0A8B9YDG7_BCL2A1-      -------------------------------------------------g
A0A452EK63_BCL2A1-      -------------------------------------------------g
W5Q0N6_BCL2A1-01        -------------------------------------------------g
A0A671FLY8_BCL2A1-      -------a---tc---------------------------------tgtg
H0WZ23_BCL2A1-01        -------a---tc---------------------------------tgtg
F7HXW0_BCL2A1-01        -------a---tc---------------------------------tgcg
F7HXW0_BCL2A1-02        -------g---gc---------------------------------tttg
A0A2K6TLG6_BCL2A1-      -------a---ag---------------------------------aaga
A0A2K6TLG6_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      -------a---tc---------------------------------tgcg
A0A2K5D2I1_BCL2A1-      -------g---gc---------------------------------tttg
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2I3GQS0_BCL2A1-      -------a---tctcaatactgttgactagaaaggacactccatattgtg
A0A2K5KAA3_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8D2E7F6_BCL2A1-      -------a---tc---------------------------------tgtg
A0A8C9HCC9_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6AD27_BCL2A1-      -------a---tc---------------------------------tgtg
A0A0D9RRC3_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6LV19_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6PHF2_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K5KHH8_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K6DS18_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K5KHH8_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2K5TMD1_BCL2A1-      -------a---tc---------------------------------tgtg
F7E8V5_BCL2A1-01        -------a---tc---------------------------------tgtg
A0A2K5KAA3_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K6LV19_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K6PHF2_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K6AD27_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K5KHH8_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K5TMD1_BCL2A1-      -------g---gc---------------------------------tttg
A0A2K6DS18_BCL2A1-      -------g---gc---------------------------------tttg
H2NNZ9_BCL2A1-01        -------g---gc---------------------------------tttg
B4E1X9_BCL2A1-03        -------t---tc---------------------------------cttg
A0A2R8ZJ66_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2R8ZJ66_BCL2A1-      -------a---tctcaatactgttgaccagaaaggacactccatattgtg
B4E1X9_BCL2A1-02        -------a---tc---------------------------------tgtg
A0A2I2YJV4_BCL2A1-      -------a---tc---------------------------------tgtg
A0A2I2YJV4_BCL2A1-      -------a---tctcaatactgttgaccagaaaggacactccatattgtg
A0A2R8ZJ66_BCL2A1-      -------g---gc---------------------------------tttg
A0A2I2YJV4_BCL2A1-      -------g---gc---------------------------------tttg
B4E1X9_BCL2A1-01        -------g---gc---------------------------------tttg
G3T8E6_BCL2A1-01        ----------------------------------------agattt-gtg
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D0Z1Y4_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D1SK15_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A4X1UP21_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D1BRF8_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D1YBS8_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A4X1UP21_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D1SK15_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D0Z1Y4_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8D1YBS8_BCL2A1-      -------c---ccacggtatcagttccagagcaatcacatggatatggtg
A0A8C0CSU7_BCL2A1-      ----------------------------------------tgatct-gtg
A0A8C6FDW6_BCL2A1-      ----------------------------------------agatct-gtg
A0A8C9BC20_BCL2A1-      ----------------------------------------agatct-gtg
A0A5F5PK00_BCL2A1-      -------c---ccacggtaccagttcaatagcaatcacatggatatggtg
A0A8C4PQL1_BCL2A1-      ----------------------------------------agatgt-gtg
A0A5F5PK00_BCL2A1-      ----------------------------------------agatgt-gtg
A0A5F5PK00_BCL2A1-      -------c---ccacggtaccagttcaatagcaatcacatggatatggtg
A0A5F5PK00_BCL2A1-      -------c---ccacggtaccagttcaatagcaatcacatggatatggtg
A0A5F5PK00_BCL2A1-      -------c---ccacggtaccagttcaatagcaatcacatggatatggtg
                                                                          

A0A673TDC6_BCL2A1-      gatgtcacttcccacg----------------------atttcagtgaca
A0A8B9S513_BCL2A1-      --------------------------------------tat---------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------ttt---------
A0A8C5X4L3_BCL2A1-      --------------------------------------tgt---------
H0ZCL9_BCL2A1-01        --------------------------------------tgt---------
A0A8C5J3C4_BCL2A1-      --------------------------------------tgc---------
A0A8D2QAC0_BCL2A1-      --------------------------------------tgt---------
A0A8C9MQN0_BCL2A1-      --------------------------------------tgt---------
A0A8C3NVU4_BCL2A1-      --------------------------------------tgt---------
A0A8D2PM01_BCL2A1-      --------------------------------------tgt---------
A0A8C0UPM3_BCL2A1-      --------------------------------------tgc---------
A0A8C0UPM3_BCL2A1-      --------------------------------------tgc---------
A0A8C3U920_BCL2A1-      --------------------------------------tgt---------
A0A803V184_BCL2A1-      --------------------------------------tgt---------
A0A8C2UCW6_BCL2A1-      --------------------------------------tat---------
G1N8C5_BCL2A1-01        --------------------------------------tat---------
A0A8C3KTI3_BCL2A1-      --------------------------------------tat---------
A0A669PVQ4_BCL2A1-      --------------------------------------tat---------
A0A8B9CVY0_BCL2A1-      --------------------------------------tat---------
A0A8B9E009_BCL2A1-      --------------------------------------tat---------
A0A8C3BNR4_BCL2A1-      --------------------------------------tat---------
A0A493SSZ7_BCL2A1-      --------------------------------------tat---------
A0A8B9UZT1_BCL2A1-      --------------------------------------tat---------
A0A8C3K1C5_BCL2A1-      --------------------------------------tgt---------
A0A8B9FJB5_BCL2A1-      --------------------------------------tgt---------
A0A672UHF9_BCL2A1-      --------------------------------------tgt---------
A0A8C4U5U5_BCL2A1-      --------------------------------------tgt---------
A0A8B9Z3D5_BCL2A1-      --------------------------------------tgt---------
A0A8B9RZD1_BCL2A1-      --------------------------------------tgt---------
A0A663E5S6_BCL2A1-      --------------------------------------tgt---------
A0A8C8AIP7_BCL2A1-      --------------------------------------tat---------
A0A663N622_BCL2A1-      --------------------------------------tct---------
A0A8C0EQC0_BCL2A1-      --------------------------------------tat---------
A0A8D0ELW8_BCL2A1-      --------------------------------------tat---------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------gaa---------
A0A8C8SUC3_BCL2A1-      --------------------------------------atc---------
K7G130_BCL2A1-01        --------------------------------------aaa---------
A0A8C3FIW3_BCL2A1-      --------------------------------------aaa---------
A0A8C0G393_BCL2A1-      --------------------------------------aaa---------
A0A452J3N6_BCL2A1-      --------------------------------------aaa---------
A0A8C4W4P8_BCL2A1-      --------------------------------------ttt---------
A0A8C3RME9_BCL2A1-      --------------------------------------ttt---------
A0A674K8Q6_BCL2A1-      --------------------------------------ttt---------
A0A8C6VPU0_BCL2A1-      --------------------------------------aga---------
A0A8C5SDG4_BCL2A1-      --------------------------------------aga---------
A0A670YDS2_BCL2A1-      --------------------------------------aga---------
A0A8D0H8G3_BCL2A1-      --------------------------------------aat---------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------aaccttacacaa
A0A670JXJ0_BCL2A1-      --------------------------------------aaccttacacaa
A0A670JXJ0_BCL2A1-      --------------------------------------aac---------
F6S8G3_BCL2A1-01        g-------------------------------------cgt---actctc
A0A8C5VB12_BCL2A1-      g-------------------------------------cgt---gctgtc
A0A286XUI2_BCL2A1-      a-------------------------------------gat---gctctc
A0A8C2UN30_BCL2A1-      a-------------------------------------gat---gctgtc
A0A8C5L8K1_BCL2A1-      a-------------------------------------aat---gctctt
F6SFL4_BCL2A1-01        g-------------------------------------ggcatattttcc
A0A4X2KFL7_BCL2A1-      g-------------------------------------ggtgtattttcc
A0A7N4P573_BCL2A1-      aagagatgcttccaacaccaaaaaagaagaccttacacaattgctttggc
A0A7N4P573_BCL2A1-      g-------------------------------------aatgtattttcc
A0A7N4P573_BCL2A1-      aagagatgcttccaacaccaaaaaagaagaccttacacaattgctttggc
A0A7N4P573_BCL2A1-      a-------------------------------------------------
A0A8C0KQ53_BCL2A1-      a-------------------------------------aat---gtggtc
A0A8C0MTY3_BCL2A1-      a-------------------------------------aat---gtggtc
A0A8I3MYG9_BCL2A1-      a-------------------------------------aat---gtggtc
M3YVH4_BCL2A1-01        a-------------------------------------aat---gttctc
U6CQS8_BCL2A1-01        a-------------------------------------aat---gttctc
A0A452U285_BCL2A1-      ----------------------------------------t---gccacc
G1LIJ8_BCL2A1-01        a-------------------------------------aat---gttctc
A0A452SIR9_BCL2A1-      a-------------------------------------aat---gttctc
A0A452U285_BCL2A1-      a-------------------------------------aat---gttctc
A0A5F9CXI7_BCL2A1-      a-------------------------------------aat----tagcg
A0A5F9CXI7_BCL2A1-      a-------------------------------------aat----tagcg
A0A5F9CXI7_BCL2A1-      a-------------------------------------aat----tagcg
A0A5F9CXI7_BCL2A1-      a-------------------------------------aat----tagcg
A0A8C8X938_BCL2A1-      g-------------------------------------gg----------
M3WHW2_BCL2A1-01        a-------------------------------------ggt---attgtc
A0A667HQV5_BCL2A1-      a-------------------------------------ggt---gttgtc
A0A8C9KZ34_BCL2A1-      a-------------------------------------g-------tctc
A0A8C8X938_BCL2A1-      a-------------------------------------ggt---gatagc
A0A8C9KZ34_BCL2A1-      a-------------------------------------ggt---attgtc
A0A8C0WAG3_BCL2A1-      a-------------------------------------cat---gctgtc
A0A8C6QF32_BCL2A1-      a-------------------------------------act---gatctt
A0A8C6R201_BCL2A1-      a-------------------------------------att---gatctt
A0A8C6GN16_BCL2A1-      a-------------------------------------aga---gccctc
G3V977_BCL2A1-01        a-------------------------------------aat---gctctt
Q925A9_BCL2A1-01        a-------------------------------------aat---gctctt
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      a-------------------------------------aat---gctctt
O55179_BCL2A1-01        a-------------------------------------aat---gctctt
Q8K164_BCL2A1-01        a-------------------------------------aat---gctctt
Q4FK02_BCL2A1-01        a-------------------------------------aat---gctctt
O55177_BCL2A1-02        a-------------------------------------aat---gctctt
Q497M6_BCL2A1-01        a-------------------------------------aat---gctctt
A0A8C2LQI3_BCL2A1-      a-------------------------------------aat---gctctt
A0A8C8U2B9_BCL2A1-      a-------------------------------------aat---gctctt
A0A8D2B7G1_BCL2A1-      a-------------------------------------gat---gctgtc
A0A8C5YJP3_BCL2A1-      a-------------------------------------gat---gctgtc
I3MCZ7_BCL2A1-01        a-------------------------------------gat---gctgtc
A0A8C9PIV7_BCL2A1-      a-------------------------------------gat---gctgtc
A0A8D2IK51_BCL2A1-      a-------------------------------------gat---gctgtc
A0A8C9DF25_BCL2A1-      a-------------------------------------cat---gctgtc
A0A2K6EKG1_BCL2A1-      a-------------------------------------cat---gctgtc
A0A8C6MJ03_BCL2A1-      a-------------------------------------agt----ta---
A0A8B9YDG7_BCL2A1-      a-------------------------------------agt----tagca
A0A8B9YDG7_BCL2A1-      a-------------------------------------agt----tagca
A0A8B9YDG7_BCL2A1-      a-------------------------------------agt----tagca
A0A8B9YDG7_BCL2A1-      a-------------------------------------agt----ta---
A0A452EK63_BCL2A1-      a-------------------------------------agt----ta---
W5Q0N6_BCL2A1-01        a-------------------------------------agt----ta---
A0A671FLY8_BCL2A1-      a-------------------------------------aat---gttctg
H0WZ23_BCL2A1-01        a-------------------------------------aat---gctgcc
F7HXW0_BCL2A1-01        a-------------------------------------aat---gctatc
F7HXW0_BCL2A1-02        t-------------------------------------aa----------
A0A2K6TLG6_BCL2A1-      a-------------------------------------aat---ggcttt
A0A2K6TLG6_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K6TLG6_BCL2A1-      ---------------------------------------------ctatc
A0A2K5D2I1_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K5D2I1_BCL2A1-      t-------------------------------------aa----------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      a-------------------------------------aat---gctctc
A0A2I3GQS0_BCL2A1-      a-------------------------------------aaccggcctaat
A0A2K5KAA3_BCL2A1-      a-------------------------------------aat---gctatc
A0A8D2E7F6_BCL2A1-      a-------------------------------------aat---gctatc
A0A8C9HCC9_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K6AD27_BCL2A1-      a-------------------------------------aat---gctctc
A0A0D9RRC3_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K6LV19_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K6PHF2_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K5KHH8_BCL2A1-      a-------------------------------------aat---gctctc
A0A2K6DS18_BCL2A1-      a-------------------------------------aat---gctctc
A0A2K5KHH8_BCL2A1-      a-------------------------------------aat---gctatc
A0A2K5TMD1_BCL2A1-      a-------------------------------------aat---gctatc
F7E8V5_BCL2A1-01        a-------------------------------------aat---gctatc
A0A2K5KAA3_BCL2A1-      t-------------------------------------aa----------
A0A2K6LV19_BCL2A1-      t-------------------------------------aa----------
A0A2K6PHF2_BCL2A1-      t-------------------------------------aa----------
A0A2K6AD27_BCL2A1-      t-------------------------------------aa----------
A0A2K5KHH8_BCL2A1-      t-------------------------------------aa----------
A0A2K5TMD1_BCL2A1-      t-------------------------------------aa----------
A0A2K6DS18_BCL2A1-      t-------------------------------------aa----------
H2NNZ9_BCL2A1-01        t-------------------------------------aa----------
B4E1X9_BCL2A1-03        c-------------------------------------ta----------
A0A2R8ZJ66_BCL2A1-      a-------------------------------------aat---gctatc
A0A2R8ZJ66_BCL2A1-      a-------------------------------------aaccggcctaat
B4E1X9_BCL2A1-02        a-------------------------------------aat---gctatc
A0A2I2YJV4_BCL2A1-      a-------------------------------------aat---gctatc
A0A2I2YJV4_BCL2A1-      a-------------------------------------aaccggcctaat
A0A2R8ZJ66_BCL2A1-      t-------------------------------------aa----------
A0A2I2YJV4_BCL2A1-      t-------------------------------------aa----------
B4E1X9_BCL2A1-01        t-------------------------------------aa----------
G3T8E6_BCL2A1-01        a-------------------------------------aat---gttatt
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      a-------------------------------------aat----tagca
A0A8D0Z1Y4_BCL2A1-      a-------------------------------------aat----tagca
A0A8D1SK15_BCL2A1-      a-------------------------------------aat----tagca
A0A4X1UP21_BCL2A1-      a-------------------------------------aat----tagca
A0A8D1BRF8_BCL2A1-      a-------------------------------------aat----tagca
A0A8D1YBS8_BCL2A1-      a-------------------------------------aat----tagca
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      a-------------------------------------aat----tagca
A0A4X1UP21_BCL2A1-      a-------------------------------------aat----tagca
A0A8D1SK15_BCL2A1-      a-------------------------------------aat----tagca
A0A8D0Z1Y4_BCL2A1-      a-------------------------------------aat----tagca
A0A8D1YBS8_BCL2A1-      a-------------------------------------aat----tagca
A0A8C0CSU7_BCL2A1-      a-------------------------------------aat---attatg
A0A8C6FDW6_BCL2A1-      a-------------------------------------aat---attatg
A0A8C9BC20_BCL2A1-      a-------------------------------------aat---attatg
A0A5F5PK00_BCL2A1-      a-------------------------------------aat----tagca
A0A8C4PQL1_BCL2A1-      a-------------------------------------aat------act
A0A5F5PK00_BCL2A1-      a-------------------------------------aat------act
A0A5F5PK00_BCL2A1-      a-------------------------------------aat----tagca
A0A5F5PK00_BCL2A1-      a-------------------------------------aat----tagca
A0A5F5PK00_BCL2A1-      a-------------------------------------aat----tagca
                                                                          

A0A673TDC6_BCL2A1-      tcatcgcttcccgcgatttcagtgacgtcatcacttcccatggtttcagt
A0A8B9S513_BCL2A1-      tcatagcttttttt-------------------tccc-------------
A0A8C6ZVQ3_BCL2A1-      tgatggcttttttc-------------------tccc-------------
A0A8C5X4L3_BCL2A1-      ttatagctgttgtc-------------------tcct-------------
H0ZCL9_BCL2A1-01        tcatagctcttgtg-------------------tcct-------------
A0A8C5J3C4_BCL2A1-      tcatagctgttgtt-------------------tcct-------------
A0A8D2QAC0_BCL2A1-      tcatagccgtcgtt-------------------tcct-------------
A0A8C9MQN0_BCL2A1-      tcattgctgttgtt-------------------tcct-------------
A0A8C3NVU4_BCL2A1-      tgatagctgttgct-------------------tcct-------------
A0A8D2PM01_BCL2A1-      tgatagctgttgtt-------------------tcct-------------
A0A8C0UPM3_BCL2A1-      tcatagctgttgtt-------------------tcct-------------
A0A8C0UPM3_BCL2A1-      tcatagctgttgtt-------------------tcct-------------
A0A8C3U920_BCL2A1-      tcatagctgttgtt-------------------tcct-------------
A0A803V184_BCL2A1-      tcatagctgttgtt-------------------tcct-------------
A0A8C2UCW6_BCL2A1-      ttgcagctgttttt-------------------tcct-------------
G1N8C5_BCL2A1-01        ttgcagctgttttt-------------------tcct-------------
A0A8C3KTI3_BCL2A1-      ttgcagctgttttt-------------------tcct-------------
A0A669PVQ4_BCL2A1-      ttgcagctgttttt-------------------tcct-------------
A0A8B9CVY0_BCL2A1-      tcgtagctcttttt-------------------tcct-------------
A0A8B9E009_BCL2A1-      tcgtagctcttttt-------------------tcct-------------
A0A8C3BNR4_BCL2A1-      tcgtggctgttttt-------------------tcct-------------
A0A493SSZ7_BCL2A1-      tcgtggctgttttt-------------------tcct-------------
A0A8B9UZT1_BCL2A1-      tcgtggctgttttt-------------------tcct-------------
A0A8C3K1C5_BCL2A1-      tcctggctgttttc-------------------tcct-------------
A0A8B9FJB5_BCL2A1-      tcatagctgttttt-------------------acct-------------
A0A672UHF9_BCL2A1-      tcatagctgttttc-------------------acct-------------
A0A8C4U5U5_BCL2A1-      tcatagctgttttt-------------------agct-------------
A0A8B9Z3D5_BCL2A1-      tcatagctgttttt-------------------tcct-------------
A0A8B9RZD1_BCL2A1-      tcatagctgttttt-------------------tcct-------------
A0A663E5S6_BCL2A1-      tcatagctgttttt-------------------tcct-------------
A0A8C8AIP7_BCL2A1-      tcatagctgttttc-------------------tcct-------------
A0A663N622_BCL2A1-      tcatagctgttttc-------------------tcct-------------
A0A8C0EQC0_BCL2A1-      tcatagctgttttc-------------------tcct-------------
A0A8D0ELW8_BCL2A1-      tcatagctgttttc-------------------tcct-------------
A0A8D0EB90_BCL2A1-      tcatatcccttgta------------------------------------
A0A7M4FFQ8_BCL2A1-      tcatggctgtcttc-------------------tcct-------------
A0A8C8SUC3_BCL2A1-      acatgtatggaggt-------------------tcctttgcctgctt---
K7G130_BCL2A1-01        tcatggatgctttt-------------------tcct-------------
A0A8C3FIW3_BCL2A1-      tcatggatgctttt-------------------tcct-------------
A0A8C0G393_BCL2A1-      tcatggatgctttt-------------------tcct-------------
A0A452J3N6_BCL2A1-      tcatggatgctttt-------------------tcct-------------
A0A8C4W4P8_BCL2A1-      tcattaataaattt-------------------ttttaaaatg-------
A0A8C3RME9_BCL2A1-      tccttaataaatgt-------------------tcttttaactactgtca
A0A674K8Q6_BCL2A1-      tccttaataca---------------------------------------
A0A8C6VPU0_BCL2A1-      tcttggctgttttt-------------------tcca-------------
A0A8C5SDG4_BCL2A1-      tcttggctgttttt-------------------tcag-------------
A0A670YDS2_BCL2A1-      tcttggctgttttt-------------------tcaa-------------
A0A8D0H8G3_BCL2A1-      tcatggctatcttt-------------------tcgt-------------
A0A8D2Q8F9_BCL2A1-      ccgcatcggtttct------------------gtaaa-------------
A0A670JXJ0_BCL2A1-      tcgccttggcttttaaagaacaagtgtgtgacgtggt-------------
A0A670JXJ0_BCL2A1-      tcgccttggcttttaaagaacaagtgtgtgacgtggt-------------
A0A670JXJ0_BCL2A1-      tcatctccgctttc-------------------tcgt-------------
F6S8G3_BCL2A1-01        ccac----------------------------------------------
A0A8C5VB12_BCL2A1-      tctc----------------------------------------------
A0A286XUI2_BCL2A1-      tctc----------------------------------------------
A0A8C2UN30_BCL2A1-      cctc----------------------------------------------
A0A8C5L8K1_BCL2A1-      ttac----------------------------------------------
F6SFL4_BCL2A1-01        tttc----------------------------------------------
A0A4X2KFL7_BCL2A1-      tttc----------------------------------------------
A0A7N4P573_BCL2A1-      tttc----------------------------------------------
A0A7N4P573_BCL2A1-      tttc----------------------------------------------
A0A7N4P573_BCL2A1-      tttc----------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      acac----------------------------------------------
A0A8C0MTY3_BCL2A1-      acac----------------------------------------------
A0A8I3MYG9_BCL2A1-      acac----------------------------------------------
M3YVH4_BCL2A1-01        tctc----------------------------------------------
U6CQS8_BCL2A1-01        tctc----------------------------------------------
A0A452U285_BCL2A1-      tttt----------------------------------------------
G1LIJ8_BCL2A1-01        tctc----------------------------------------------
A0A452SIR9_BCL2A1-      tctc----------------------------------------------
A0A452U285_BCL2A1-      tctc----------------------------------------------
A0A5F9CXI7_BCL2A1-      tcag----------------------------------------------
A0A5F9CXI7_BCL2A1-      tcag----------------------------------------------
A0A5F9CXI7_BCL2A1-      tcag----------------------------------------------
A0A5F9CXI7_BCL2A1-      tcag----------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        tc------------------------------------------------
A0A667HQV5_BCL2A1-      tc------------------------------------------------
A0A8C9KZ34_BCL2A1-      tcaca---------------------------------------------
A0A8C8X938_BCL2A1-      tcacagtcagtatc------------------------------------
A0A8C9KZ34_BCL2A1-      tc------------------------------------------------
A0A8C0WAG3_BCL2A1-      cctc----------------------------------------------
A0A8C6QF32_BCL2A1-      tctc----------------------------------------------
A0A8C6R201_BCL2A1-      tctc----------------------------------------------
A0A8C6GN16_BCL2A1-      ttgctgaaatatgg------------------------------------
G3V977_BCL2A1-01        tctc----------------------------------------------
Q925A9_BCL2A1-01        tctc----------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      tctc----------------------------------------------
O55179_BCL2A1-01        tctc----------------------------------------------
Q8K164_BCL2A1-01        tctc----------------------------------------------
Q4FK02_BCL2A1-01        tctc----------------------------------------------
O55177_BCL2A1-02        tctc----------------------------------------------
Q497M6_BCL2A1-01        tctc----------------------------------------------
A0A8C2LQI3_BCL2A1-      t-------------------------------------------------
A0A8C8U2B9_BCL2A1-      tctc----------------------------------------------
A0A8D2B7G1_BCL2A1-      tctc----------------------------------------------
A0A8C5YJP3_BCL2A1-      tctc----------------------------------------------
I3MCZ7_BCL2A1-01        tctc----------------------------------------------
A0A8C9PIV7_BCL2A1-      tctc----------------------------------------------
A0A8D2IK51_BCL2A1-      tctc----------------------------------------------
A0A8C9DF25_BCL2A1-      cctc----------------------------------------------
A0A2K6EKG1_BCL2A1-      cctc----------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      tcgc----------------------------------------------
A0A8B9YDG7_BCL2A1-      tcgc----------------------------------------------
A0A8B9YDG7_BCL2A1-      tcgc----------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      tctt----------------------------------------------
H0WZ23_BCL2A1-01        tctc----------------------------------------------
F7HXW0_BCL2A1-01        tctc----------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      tctc----------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      tctc----------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      tttc----------------------------------------------
A0A2I3GQS0_BCL2A1-      tttt----------------------------------------------
A0A2K5KAA3_BCL2A1-      tctc----------------------------------------------
A0A8D2E7F6_BCL2A1-      tctc----------------------------------------------
A0A8C9HCC9_BCL2A1-      tctc----------------------------------------------
A0A2K6AD27_BCL2A1-      tctc----------------------------------------------
A0A0D9RRC3_BCL2A1-      tctc----------------------------------------------
A0A2K6LV19_BCL2A1-      tctc----------------------------------------------
A0A2K6PHF2_BCL2A1-      tctc----------------------------------------------
A0A2K5KHH8_BCL2A1-      tctt----------------------------------------------
A0A2K6DS18_BCL2A1-      tctt----------------------------------------------
A0A2K5KHH8_BCL2A1-      tctc----------------------------------------------
A0A2K5TMD1_BCL2A1-      tctc----------------------------------------------
F7E8V5_BCL2A1-01        tctc----------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      tctc----------------------------------------------
A0A2R8ZJ66_BCL2A1-      tttt----------------------------------------------
B4E1X9_BCL2A1-02        tctc----------------------------------------------
A0A2I2YJV4_BCL2A1-      tctc----------------------------------------------
A0A2I2YJV4_BCL2A1-      tttt----------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        tctc----------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      tcgc----------------------------------------------
A0A8D0Z1Y4_BCL2A1-      tcgc----------------------------------------------
A0A8D1SK15_BCL2A1-      tcgc----------------------------------------------
A0A4X1UP21_BCL2A1-      tcgc----------------------------------------------
A0A8D1BRF8_BCL2A1-      tcgc----------------------------------------------
A0A8D1YBS8_BCL2A1-      tcgc----------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      tcgc----------------------------------------------
A0A4X1UP21_BCL2A1-      tcgc----------------------------------------------
A0A8D1SK15_BCL2A1-      tcgc----------------------------------------------
A0A8D0Z1Y4_BCL2A1-      tcgc----------------------------------------------
A0A8D1YBS8_BCL2A1-      tcgc----------------------------------------------
A0A8C0CSU7_BCL2A1-      tctc----------------------------------------------
A0A8C6FDW6_BCL2A1-      tctc----------------------------------------------
A0A8C9BC20_BCL2A1-      tctc----------------------------------------------
A0A5F5PK00_BCL2A1-      tcac----------------------------------------------
A0A8C4PQL1_BCL2A1-      tttc----------------------------------------------
A0A5F5PK00_BCL2A1-      tttc----------------------------------------------
A0A5F5PK00_BCL2A1-      tcac----------------------------------------------
A0A5F5PK00_BCL2A1-      tcac----------------------------------------------
A0A5F5PK00_BCL2A1-      tcac----------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      gatatcatcacttcccacgatttcagtgatgtattcacttcccatgattt
A0A8B9S513_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C6ZVQ3_BCL2A1-      ---------------------------tgttcaggg--------------
A0A8C5X4L3_BCL2A1-      ---------------------------tgttcagag--------------
H0ZCL9_BCL2A1-01        ---------------------------tgttcagag--------------
A0A8C5J3C4_BCL2A1-      ---------------------------tgttcagag--------------
A0A8D2QAC0_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C9MQN0_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C3NVU4_BCL2A1-      ---------------------------tgttcagag--------------
A0A8D2PM01_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C0UPM3_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C0UPM3_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C3U920_BCL2A1-      ---------------------------tgttcagag--------------
A0A803V184_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C2UCW6_BCL2A1-      ---------------------------tgttcagag--------------
G1N8C5_BCL2A1-01        ---------------------------tgttcagag--------------
A0A8C3KTI3_BCL2A1-      ---------------------------tgtttagag--------------
A0A669PVQ4_BCL2A1-      ---------------------------tgttcagag--------------
A0A8B9CVY0_BCL2A1-      ---------------------------tgttcagag--------------
A0A8B9E009_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C3BNR4_BCL2A1-      ---------------------------tgttcagag--------------
A0A493SSZ7_BCL2A1-      ---------------------------tgttcagag--------------
A0A8B9UZT1_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C3K1C5_BCL2A1-      ---------------------------tgttcagag--------------
A0A8B9FJB5_BCL2A1-      ---------------------------tgttcagag--------------
A0A672UHF9_BCL2A1-      ---------------------------tgttcagag--------------
A0A8C4U5U5_BCL2A1-      ---------------------------tgttcagag--------------
A0A8B9Z3D5_BCL2A1-      ---------------------------tgctcagag--------------
A0A8B9RZD1_BCL2A1-      ---------------------------tgctcagag--------------
A0A663E5S6_BCL2A1-      ---------------------------tgctcagag--------------
A0A8C8AIP7_BCL2A1-      ---------------------------tattcagag--------------
A0A663N622_BCL2A1-      ---------------------------tattcagag--------------
A0A8C0EQC0_BCL2A1-      ---------------------------tattcagag--------------
A0A8D0ELW8_BCL2A1-      ---------------------------tattcagag--------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      ---------------------------tcttcagtc--------------
A0A8C8SUC3_BCL2A1-      ---------------------------ctttcagtc--------------
K7G130_BCL2A1-01        ---------------------------tcttcagtc--------------
A0A8C3FIW3_BCL2A1-      ---------------------------tcttcagtc--------------
A0A8C0G393_BCL2A1-      ---------------------------tcttcagtc--------------
A0A452J3N6_BCL2A1-      ---------------------------tcttcagtc--------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      aaaagaatcatcaacttagccagggctttatcattt--------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      ---------------------------tcttcaatc--------------
A0A8C5SDG4_BCL2A1-      ---------------------------tcttcaatc--------------
A0A670YDS2_BCL2A1-      ---------------------------tcttcaatc--------------
A0A8D0H8G3_BCL2A1-      ---------------------------tcttcaacc--------------
A0A8D2Q8F9_BCL2A1-      ---------------------------ccttcagac--------------
A0A670JXJ0_BCL2A1-      ---------------------------ccctgcgtctgaaaatgatgtga
A0A670JXJ0_BCL2A1-      ---------------------------ccctgcgtctgaaaatgatgtga
A0A670JXJ0_BCL2A1-      ---------------------------tcttcagtc--------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      cagtgatgtcatcacttcccagggtttcagtgatgtcatcacttcccacg
A0A8B9S513_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C6ZVQ3_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C5X4L3_BCL2A1-      ---------------------agtact-actga-----------------
H0ZCL9_BCL2A1-01        ---------------------agtact-actga-----------------
A0A8C5J3C4_BCL2A1-      ---------------------agtact-actga-----------------
A0A8D2QAC0_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C9MQN0_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C3NVU4_BCL2A1-      ---------------------agtact-actga-----------------
A0A8D2PM01_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C0UPM3_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C0UPM3_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C3U920_BCL2A1-      ---------------------agtact-actga-----------------
A0A803V184_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C2UCW6_BCL2A1-      ---------------------agtact-actga-----------------
G1N8C5_BCL2A1-01        ---------------------actact-actga-----------------
A0A8C3KTI3_BCL2A1-      ---------------------agtact-actga-----------------
A0A669PVQ4_BCL2A1-      ---------------------agtact-actga-----------------
A0A8B9CVY0_BCL2A1-      ---------------------agtact-actga-----------------
A0A8B9E009_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C3BNR4_BCL2A1-      ---------------------agtact-actga-----------------
A0A493SSZ7_BCL2A1-      ---------------------agtag------------------------
A0A8B9UZT1_BCL2A1-      ---------------------agtag------------------------
A0A8C3K1C5_BCL2A1-      ---------------------agtact-actga-----------------
A0A8B9FJB5_BCL2A1-      ---------------------agtact-actga-----------------
A0A672UHF9_BCL2A1-      ---------------------agtact-attga-----------------
A0A8C4U5U5_BCL2A1-      ---------------------agtact-actaa-----------------
A0A8B9Z3D5_BCL2A1-      ---------------------agtact-actga-----------------
A0A8B9RZD1_BCL2A1-      ---------------------agtact-actga-----------------
A0A663E5S6_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C8AIP7_BCL2A1-      ---------------------agtact-actga-----------------
A0A663N622_BCL2A1-      ---------------------agtact-actga-----------------
A0A8C0EQC0_BCL2A1-      ---------------------agtact-actga-----------------
A0A8D0ELW8_BCL2A1-      ---------------------agtact-actga-----------------
A0A8D0EB90_BCL2A1-      ---------------------agaaaatattag-----------------
A0A7M4FFQ8_BCL2A1-      ---------------------aatatt-actga-----------------
A0A8C8SUC3_BCL2A1-      ---------------------aaacctgcttaa-----------------
K7G130_BCL2A1-01        ---------------------agtatt-attga-----------------
A0A8C3FIW3_BCL2A1-      ---------------------agtact-tttga-----------------
A0A8C0G393_BCL2A1-      ---------------------agtact-attga-----------------
A0A452J3N6_BCL2A1-      ---------------------agtact-attga-----------------
A0A8C4W4P8_BCL2A1-      -----------------------ttct-tttaa-----------------
A0A8C3RME9_BCL2A1-      ---------------------gcttta-tttaa-----------------
A0A674K8Q6_BCL2A1-      -----------------------------ttaa-----------------
A0A8C6VPU0_BCL2A1-      ---------------------aatatc-actcataa--------------
A0A8C5SDG4_BCL2A1-      ---------------------aatatc-actcataa--------------
A0A670YDS2_BCL2A1-      ---------------------aatatc-actcataa--------------
A0A8D0H8G3_BCL2A1-      ---------------------agtatt-attga-----------------
A0A8D2Q8F9_BCL2A1-      -----------------------------ctga-----------------
A0A670JXJ0_BCL2A1-      aagttgatgaaatcctgtttgaagaca-actga-----------------
A0A670JXJ0_BCL2A1-      aagttgatgaaatcctgtttgaagaca-actga-----------------
A0A670JXJ0_BCL2A1-      ---------------------aatatt-actga-----------------
F6S8G3_BCL2A1-01        -----------------------------ctgaag----caattttactg
A0A8C5VB12_BCL2A1-      ---------------------------------------ctccactactg
A0A286XUI2_BCL2A1-      -----------------------------ctgaag----caattctactg
A0A8C2UN30_BCL2A1-      -----------------------------ctgaag----caattctactg
A0A8C5L8K1_BCL2A1-      -----------------------------ctgaag----caa--------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      -----------------------------ctaaag----caatactactg
A0A8C0MTY3_BCL2A1-      -----------------------------ctaaag----caatactactg
A0A8I3MYG9_BCL2A1-      -----------------------------ctaaag----caatactactg
M3YVH4_BCL2A1-01        -----------------------------ctgaag----caatactactg
U6CQS8_BCL2A1-01        -----------------------------ctgaag----caatactactg
A0A452U285_BCL2A1-      -----------------------------cagctggctccagcgttcgtg
G1LIJ8_BCL2A1-01        -----------------------------ctgaag----caatactgctg
A0A452SIR9_BCL2A1-      -----------------------------ctgaag----caatactactg
A0A452U285_BCL2A1-      -----------------------------ctgaag----caatactactg
A0A5F9CXI7_BCL2A1-      -----------------------------cagacg----aaatttcttca
A0A5F9CXI7_BCL2A1-      -----------------------------cagacg----aaatttcttca
A0A5F9CXI7_BCL2A1-      -----------------------------cagacg----aaatttcttca
A0A5F9CXI7_BCL2A1-      -----------------------------cagacg----aaatttcttca
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      ---------------------agaagtcgaaaaga----atctccatctt
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      -----------------------------ctgagg----ctatactattg
A0A8C6QF32_BCL2A1-      -----------------------------ctgaag----caccatcattg
A0A8C6R201_BCL2A1-      -----------------------------ctgaag---------------
A0A8C6GN16_BCL2A1-      ---------------------gagaattacccagg----aaatgaggtag
G3V977_BCL2A1-01        -----------------------------ctcaag----caacactactg
Q925A9_BCL2A1-01        -----------------------------ctcaag----caacactactg
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      -----------------------------ctcaag----taa--------
O55179_BCL2A1-01        -----------------------------ctcaag----taa--------
Q8K164_BCL2A1-01        -----------------------------ctcaag----taa--------
Q4FK02_BCL2A1-01        -----------------------------ctcaag----tag--------
O55177_BCL2A1-02        -----------------------------ctcaag----taa--------
Q497M6_BCL2A1-01        -----------------------------ctcaag----taa--------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      -----------------------------ctcaag----caa--------
A0A8D2B7G1_BCL2A1-      -----------------------------ctgaag----caatactattg
A0A8C5YJP3_BCL2A1-      -----------------------------ctgaag----caatactattg
I3MCZ7_BCL2A1-01        -----------------------------ctgaag----caatactattg
A0A8C9PIV7_BCL2A1-      -----------------------------ctgaag----caa--------
A0A8D2IK51_BCL2A1-      -----------------------------ctgaag----caatactattg
A0A8C9DF25_BCL2A1-      -----------------------------ctcaac----tactga-----
A0A2K6EKG1_BCL2A1-      -----------------------------ctctac----tcctga-----
A0A8C6MJ03_BCL2A1-      -----------------------------caggaa----agatc------
A0A8B9YDG7_BCL2A1-      -----------------------------cagagg----aaatcgcttcg
A0A8B9YDG7_BCL2A1-      -----------------------------cagagg----aaatcgcttcg
A0A8B9YDG7_BCL2A1-      -----------------------------cagagg----aaatcgcttcg
A0A8B9YDG7_BCL2A1-      -----------------------------caggaa----agatc------
A0A452EK63_BCL2A1-      -----------------------------caggaa----agatc------
W5Q0N6_BCL2A1-01        -----------------------------caggaa----agatc------
A0A671FLY8_BCL2A1-      -----------------------------ctgaag----caatactgttg
H0WZ23_BCL2A1-01        -----------------------------ctg------------------
F7HXW0_BCL2A1-01        -----------------------------ttgaag----caatactg---
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      ----------------------------------g----taa--------
A0A2K6TLG6_BCL2A1-      -----------------------------ttgaag----caatacta---
A0A2K6TLG6_BCL2A1-      ----------------------------------g----caatag-----
A0A2K5D2I1_BCL2A1-      -----------------------------ttgaag----caatacta---
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      -----------------------------ctg------------------
A0A2I3GQS0_BCL2A1-      -----------------------------ctgact----cttatggaaac
A0A2K5KAA3_BCL2A1-      -----------------------------ctgaag----caa--------
A0A8D2E7F6_BCL2A1-      -----------------------------ctgaag----caa--------
A0A8C9HCC9_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K6AD27_BCL2A1-      -----------------------------ctgaag----caa--------
A0A0D9RRC3_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K6LV19_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K6PHF2_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K5KHH8_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K6DS18_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K5KHH8_BCL2A1-      -----------------------------ctgaag----caa--------
A0A2K5TMD1_BCL2A1-      -----------------------------ctgaag----caa--------
F7E8V5_BCL2A1-01        -----------------------------ctgaag----caa--------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      -----------------------------ct--------------gaagc
A0A2R8ZJ66_BCL2A1-      -----------------------------ctgact----gttatggaaac
B4E1X9_BCL2A1-02        -----------------------------ct--------------gaagc
A0A2I2YJV4_BCL2A1-      -----------------------------ct--------------gaagc
A0A2I2YJV4_BCL2A1-      -----------------------------ctgact----gttatggaaac
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        -----------------------------ctgaag----caatactat--
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D0Z1Y4_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D1SK15_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A4X1UP21_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D1BRF8_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D1YBS8_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A4X1UP21_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D1SK15_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D0Z1Y4_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8D1YBS8_BCL2A1-      -----------------------------ccgagg----aaatttcttcc
A0A8C0CSU7_BCL2A1-      -----------------------------ctgaag----cagtactat--
A0A8C6FDW6_BCL2A1-      -----------------------------ctgaag----cagtactat--
A0A8C9BC20_BCL2A1-      -----------------------------ctgaag----cagtactat--
A0A5F5PK00_BCL2A1-      -----------------------------ctgagg----aaattttgtca
A0A8C4PQL1_BCL2A1-      -----------------------------ctgaag----caatactat--
A0A5F5PK00_BCL2A1-      -----------------------------ctgaag----caatactac--
A0A5F5PK00_BCL2A1-      -----------------------------ctgagg----aaattttgtca
A0A5F5PK00_BCL2A1-      -----------------------------ctgagg----aaattttgtca
A0A5F5PK00_BCL2A1-      -----------------------------ctgagg----aaattttgtca
                                                                          

A0A673TDC6_BCL2A1-      atttcagtgatgtc------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        a-------------------------------------------------
A0A8C5VB12_BCL2A1-      a-------------------------------------------------
A0A286XUI2_BCL2A1-      a-------------------------------------------------
A0A8C2UN30_BCL2A1-      a-------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      a-------------------------------------------------
A0A8C0MTY3_BCL2A1-      a-------------------------------------------------
A0A8I3MYG9_BCL2A1-      a-------------------------------------------------
M3YVH4_BCL2A1-01        a-------------------------------------------------
U6CQS8_BCL2A1-01        a-------------------------------------------------
A0A452U285_BCL2A1-      agtag---------------------------------------------
G1LIJ8_BCL2A1-01        a-------------------------------------------------
A0A452SIR9_BCL2A1-      a-------------------------------------------------
A0A452U285_BCL2A1-      a-------------------------------------------------
A0A5F9CXI7_BCL2A1-      cttcctaaaacctc------------------------------------
A0A5F9CXI7_BCL2A1-      cttcctaaaacctc------------------------------------
A0A5F9CXI7_BCL2A1-      cttcctaaaacctc------------------------------------
A0A5F9CXI7_BCL2A1-      cttcctaaaacctc------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      tctgagcatgccagacgaagtcgagacagaagagatcatcagggacattt
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      a-------------------------------------------------
A0A8C6QF32_BCL2A1-      a-------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        a-------------------------------------------------
Q925A9_BCL2A1-01        a-------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      a-------------------------------------------------
A0A8C5YJP3_BCL2A1-      a-------------------------------------------------
I3MCZ7_BCL2A1-01        a-------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      a-------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      -------------t------------------------------------
A0A8B9YDG7_BCL2A1-      ctgcccagaacttc------------------------------------
A0A8B9YDG7_BCL2A1-      ctgcccagaacttc------------------------------------
A0A8B9YDG7_BCL2A1-      ctgcccagaacttc------------------------------------
A0A8B9YDG7_BCL2A1-      -------------t------------------------------------
A0A452EK63_BCL2A1-      -------------t------------------------------------
W5Q0N6_BCL2A1-01        -------------t------------------------------------
A0A671FLY8_BCL2A1-      a-------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      aattgccaacacat------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      aa------------------------------------------------
A0A2R8ZJ66_BCL2A1-      gattgccaacacat------------------------------------
B4E1X9_BCL2A1-02        aa------------------------------------------------
A0A2I2YJV4_BCL2A1-      aa------------------------------------------------
A0A2I2YJV4_BCL2A1-      gattgccaacacat------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D0Z1Y4_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D1SK15_BCL2A1-      cttcccaaaacatc------------------------------------
A0A4X1UP21_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D1BRF8_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D1YBS8_BCL2A1-      cttcccaaaacatc------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      cttcccaaaacatc------------------------------------
A0A4X1UP21_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D1SK15_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D0Z1Y4_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8D1YBS8_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      cttcccaaaacatc------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      cttcccaaaacatc------------------------------------
A0A5F5PK00_BCL2A1-      cttcccaaaacatc------------------------------------
A0A5F5PK00_BCL2A1-      cttcccaaaacatc------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      tccggcaagggaagacctgcttcgtcccacggtaccggttccagaacaac
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      cacatggacatgctgagactgacgtcccccgacgaaatttcgttacttcc
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      -------ctggaacattcatcagccgagtgagagtgacacgcgggaggag
A0A5F9CXI7_BCL2A1-      -------ctggaacattcatcagccgagtgagagtgacacgcgggaggag
A0A5F9CXI7_BCL2A1-      -------ctggaacattcatcagccgagtgagagtgacacgcgggaggag
A0A5F9CXI7_BCL2A1-      -------ctggaacattcatcagccgagtgagagtgacacgcgggaggag
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        -------tcctg--------------------------------------
A0A667HQV5_BCL2A1-      -------tcctg--------------------------------------
A0A8C9KZ34_BCL2A1-      -------tcct---------------------------------------
A0A8C8X938_BCL2A1-      caggacgtcctggaatatccttcagcctggagaggatgaggtccgggagg
A0A8C9KZ34_BCL2A1-      -------tcctg--------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      -------gtgaaacattatgtcgcc---------tgaag-----------
A0A8B9YDG7_BCL2A1-      -------ctggaacattcagcagcccggtgaggatgaagttctggaggag
A0A8B9YDG7_BCL2A1-      -------ctggaacattcagcagcccggtgaggatgaagttctggaggag
A0A8B9YDG7_BCL2A1-      -------ctggaacattcagcagcccggtgaggatgaagttctggaggag
A0A8B9YDG7_BCL2A1-      -------gtgaaacattatgtcgcc---------tgaag-----------
A0A452EK63_BCL2A1-      -------gtgaaacattatgtcgtc---------tgaag-----------
W5Q0N6_BCL2A1-01        -------gtgaaacattatgtcgtc---------tgaag-----------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------ttga--
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------ctga--
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------ttga--
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      -----------------------aaatggctttg-----------taa--
A0A2I3GQS0_BCL2A1-      -----------------------aagcaatactg----------ttga--
A0A2I3GQS0_BCL2A1-      -------acttctactttaaaataaacaactttgatgatgtaacttga--
A0A2K5KAA3_BCL2A1-      ------------tactg---------------------------ttga--
A0A8D2E7F6_BCL2A1-      ------------tactg---------------------------ttga--
A0A8C9HCC9_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K6AD27_BCL2A1-      ------------tactg---------------------------ttga--
A0A0D9RRC3_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K6LV19_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K6PHF2_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K5KHH8_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K6DS18_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K5KHH8_BCL2A1-      ------------tactg---------------------------ttga--
A0A2K5TMD1_BCL2A1-      ------------tactg---------------------------ttga--
F7E8V5_BCL2A1-01        ------------tactg---------------------------ttga--
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        ----------------g---------------------------ttaa--
A0A2R8ZJ66_BCL2A1-      ------------tactg---------------------------ttga--
A0A2R8ZJ66_BCL2A1-      -------acttctactt---------------------------ttaa--
B4E1X9_BCL2A1-02        ------------tactg---------------------------ttga--
A0A2I2YJV4_BCL2A1-      ------------tactg---------------------------ttga--
A0A2I2YJV4_BCL2A1-      -------acttctactt---------------------------ttaa--
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      -------------------------------------------------g
A0A8D1BRF8_BCL2A1-      -------ctgggatattcatcagcccggggagaatgagattcgagaggag
A0A8D0Z1Y4_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8D1SK15_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A4X1UP21_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8D1BRF8_BCL2A1-      -------ctgggatattcatcagcccggggagaatgagattcgagaggag
A0A8D1YBS8_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A4X1UP21_BCL2A1-      -------------------------------------------------g
A0A4X1UQW5_BCL2A1-      -------------------------------------------------g
A0A8D0Z1Y4_BCL2A1-      -------------------------------------------------g
A0A8D1BRF8_BCL2A1-      -------------------------------------------------g
A0A8D1SK15_BCL2A1-      -------------------------------------------------g
A0A8D1YBS8_BCL2A1-      -------------------------------------------------g
C7F841_BCL2A1-01        -------------------------------------------------g
A0A8D1KPD1_BCL2A1-      -------------------------------------------------g
A0A8D1BRF8_BCL2A1-      -------ctgggatattcatcagcccggggagaatgagattcgagaggag
A0A4X1UP21_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8D1SK15_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8D0Z1Y4_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8D1YBS8_BCL2A1-      -------ctggaatattcatcagcccggggagaatgagattcgagaggag
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      -------ctggaatattcatcagcctggtgaggaggaggttcgggaggag
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      -------ctggaatattcatcagcctggtgaggaggaggttcgggaggag
A0A5F5PK00_BCL2A1-      -------ctggaatattcatcagcctggtgaggaggaggttcgggaggag
A0A5F5PK00_BCL2A1-      -------ctggaatattcatcagcctggtgaggaggaggttcgggaggag
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      gccttggccaccgggggcctcgacctc--atcttcatgccgggcctcggg
A0A5F9CXI7_BCL2A1-      gccttggccaccgggggcctcgacctc--atcttcatgccgggcctcggg
A0A5F9CXI7_BCL2A1-      gccttggccaccgatg--------cac--a----catgcaga--------
A0A5F9CXI7_BCL2A1-      gccttggccaccgggggcctcgacctc--atcttcatgccgggcctcggg
A0A8C8X938_BCL2A1-      --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      aagccttgtccacagggggacttgatctcatctttgtgccgggtcttggg
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      -------caata--------------------------------------
A0A8B9YDG7_BCL2A1-      gccttgtcaacagggggacttgacctc--atctttgtgccgggtctcggg
A0A8B9YDG7_BCL2A1-      gccttgtcaacagggggacttgacctc--atctttgtgccgggtctcggg
A0A8B9YDG7_BCL2A1-      gccttgtcaacag-------------------------------------
A0A8B9YDG7_BCL2A1-      -------caata--------------------------------------
A0A452EK63_BCL2A1-      -------caata--------------------------------------
W5Q0N6_BCL2A1-01        -------caata--------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgaccct---
A0A8D1BRF8_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D0Z1Y4_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D1SK15_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A4X1UP21_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D1BRF8_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D1YBS8_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A4X1UP21_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A4X1UQW5_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D0Z1Y4_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D1BRF8_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D1SK15_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D1YBS8_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
C7F841_BCL2A1-01        gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D1KPD1_BCL2A1-      gctttgtaaagaag----tttgaacccaaatctggctggctgacctttg-
A0A8D1BRF8_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A4X1UP21_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D1SK15_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D0Z1Y4_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8D1YBS8_BCL2A1-      gccttgtcaacagggggacttgatctc--atcttcatgcctggtcttggg
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gccttgtcaacagcag----------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gccttgtcaacagggggacttgatctc--atcctcatgccaggtcttggg
A0A5F5PK00_BCL2A1-      gccttgtcaacagggggacttgatctc--atcctcatgccaggtcttggg
A0A5F5PK00_BCL2A1-      gccttgtcaacagggggacttgatctc--atcctcatgccaggtcttggg
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ct---------ttgccccctgctgct-----gcttttgctactccgacat
A0A5F9CXI7_BCL2A1-      ttcgacagggacggcaaccggctggggaggggcaggggctactacgacac
A0A5F9CXI7_BCL2A1-      -tgagcagaga-------aggctatggaagagaagaacc-----------
A0A5F9CXI7_BCL2A1-      ttcgacagggacggcaaccggctggggaggggcaggggctactacgacac
A0A8C8X938_BCL2A1-      --------------------------gcggggcaagggctactacgactc
M3WHW2_BCL2A1-01        ---------------------------------aagaactactac-----
A0A667HQV5_BCL2A1-      ---------------------------------aagaactactac-----
A0A8C9KZ34_BCL2A1-      --------------------------------------ctgcttcg----
A0A8C8X938_BCL2A1-      tttgacaagcatggcaaccggctggggcggggcaagggctactacgactc
A0A8C9KZ34_BCL2A1-      ---------------------------------aagaactactac-----
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgc
A0A8B9YDG7_BCL2A1-      ttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgc
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      tctggaagttactggaaagatctg--------------------------
A0A8D1BRF8_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A8D0Z1Y4_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacac
A0A8D1SK15_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacac
A0A4X1UP21_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A8D1BRF8_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A8D1YBS8_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A4X1UP21_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A4X1UQW5_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A8D0Z1Y4_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A8D1BRF8_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A8D1SK15_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A8D1YBS8_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
C7F841_BCL2A1-01        --tggaagttacaggaaagatctg--------------------------
A0A8D1KPD1_BCL2A1-      --tggaagttacaggaaagatctg--------------------------
A0A8D1BRF8_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A4X1UP21_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A8D1SK15_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacac
A0A8D0Z1Y4_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacac
A0A8D1YBS8_BCL2A1-      tttgacaactgtggcaaccgtctggggcggggcaagggctactacgacgc
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      tttgataagcatggcaaccggttggggaggggcaagggctactatgacac
A0A5F5PK00_BCL2A1-      tttgataagcatggcaaccggttggggaggggcaagggctactatgacac
A0A5F5PK00_BCL2A1-      tttgataagcatggcaaccggttggggaggggcaagggctactatgacac
                                                                          

A0A673TDC6_BCL2A1-      --------------------------------------------------
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        --------------------------------------------------
A0A4X2KFL7_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ccgtt--cttcgcttgctgc----tcaggtgcggagtttacgcttcctct
A0A5F9CXI7_BCL2A1-      ctacctgcagcgctgcctgcagcagcagggggcaaagccctacaccatcg
A0A5F9CXI7_BCL2A1-      -------cagcgc-----------acaggg---aaggctgttc-------
A0A5F9CXI7_BCL2A1-      ctacctgcagcgctgcctgcagcagcagggggcaaagccctacaccatcg
A0A8C8X938_BCL2A1-      ctacctgacgcgctgtctgcagcagcgggactcgaagccctacaccgtgg
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      ctacctgacgcgctgtctgcagcagcgggactcgaagccctacaccgtgg
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccctgg
A0A8B9YDG7_BCL2A1-      ctacctgaagcgttgtctgcagtcccaggacgtgaaaccctacaccctgg
A0A8B9YDG7_BCL2A1-      ----------------ttgcagtc--------------------------
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------tga---------------
A0A8C3WEA1_BCL2A1-      -----cgaaatgttat----------------------------------
A0A8D1BRF8_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D0Z1Y4_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D1SK15_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A4X1UP21_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D1BRF8_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D1YBS8_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A4X1UP21_BCL2A1-      -----tgaaatgttat----------------------------------
A0A4X1UQW5_BCL2A1-      -----tgaaatgttat----------------------------------
A0A8D0Z1Y4_BCL2A1-      -----tgaaatgttat----------------------------------
A0A8D1BRF8_BCL2A1-      -----tgaaatgttat----------------------------------
A0A8D1SK15_BCL2A1-      -----tgaaatgttat----------------------------------
A0A8D1YBS8_BCL2A1-      -----tgaaatgttat----------------------------------
C7F841_BCL2A1-01        -----tgaaatgttat----------------------------------
A0A8D1KPD1_BCL2A1-      -----tgaaatgttat----------------------------------
A0A8D1BRF8_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A4X1UP21_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D1SK15_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D0Z1Y4_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8D1YBS8_BCL2A1-      ctacctgaagcgctgtctgcagtcccaggatgtgaagccctacaccctgg
A0A8C0CSU7_BCL2A1-      --------------------------------tga---------------
A0A8C6FDW6_BCL2A1-      --------------------------------tga---------------
A0A8C9BC20_BCL2A1-      --------------------------------tga---------------
A0A5F5PK00_BCL2A1-      ------------------------cctggagatga---------------
A0A8C4PQL1_BCL2A1-      --------------------------------tga---------------
A0A5F5PK00_BCL2A1-      --------------------------------tga---------------
A0A5F5PK00_BCL2A1-      ctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctgg
A0A5F5PK00_BCL2A1-      ctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctgg
A0A5F5PK00_BCL2A1-      ctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctgg
                                                                          

A0A673TDC6_BCL2A1-      --ttcgcttcccacgatttcagtgatgtcatggcttcccacggtttcagt
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        -----------tg-------------------------------------
A0A4X2KFL7_BCL2A1-      -----------tg-------------------------------------
A0A7N4P573_BCL2A1-      -----------aaagagcagatctgtgatgcagtgccagtgggagaagat
A0A7N4P573_BCL2A1-      -----------tg-------------------------------------
A0A7N4P573_BCL2A1-      -----------aaagagcagatctgtgatgcagtgccagtgggagaagat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      tcttgctctcggaacgccagcatggtc------------tggagaccagc
A0A5F9CXI7_BCL2A1-      ccctggccttcagagagcagatctgcccccaggtgcccgtggacgacaca
A0A5F9CXI7_BCL2A1-      ------tctctggagggcgg----------------------------ta
A0A5F9CXI7_BCL2A1-      ccctggccttcagagagcagatctgcccccaggtgcccgtggacgacaca
A0A8C8X938_BCL2A1-      ccttggcgttccgagaacagatgtgcctccgggtccccgtggacgaacac
M3WHW2_BCL2A1-01        --------------------------------------------------
A0A667HQV5_BCL2A1-      --------------------------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      ccttggcgttccgagaacagatgtgcctccgggtccccgtggacgaacac
A0A8C9KZ34_BCL2A1-      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8B9YDG7_BCL2A1-      ccttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaat
A0A8B9YDG7_BCL2A1-      ccttggctttcaaagagcagatctgcctccaggtcccggtgaatgagaat
A0A8B9YDG7_BCL2A1-      ---tgtctggtaa--------------------------tgagtgag---
A0A8B9YDG7_BCL2A1-      --------------------------------------------------
A0A452EK63_BCL2A1-      --------------------------------------------------
W5Q0N6_BCL2A1-01        --------------------------------------------------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      --------------------------------gtgtcc------------
A0A8D1BRF8_BCL2A1-      ccttggctttcaaagaacagatttgcctccaggtccccatggatgaacat
A0A8D0Z1Y4_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A8D1SK15_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A4X1UP21_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A8D1BRF8_BCL2A1-      ccttggctttcaaagaacagatttgcctccaggtccccatggatgaacat
A0A8D1YBS8_BCL2A1-      ccttggctttcaaagaacagatttgcctccaggtccccatggatgaacat
A0A4X1UP21_BCL2A1-      --------------------------------gtctcc------------
A0A4X1UQW5_BCL2A1-      --------------------------------gtctcc------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------gtctcc------------
A0A8D1BRF8_BCL2A1-      --------------------------------gtctcc------------
A0A8D1SK15_BCL2A1-      --------------------------------gtctcc------------
A0A8D1YBS8_BCL2A1-      --------------------------------gtctcc------------
C7F841_BCL2A1-01        --------------------------------gtctcc------------
A0A8D1KPD1_BCL2A1-      --------------------------------gtctcc------------
A0A8D1BRF8_BCL2A1-      ccttggctttcaaagaacagatttgcctccaggtccccatggatgaacat
A0A4X1UP21_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A8D1SK15_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A8D0Z1Y4_BCL2A1-      ccttggctttcaaagaacagatttgccttcaggtccccatggatgaacat
A0A8D1YBS8_BCL2A1-      ccttggctttcaaagaacagatttgcctccaggtccccatggatgaacat
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ccttggctttcaaagaacaaatttgtgtccaggtcccagtggacgaaaat
A0A5F5PK00_BCL2A1-      ccttggctttcaaagaacaaatttgtgtccaggtcccagtggacgaaaat
A0A5F5PK00_BCL2A1-      ccttggctttcaaagaacaaatttgtgtccaggtcccagtggacgaaaat
                                                                          

A0A673TDC6_BCL2A1-      gatgtcatcacttcccacggtttcagtgatgtcatcacttactttccacg
A0A8B9S513_BCL2A1-      --------------------------------------------------
A0A8C6ZVQ3_BCL2A1-      --------------------------------------------------
A0A8C5X4L3_BCL2A1-      --------------------------------------------------
H0ZCL9_BCL2A1-01        --------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8D2QAC0_BCL2A1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      --------------------------------------------------
A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8D2PM01_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C0UPM3_BCL2A1-      --------------------------------------------------
A0A8C3U920_BCL2A1-      --------------------------------------------------
A0A803V184_BCL2A1-      --------------------------------------------------
A0A8C2UCW6_BCL2A1-      --------------------------------------------------
G1N8C5_BCL2A1-01        --------------------------------------------------
A0A8C3KTI3_BCL2A1-      --------------------------------------------------
A0A669PVQ4_BCL2A1-      --------------------------------------------------
A0A8B9CVY0_BCL2A1-      --------------------------------------------------
A0A8B9E009_BCL2A1-      --------------------------------------------------
A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A493SSZ7_BCL2A1-      --------------------------------------------------
A0A8B9UZT1_BCL2A1-      --------------------------------------------------
A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A672UHF9_BCL2A1-      --------------------------------------------------
A0A8C4U5U5_BCL2A1-      --------------------------------------------------
A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8B9RZD1_BCL2A1-      --------------------------------------------------
A0A663E5S6_BCL2A1-      --------------------------------------------------
A0A8C8AIP7_BCL2A1-      --------------------------------------------------
A0A663N622_BCL2A1-      --------------------------------------------------
A0A8C0EQC0_BCL2A1-      --------------------------------------------------
A0A8D0ELW8_BCL2A1-      --------------------------------------------------
A0A8D0EB90_BCL2A1-      --------------------------------------------------
A0A7M4FFQ8_BCL2A1-      --------------------------------------------------
A0A8C8SUC3_BCL2A1-      --------------------------------------------------
K7G130_BCL2A1-01        --------------------------------------------------
A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C0G393_BCL2A1-      --------------------------------------------------
A0A452J3N6_BCL2A1-      --------------------------------------------------
A0A8C4W4P8_BCL2A1-      --------------------------------------------------
A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A670YDS2_BCL2A1-      --------------------------------------------------
A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D2Q8F9_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
A0A670JXJ0_BCL2A1-      --------------------------------------------------
F6S8G3_BCL2A1-01        --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A286XUI2_BCL2A1-      --------------------------------------------------
A0A8C2UN30_BCL2A1-      --------------------------------------------------
A0A8C5L8K1_BCL2A1-      --------------------------------------------------
F6SFL4_BCL2A1-01        ---------------------------------aagtaa-----------
A0A4X2KFL7_BCL2A1-      ---------------------------------aagtaa-----------
A0A7N4P573_BCL2A1-      gatatgagaatagatgaagtgctctatgaagacaaataa-----------
A0A7N4P573_BCL2A1-      ---------------------------------aagtaa-----------
A0A7N4P573_BCL2A1-      gatatgagaatagatgaagtgctctatgaagacaaataa-----------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A8C0KQ53_BCL2A1-      --------------------------------------------------
A0A8C0MTY3_BCL2A1-      --------------------------------------------------
A0A8I3MYG9_BCL2A1-      --------------------------------------------------
M3YVH4_BCL2A1-01        --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
G1LIJ8_BCL2A1-01        --------------------------------------------------
A0A452SIR9_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A5F9CXI7_BCL2A1-      ggctgatactcctaagagcttctctttgttga------------------
A0A5F9CXI7_BCL2A1-      gacatgagcgtcgacgaggtgctgtacgtggacgcggccgcttccctcgc
A0A5F9CXI7_BCL2A1-      ggcagaaatgttaa------------------------------------
A0A5F9CXI7_BCL2A1-      gacatgagcgtcgacgaggtgctgtacgtggacgcggccgcttccctcgc
A0A8C8X938_BCL2A1-      gacgtgagggtggatgaagtcctttacgaagactccacgtag--------
M3WHW2_BCL2A1-01        --------------tga---------------------------------
A0A667HQV5_BCL2A1-      --------------tga---------------------------------
A0A8C9KZ34_BCL2A1-      --------------------------------------ttag--------
A0A8C8X938_BCL2A1-      gacgtgagggtggatgaagtcctttacgaagactccacgtag--------
A0A8C9KZ34_BCL2A1-      --------------tga---------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6GN16_BCL2A1-      --------------------------------------------------
G3V977_BCL2A1-01        --------------------------------------------------
Q925A9_BCL2A1-01        --------------------------------------------------
O55178_BCL2A1-01        --------------------------------------------------
Q0P538_BCL2A1-01        --------------------------------------------------
A0A8C6H5H7_BCL2A1-      --------------------------------------------------
O55179_BCL2A1-01        --------------------------------------------------
Q8K164_BCL2A1-01        --------------------------------------------------
Q4FK02_BCL2A1-01        --------------------------------------------------
O55177_BCL2A1-02        --------------------------------------------------
Q497M6_BCL2A1-01        --------------------------------------------------
A0A8C2LQI3_BCL2A1-      --------------------------------------------------
A0A8C8U2B9_BCL2A1-      --------------------------------------------------
A0A8D2B7G1_BCL2A1-      --------------------------------------------------
A0A8C5YJP3_BCL2A1-      --------------------------------------------------
I3MCZ7_BCL2A1-01        --------------------------------------------------
A0A8C9PIV7_BCL2A1-      --------------------------------------------------
A0A8D2IK51_BCL2A1-      --------------------------------------------------
A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A2K6EKG1_BCL2A1-      --------------------------------------------------
A0A8C6MJ03_BCL2A1-      --------------------------------ctattga-----------
A0A8B9YDG7_BCL2A1-      gatgtgaaggtagacgaagtgctttacgaagactcctga-----------
A0A8B9YDG7_BCL2A1-      gatgtgaaggtagacgaagtgctttacgaagactcctga-----------
A0A8B9YDG7_BCL2A1-      ------------------------------------tga-----------
A0A8B9YDG7_BCL2A1-      --------------------------------ctattga-----------
A0A452EK63_BCL2A1-      --------------------------------ctattga-----------
W5Q0N6_BCL2A1-01        --------------------------------ctattga-----------
A0A671FLY8_BCL2A1-      --------------------------------------------------
H0WZ23_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2I3GQS0_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A8D2E7F6_BCL2A1-      --------------------------------------------------
A0A8C9HCC9_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A0D9RRC3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
F7E8V5_BCL2A1-01        --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K6LV19_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6AD27_BCL2A1-      --------------------------------------------------
A0A2K5KHH8_BCL2A1-      --------------------------------------------------
A0A2K5TMD1_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
H2NNZ9_BCL2A1-01        --------------------------------------------------
B4E1X9_BCL2A1-03        --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-02        --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
B4E1X9_BCL2A1-01        --------------------------------------------------
G3T8E6_BCL2A1-01        --------------------------------------------------
A0A8C3WEA1_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D1BRF8_BCL2A1-      gacatgaag---------gtgat-t------gcc-----------cagtt
A0A8D0Z1Y4_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A8D1SK15_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A4X1UP21_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A8D1BRF8_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A8D1YBS8_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A4X1UP21_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A4X1UQW5_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D0Z1Y4_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D1BRF8_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D1SK15_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D1YBS8_BCL2A1-      ----tgaag----------------------------caatactattga-
C7F841_BCL2A1-01        ----tgaag----------------------------caatactattga-
A0A8D1KPD1_BCL2A1-      ----tgaag----------------------------caatactattga-
A0A8D1BRF8_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A4X1UP21_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A8D1SK15_BCL2A1-      gacatgaag---------gtcatct------gctttccaacactgcaagt
A0A8D0Z1Y4_BCL2A1-      gacatgaaggtagatgaagtcctttatgaagactccccagcatcctaa--
A0A8D1YBS8_BCL2A1-      gacatgaaggtagatgaagtcctttatgaagactccccagcgtcctaa--
A0A8C0CSU7_BCL2A1-      --------------------------------------------------
A0A8C6FDW6_BCL2A1-      --------------------------------------------------
A0A8C9BC20_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A8C4PQL1_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa--
A0A5F5PK00_BCL2A1-      gacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa--
A0A5F5PK00_BCL2A1-      gacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa--
                                                                          

A0A673TDC6_BCL2A1-      gtctcagtga
A0A8B9S513_BCL2A1-      ----------
A0A8C6ZVQ3_BCL2A1-      ----------
A0A8C5X4L3_BCL2A1-      ----------
H0ZCL9_BCL2A1-01        ----------
A0A8C5J3C4_BCL2A1-      ----------
A0A8D2QAC0_BCL2A1-      ----------
A0A8C9MQN0_BCL2A1-      ----------
A0A8C3NVU4_BCL2A1-      ----------
A0A8D2PM01_BCL2A1-      ----------
A0A8C0UPM3_BCL2A1-      ----------
A0A8C0UPM3_BCL2A1-      ----------
A0A8C3U920_BCL2A1-      ----------
A0A803V184_BCL2A1-      ----------
A0A8C2UCW6_BCL2A1-      ----------
G1N8C5_BCL2A1-01        ----------
A0A8C3KTI3_BCL2A1-      ----------
A0A669PVQ4_BCL2A1-      ----------
A0A8B9CVY0_BCL2A1-      ----------
A0A8B9E009_BCL2A1-      ----------
A0A8C3BNR4_BCL2A1-      ----------
A0A493SSZ7_BCL2A1-      ----------
A0A8B9UZT1_BCL2A1-      ----------
A0A8C3K1C5_BCL2A1-      ----------
A0A8B9FJB5_BCL2A1-      ----------
A0A672UHF9_BCL2A1-      ----------
A0A8C4U5U5_BCL2A1-      ----------
A0A8B9Z3D5_BCL2A1-      ----------
A0A8B9RZD1_BCL2A1-      ----------
A0A663E5S6_BCL2A1-      ----------
A0A8C8AIP7_BCL2A1-      ----------
A0A663N622_BCL2A1-      ----------
A0A8C0EQC0_BCL2A1-      ----------
A0A8D0ELW8_BCL2A1-      ----------
A0A8D0EB90_BCL2A1-      ----------
A0A7M4FFQ8_BCL2A1-      ----------
A0A8C8SUC3_BCL2A1-      ----------
K7G130_BCL2A1-01        ----------
A0A8C3FIW3_BCL2A1-      ----------
A0A8C0G393_BCL2A1-      ----------
A0A452J3N6_BCL2A1-      ----------
A0A8C4W4P8_BCL2A1-      ----------
A0A8C3RME9_BCL2A1-      ----------
A0A674K8Q6_BCL2A1-      ----------
A0A8C6VPU0_BCL2A1-      ----------
A0A8C5SDG4_BCL2A1-      ----------
A0A670YDS2_BCL2A1-      ----------
A0A8D0H8G3_BCL2A1-      ----------
A0A8D2Q8F9_BCL2A1-      ----------
A0A670JXJ0_BCL2A1-      ----------
A0A670JXJ0_BCL2A1-      ----------
A0A670JXJ0_BCL2A1-      ----------
F6S8G3_BCL2A1-01        ----------
A0A8C5VB12_BCL2A1-      ----------
A0A286XUI2_BCL2A1-      ----------
A0A8C2UN30_BCL2A1-      ----------
A0A8C5L8K1_BCL2A1-      ----------
F6SFL4_BCL2A1-01        ----------
A0A4X2KFL7_BCL2A1-      ----------
A0A7N4P573_BCL2A1-      ----------
A0A7N4P573_BCL2A1-      ----------
A0A7N4P573_BCL2A1-      ----------
A0A7N4P573_BCL2A1-      ----------
A0A8C0KQ53_BCL2A1-      ----------
A0A8C0MTY3_BCL2A1-      ----------
A0A8I3MYG9_BCL2A1-      ----------
M3YVH4_BCL2A1-01        ----------
U6CQS8_BCL2A1-01        ----------
A0A452U285_BCL2A1-      ----------
G1LIJ8_BCL2A1-01        ----------
A0A452SIR9_BCL2A1-      ----------
A0A452U285_BCL2A1-      ----------
A0A5F9CXI7_BCL2A1-      ----------
A0A5F9CXI7_BCL2A1-      gccctga---
A0A5F9CXI7_BCL2A1-      ----------
A0A5F9CXI7_BCL2A1-      gccctga---
A0A8C8X938_BCL2A1-      ----------
M3WHW2_BCL2A1-01        ----------
A0A667HQV5_BCL2A1-      ----------
A0A8C9KZ34_BCL2A1-      ----------
A0A8C8X938_BCL2A1-      ----------
A0A8C9KZ34_BCL2A1-      ----------
A0A8C0WAG3_BCL2A1-      ----------
A0A8C6QF32_BCL2A1-      ----------
A0A8C6R201_BCL2A1-      ----------
A0A8C6GN16_BCL2A1-      ----------
G3V977_BCL2A1-01        ----------
Q925A9_BCL2A1-01        ----------
O55178_BCL2A1-01        ----------
Q0P538_BCL2A1-01        ----------
A0A8C6H5H7_BCL2A1-      ----------
O55179_BCL2A1-01        ----------
Q8K164_BCL2A1-01        ----------
Q4FK02_BCL2A1-01        ----------
O55177_BCL2A1-02        ----------
Q497M6_BCL2A1-01        ----------
A0A8C2LQI3_BCL2A1-      ----------
A0A8C8U2B9_BCL2A1-      ----------
A0A8D2B7G1_BCL2A1-      ----------
A0A8C5YJP3_BCL2A1-      ----------
I3MCZ7_BCL2A1-01        ----------
A0A8C9PIV7_BCL2A1-      ----------
A0A8D2IK51_BCL2A1-      ----------
A0A8C9DF25_BCL2A1-      ----------
A0A2K6EKG1_BCL2A1-      ----------
A0A8C6MJ03_BCL2A1-      ----------
A0A8B9YDG7_BCL2A1-      ----------
A0A8B9YDG7_BCL2A1-      ----------
A0A8B9YDG7_BCL2A1-      ----------
A0A8B9YDG7_BCL2A1-      ----------
A0A452EK63_BCL2A1-      ----------
W5Q0N6_BCL2A1-01        ----------
A0A671FLY8_BCL2A1-      ----------
H0WZ23_BCL2A1-01        ----------
F7HXW0_BCL2A1-01        ----------
F7HXW0_BCL2A1-02        ----------
A0A2K6TLG6_BCL2A1-      ----------
A0A2K6TLG6_BCL2A1-      ----------
A0A2K6TLG6_BCL2A1-      ----------
A0A2K5D2I1_BCL2A1-      ----------
A0A2K5D2I1_BCL2A1-      ----------
A0A2I3GQS0_BCL2A1-      ----------
A0A2I3GQS0_BCL2A1-      ----------
A0A2I3GQS0_BCL2A1-      ----------
A0A2K5KAA3_BCL2A1-      ----------
A0A8D2E7F6_BCL2A1-      ----------
A0A8C9HCC9_BCL2A1-      ----------
A0A2K6AD27_BCL2A1-      ----------
A0A0D9RRC3_BCL2A1-      ----------
A0A2K6LV19_BCL2A1-      ----------
A0A2K6PHF2_BCL2A1-      ----------
A0A2K5KHH8_BCL2A1-      ----------
A0A2K6DS18_BCL2A1-      ----------
A0A2K5KHH8_BCL2A1-      ----------
A0A2K5TMD1_BCL2A1-      ----------
F7E8V5_BCL2A1-01        ----------
A0A2K5KAA3_BCL2A1-      ----------
A0A2K6LV19_BCL2A1-      ----------
A0A2K6PHF2_BCL2A1-      ----------
A0A2K6AD27_BCL2A1-      ----------
A0A2K5KHH8_BCL2A1-      ----------
A0A2K5TMD1_BCL2A1-      ----------
A0A2K6DS18_BCL2A1-      ----------
H2NNZ9_BCL2A1-01        ----------
B4E1X9_BCL2A1-03        ----------
A0A2R8ZJ66_BCL2A1-      ----------
A0A2R8ZJ66_BCL2A1-      ----------
B4E1X9_BCL2A1-02        ----------
A0A2I2YJV4_BCL2A1-      ----------
A0A2I2YJV4_BCL2A1-      ----------
A0A2R8ZJ66_BCL2A1-      ----------
A0A2I2YJV4_BCL2A1-      ----------
B4E1X9_BCL2A1-01        ----------
G3T8E6_BCL2A1-01        ----------
A0A8C3WEA1_BCL2A1-      ----------
A0A8D1BRF8_BCL2A1-      atatatttag
A0A8D0Z1Y4_BCL2A1-      gaacctgtag
A0A8D1SK15_BCL2A1-      gaacctgtag
A0A4X1UP21_BCL2A1-      gaacctgtag
A0A8D1BRF8_BCL2A1-      gaacctgtag
A0A8D1YBS8_BCL2A1-      gaacctgtag
A0A4X1UP21_BCL2A1-      ----------
A0A4X1UQW5_BCL2A1-      ----------
A0A8D0Z1Y4_BCL2A1-      ----------
A0A8D1BRF8_BCL2A1-      ----------
A0A8D1SK15_BCL2A1-      ----------
A0A8D1YBS8_BCL2A1-      ----------
C7F841_BCL2A1-01        ----------
A0A8D1KPD1_BCL2A1-      ----------
A0A8D1BRF8_BCL2A1-      gaacctgtag
A0A4X1UP21_BCL2A1-      gaacctgtag
A0A8D1SK15_BCL2A1-      gaacctgtag
A0A8D0Z1Y4_BCL2A1-      ----------
A0A8D1YBS8_BCL2A1-      ----------
A0A8C0CSU7_BCL2A1-      ----------
A0A8C6FDW6_BCL2A1-      ----------
A0A8C9BC20_BCL2A1-      ----------
A0A5F5PK00_BCL2A1-      ----------
A0A8C4PQL1_BCL2A1-      ----------
A0A5F5PK00_BCL2A1-      ----------
A0A5F5PK00_BCL2A1-      ----------
A0A5F5PK00_BCL2A1-      ----------
A0A5F5PK00_BCL2A1-      ----------
                                  

© 1998-2023Legal notice