Dataset for CDS Unclassified of organism Branchiostoma lanceolatum

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A8J9YRV3_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Branchiostoma lanceolatum (length=561 residues).
atggtgacatcggattccaggtccattgtgaccgactatgtcttttacaaactgaacaaaaagggcctaccctggcccaa
cgcaccccctctaccccctcccacggacgctcaccgcctcatgcgggaactgggggacaagttcgaggaaagatacaagg
agcagttcgacgagatgggcgaccagctgcacctgactcccgatacggcgtaccagaagtaccacaacgtcgtggcggag
ctgttccgcgagggcgtccgatggggccggctggtcgccctggtggcgttcacgggagcgtgcacggtaacggccgtgga
acgagagatgccgcagtttgtggacagatacgtcgactggactgtacagtatatagacaacaatttggcgcagtggctac
aggaaaacggaggctgggtagacgacctggcaggtgagcaggtaacgcccccgggcctcacctggtggcgcatacctgtg
tgtttactcacggtgggcggggacaaaaatcacctggccgggagaaccaatgacggaaggacgtgctgtgtgctcggata
a
>gnl|bcl2dbcds|A0A8K0AF88_uncBCL2L1-04 Putative BCL2-like 1 gene OS=[Eukaryota] Branchiostoma lanceolatum (length=822 residues).
atggtcgggagtactacgcaaccacacccgatactactgactaaaactggggaattttactgttcacctccttcttcttt
gcttctcgcccggacaggtaggaagccaaaaatgtcagcggcttctcctcagcctctaccaacgggtctatcgccaacat
ctggatgtcctgggctctcgcaactactaggaaggcagcagaaaacggtcgggctgaacgaatttggaagcctttttcat
ctaggcgagaacaacaacaaaatccaacatggccgccagcaagtccagagtcattctgatgcagagaaccccattgtggc
agaggctgaggaactagccaggttctacatccaaacaaaaatcagcaacaggaaacccactccacccaacaagacagcag
ccactctacagagaaccgcagacgaactactggaacggcaccagtatttcttcaacggcatggtcaacaggttacagatc
tcacctgaaacaagctacaccacgttcaagaacgtagcggatgaaatgttaaaggaccaaacggtcaactggggccgagt
cgttgccctgtacgcctttgccggaagaatagccgtccactgtcgagagcagaacccagaagtggctgaaacagtcgggg
aatttctgggaaaatacgtcggaagcaaccttgaaggttggatcaaagaaaatggaggatgggaaaccttgaacaatgtg
ttccggaaggatcaacccgtggaagtcacccttcggaacggacttatcttcacagcagctgcactaggcgctgccgcgac
tgttctcaagctcatctcttga
>gnl|bcl2dbcds|A0A8K0AF88_uncBCL2L1-05 Putative BCL2-like 1 gene OS=[Eukaryota] Branchiostoma lanceolatum (length=711 residues).
atgtcagcggcttctcctcagcctctaccaacgggtctatcgccaacatctggatgtcctgggctctcgcaactactagg
aaggcagcagaaaacggtcgggctgaacgaatttggaagcctttttcatctaggcgagaacaacaacaaaatccaacatg
gccgccagcaagtccagagtcattctgatgcagagaaccccattgtggcagaggctgaggaactagccaggttctacatc
caaacaaaaatcagcaacaggaaacccactccacccaacaagacagcagccactctacagagaaccgcagacgaactact
ggaacggcaccagtatttcttcaacggcatggtcaacaggttacagatctcacctgaaacaagctacaccacgttcaaga
acgtagcggatgaaatgttaaaggaccaaacggtcaactggggccgagtcgttgccctgtacgcctttgccggaagaata
gccgtccactgtcgagagcagaacccagaagtggctgaaacagtcggggaatttctgggaaaatacgtcggaagcaacct
tgaaggttggatcaaagaaaatggaggatgggaaaccttgaacaatgtgttccggaaggatcaacccgtggaagtcaccc
ttcggaacggacttatcttcacagcagctgcactaggcgctgccgcgactgttctcaagctcatctcttga
© 1998-2023Legal notice