Dataset for CDS BAX-like of Organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A7N5J9E6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=579 residues).
atggacgggtccggggaacaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctggccctggagcaggtgccccaggacg
catccaccaagaagctgagcgagtgtctcaaacgcatcggagatgaactggacagtaacatggagttacagaggatgatc
gcagccgtggacacagactccccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A7N5J9E6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=432 residues).
atggacgggtccggggaacaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgatcgcagccgtggacacagactccccgcgcgaggtctttttccgagtggcagctgacatgttttccgatg
gcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactg
cgtcactcaccatctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A7N5J9E6_BAX-03 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=618 residues).
atgagccaccctagttccctggatcccctaggacccaagagtccaggcacctcttccctcctttctcctctagggcccac
cagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatggggggag
agacacctgagctggccctggagcaggtgccccaggacgcatccaccaagaagctgagcgagtgtctcaaacgcatcgga
gatgaactggacagtaacatggagttacagaggatgatcgcagccgtggacacagactccccgcgcgaggtctttttccg
agtggcagctgacatgttttccgatggcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcgg
ctgctgggctggatccaggaccagggtggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgac
catctttgtggctggagtgctcactgcgtcactcaccatctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A7N5JPV0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=708 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgccgg
agcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctgggggacgagctggagctg
atccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggtgaccgacgcctt
cctggctgtggcgtctcagatcttctctggagaacccgtggccacactctggaacccacgaggcctgcggccacacccac
acctgctgcgagcgtctacggagaagccgaagggtcacgacacacactcggggtcacggggtcaccttcttgtaggtgat
gtgaagatgctgagtcatgggctgggtagtggtcgccatggagactgtctgttcaagtttgccttcagaattcagcctga
attttcgggtgatctgagcagaacaaatacaaacaccttagttttaccttccaaaggcggccctgccacgggccaagtgt
ttggttcgcgctcaacgtgccgcccccgttgtcagaggcctgtgggacgtgtcctcgccagtgggtga
>gnl|bcl2dbcds|A0A7N5JPV0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=888 residues).
atggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggagcgcgccgg
agcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccgtgctgctgcgcctgggggacgagctggagctg
atccggcccagcgtctaccgcaacgtggctcgccagctgaacatctccctgcagtctgaaaccgtggtgaccgacgcctt
cctggctgtggcgtctcagatcttctctggagggcccctccttggaaccctgctgggctctctgttgtccgtagacctcc
atagacctcatctccccacctgtgacctcatgtcgtgtcctcgtacctgcgctctgcatcacatggggcaaggtggtgtc
cctgtactcggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctctcgtcgact
gccttggggagtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctcaagtgtgtg
gtcagcacggagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaaggctgcttt
cttcgtgctgttgccggagagatgagctgtgggctccggcacaggctgaagcccggtgctccgacccagaaggccctggg
cccccaagagcatccatgtcctcctcgaccaggctgggaaggctctgacgttcagagccccgcttctgtgctggaggccc
tgccctga
>gnl|bcl2dbcds|A0A7N5JPV0_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BOK (length=834 residues).
atggtggcgatggaggtctcctccagggggccgggtttaagctgcaggcagaggaggcagggcacggcctcaggcacccc
ggacacagaccagcccttccttccacgccactccagacccgtcgccagggccctaactcgaccacctctctcccggggga
ggggtgccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcggtcttcgcggcggagatcatggac
gcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgctcggccgggagttcgtgcacgcgcggct
gctgcgcgccggcctcgcctggagcgcgccggagcgcgccgcgcctgtccccggaggccgcctggcggaggtgtgcgccg
tgctgctgcgcctgggggacgagctggagctgatccggcccagcgtctaccgcaacgtggctcgccagctgaacatctcc
ctgcagtctgaaaccgtggtgaccgacgccttcctggctgtggcgtctcagatcttctctggaggcatcacatggggcaa
ggtggtgtccctgtactcggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccatggtccacgctc
tcgtcgactgccttggggagtttgtgcgcaagaccctggcaccctggctgcgaagacgcggtggatggaccgacgtcctc
aagtgtgtggtcagcacggagcccggcttccgctcccactggctcgtggccgcactctgcagctttggccgcttcctgaa
ggctgctttcttcgtgctgttgccggagagatga
>gnl|bcl2dbcds|A0A7N5JYN4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAK1 (length=933 residues).
atgaaagggggtgcagatcaaagaccaggagtgggagaaggggagccatgccacctgaccgtggccaagtgtgaggggtg
gagcgtctcccctgcgtacaagcccagaccgacccccaggctggaggccctgcatccgcgtccggcggctacacagcaac
ttcctctagagggagctgattggagccgggagccgccggcacctctaggatcaccgcagcctcgcgggtccctagggccg
ttctgggacaagcagaggctgcatccagacgccgggactgcactgacgccttgcctggaagccgggcctgggcacccaaa
cccccgggagcagcctctggcccctcaggatctctggcctcggccctgtgagccatccgggcctgggctagggtccgggc
aggctaaccctgtcctccaccagaacctgagaaatggcatccgggcaaggcccaggtcctcccaggcaggagtgtggaga
gacggccccatcttctacttctgcaccatggggcaggtgggtcggcagctcgccatcatcggggatgacatcaaccagcg
ctacgactctgagttccagaccatgctgcagcacctacagccaacagcagagaacgcctatgagtatttcaccaagatcg
cctcgagcctgtttgagagcggcatcaactggggccgagtggtggctctcctgggcttcggctaccgcctggccctacac
gtctaccagcgtggactgaccggcttcctgggccaggtgacccgcttcgtagccgacttcatgctgcatcattgcattgc
ccggtggattgcgcagaggggcggctgggtggcagccctgaacttgggaaatggccccatcctcaacgtgctgatagttc
tgtctttggttctcttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A7N5JYN4_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAK1 (length=636 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtggagagacggccccatcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
cgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccatc
atcggggatgacatcaaccagcgctacgactctgagttccagaccatgctgcagcacctacagccaacagcagagaacgc
ctatgagtatttcaccaagatcgcctcgagcctgtttgagagcggcatcaactggggccgagtggtggctctcctgggct
tcggctaccgcctggccctacacgtctaccagcgtggactgaccggcttcctgggccaggtgacccgcttcgtagccgac
ttcatgctgcatcattgcattgcccggtggattgcgcagaggggcggctgggtggcagccctgaacttgggaaatggccc
catcctcaacgtgctgatagttctgtctttggttctcttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|A0A7N5JYN4_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAK1 (length=462 residues).
atggcatccgggcaaggcccaggtcctcccaggcaggagtgtggagagacggccccatcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
cgcctgctgacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcggcagctcgccatc
atcggggatgacatcaaccagcgctacgactctgagttccagaccatgctgcagcacctacagccaacagcagagaacgc
ctatgagtatttcaccaagatcgcctcgaggccagcagcaacagccacagcctgtttgagagcggcatcaactggggccg
agtggtggctctcctgggcttcggctaccgcctggccctacacgtctaccagcgtggactga
© 1998-2023Legal notice