Dataset for CDS BAX-like of Organism Cyanoderma ruficeps

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C3NN90_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BAK1 (length=630 residues).
atggcctcagggaatgaggaggagcctccacgggcactggaacgccgggggagccgcagctcagaaggtcgtgtggcaga
ggaggccgagggggtgttccggagtttcgccttctaccgctaccagcaggagcgccaggagcgaggggcagagctgcggc
cggacccggagatcgagcaaatccagcaggacctgaagagcaccgagagccaggtgggcgagcgcctggccatcatcggg
gatgacatctaccggcgctacgacgtggagttctgcagcatgctgggctccctgcagctcacccccgacaacgcctacca
gcacttcaccgaaatcgcctcccggctgttcgagagtggcatcaactggggccgggtgatcgccctgctggccttcgggt
accgcatggccatgcacgtgtggcagcgcggcgtgcgcggcttcctgcgccgcatcgccggcttcctcagggacttcatg
ctgcacaaccacatcgcccgctggatcgcccagcagggaggatggagggccgtgtgggaccgtgagttctgtgtttgtgt
caagtacctgctggtggcggccgtggtgctgctgggccacctggtggtgcgacgcttcttcaccccctga
>gnl|bcl2dbcds|A0A8C3R8A1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyanoderma ruficeps GN=BAX (length=561 residues).
atggcggcggcggcggcttcggcccagcggggcgggggcggcggcggcggcggcgatcccggggccgggcctgggggcgg
ctccggcgagcccgccccacccccggggggcggcggtgagcggaggggctggcgggaccccagccccgacaccaaacgcc
tcagcgagtgcctgcggcgcatcggcgacgagctcgacagcaacatggagctgcagaggatgatcgagcaggtgggctgt
gacgcccccaaaaagctgttcttccgcgtggccaaggagatgttcgccgacggcaccttcaactggggccgcgtggtcgc
cctgttctacttcgcctgcaaactggtgctgaaggctctctgcaccaaggtgcccgagctggtgcagaccatcctgcgct
ggaccatggagtatctccaggagcacgtgctggcctggatccaggcccagggcggatgggaagggctcctgtcccacttt
gggacccccacctggcagaccatcaccatcttcgccgccggcgtcctcacagcctcgctgaccatctggaagatgtcgta
g
>gnl|bcl2dbcds|A0A8C3RHI9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyanoderma ruficeps GN=BOK (length=642 residues).
atggaggtgctacgtcgttcctcagtctttgctgcagaggtgatggaggtgtttgacaggtctcccactgacaaagagct
tgtgtcccaagccaaggctctctgcagagactacataaactccaggctgattcaggcaggtgtcagctggagcaaacccg
agtacaacgccccagtgcctgggggtaagctggccgaggtgtccaccatactgctacgacttggggatgagctggagtac
attcgccccaacgtctaccggaacatcgcgcgccagctcaacatctccctgcactccgagaccgtcgtgtccgacgcctt
cctggctgtggctgcgcagattttcactgcaggcataacgtggggcaaggtggtgtccctgtacgccgtggcggccgggc
tggccgtggactgcgtgcggcacgcgcagcccgccatggtccacaccatcgtcgactgcctgggggagtttgtccgcaag
accttggtgacctggctgaaaaggagagggggctgggcagacatcacaaaatgtgtggtgaatactgaccccaaccttcg
ctcccactggctggtggccgctgtttgcagttttggtcacttcctcaaggccatcttcttcgtcctgctgcctgagagat
ga
© 1998-2023Legal notice