Dataset for CDS BAX of Organism Gopherus evgoodei

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4WFJ5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gopherus evgoodei GN=BAX (length=609 residues).
atggcggcagctccgggtggggagagcgagagcggccgggggggcggcggggccacgtcggatcaaatcctgcagacggg
agcggttctgttgcaggggttcatccgggaccgggtccagcgctgtggggactcccaggctgtggagctgagccgggcag
agctgggggggccggagccccccctctgcgatgagaacaccaagcggctcagcgagtgcctgcggcggatcggggacgag
ctcgatagcaacgccgagctgcagagtatgattgaccgagtgggggcccacgcccccaaggaagtcttcttccgcgtggc
cgccgagatgttctccgacgggaccttcaactggggccgggtcgtggcgcttttctacttcgcctgcaaactggtgctca
aggctctgtgcaccaaggtccccgagctggtacggaccatcgtgggctggacgttggagtacctccgggatcatgtgctg
gcctggatccaggcccagggaggatgggacggcctcctctcctacttcggcacacctacctggcagaccatcaccatctt
cgccgccggcgtgctcaccgcctccctcaccatctggaagatgtcatag
© 1998-2023Legal notice