Dataset for CDS Unclassified of Organism Cyanistes caeruleus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0VEB4_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cyanistes caeruleus (length=429 residues).
atgtctcgtatcaggagagctcccaggcactttgtcctctccagctaccccaatggagcaccagaagaggaaacctacag
taacctccaaacaattccagatacgacagagcaaatggagattgataccagctcagctactcagattggccatcagctgg
ccctgattggggatgaatttaacaggaggtaccacaggacattagaagaaacactgcttcacctggcaagagttgttttt
cagacctggaatgttattaaaagtgttaaaagaagctttggagatgttgtgagcagtaactggacaaagtggatcagtgg
ctgtggaggctggacctgcaggcttcctgtgaggtgcctctgccagaagctggtgcctgcagccttgcttgttgctgcct
tttggtgggccatgaattatggactgtag
© 1998-2023Legal notice