Dataset for CDS BAX-like of Organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2YAM0_BAX-05       atggacg-ggtccggggagcagcccag------------aggcggggggc
A0A2I2YAM0_BAX-02       atggacg-ggtccggggagca-----------------------------
A0A2I2YAM0_BAX-03       atggacg-ggtccggggagcagcccag------------aggcggggtga
A0A2I2YAM0_BAX-01       atggacg-ggtccggggagcagcccag------------aggcggggggc
A0A2I2YAM0_BAX-04       atggacg-ggtccggggagcagcccag------------aggcggggggc
A0A2I2ZF28_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A2I2Y8H5_BAK1-01      atg-----gcatcggggcaaggcccagggcctcccaggcaggagtgcgga
A0A2I2YT72_BAK1-02      atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
A0A2I2YT72_BAK1-01      atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
A0A2I2YT72_BAK1-03      atg-----gcttcggggcaaggcccaggtcctcccaggcaggagtgcgga
                        ***     *   *** *                                 

A0A2I2YAM0_BAX-05       ccaccagctctgagc------------agatcatgaagacaggggccct-
A0A2I2YAM0_BAX-02       --------------------------------------------------
A0A2I2YAM0_BAX-03       cacctcgttctga-----------------------------------t-
A0A2I2YAM0_BAX-01       ccaccagctctgagc------------agatcatgaagacaggggccct-
A0A2I2YAM0_BAX-04       ccaccagctctgagc------------agatcatgaagacaggggccct-
A0A2I2ZF28_BOK-01       cgcctttgaccgctcgcccacagacaaggagctggtggcccaggccaagg
A0A2I2Y8H5_BAK1-01      aagcctgccctgcgc-tctgcttctgaggagcaggtagcccaggacacgg
A0A2I2YT72_BAK1-02      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
A0A2I2YT72_BAK1-01      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
A0A2I2YT72_BAK1-03      gagcctgccctgccc-tctgcttctgaggagcaggtagcccaggacacag
                                                                          

A0A2I2YAM0_BAX-05       ----------------------tttgcttcagggtttcatccaggatcga
A0A2I2YAM0_BAX-02       ----------------------------------tttcatccaggatcga
A0A2I2YAM0_BAX-03       ----------------------tctgcaccctcactccatccccactcta
A0A2I2YAM0_BAX-01       ----------------------tttgcttcagggtttcatccaggatcga
A0A2I2YAM0_BAX-04       ----------------------tttgcttcagg-----------------
A0A2I2ZF28_BOK-01       cgctgggccgggagtacgtgcacgcgcggctac--tgcgcgccggcctct
A0A2I2Y8H5_BAK1-01      agg-ggttt-------------tccgcagctaca----------------
A0A2I2YT72_BAK1-02      aggaggttt-------------tccgcagctacgttttttaccgccatca
A0A2I2YT72_BAK1-01      aggaggttt-------------tccgcagctacgttttttaccgccatca
A0A2I2YT72_BAK1-03      aggaggttt-------------tccgcagctacgttttttaccgccatca
                                                                          

A0A2I2YAM0_BAX-05       gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
A0A2I2YAM0_BAX-02       gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
A0A2I2YAM0_BAX-03       ----g-----gcgaatggggggggaggcacccgagct--ggccctggacc
A0A2I2YAM0_BAX-01       gcagg-----gcgaatggggggggaggcacccgagct--ggccctggacc
A0A2I2YAM0_BAX-04       --------------------------------------------------
A0A2I2ZF28_BOK-01       cctggagcgcgc---------ccgagcgcgccgcgcc--ggtcccgggac
A0A2I2Y8H5_BAK1-01      ---------------------gatggcaccctgcgcc-------------
A0A2I2YT72_BAK1-02      gcagaacc---------------------cctctgccatgagcca-----
A0A2I2YT72_BAK1-01      gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
A0A2I2YT72_BAK1-03      gcaggaacaggaggctgaaggggcggctgcccctgcc--gacccagagat
                                                                          

A0A2I2YAM0_BAX-05       cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
A0A2I2YAM0_BAX-02       cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
A0A2I2YAM0_BAX-03       cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
A0A2I2YAM0_BAX-01       cggtgcctcagg-----------atgcgtccaccaagaagctgagcgagt
A0A2I2YAM0_BAX-04       --------------------------------------------------
A0A2I2ZF28_BOK-01       gcctggctgaggtgtgc------gcggtgctgctgcgcctgggcgatg--
A0A2I2Y8H5_BAK1-01      --------------tccaacctagaagcaccatggggcaggtgggacggc
A0A2I2YT72_BAK1-02      ---------------------------------gggcctggtgggacggc
A0A2I2YT72_BAK1-01      ggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggc
A0A2I2YT72_BAK1-03      ggtcacgttacctctgcaacctagcagcaccatggggcaggtgggacggc
                                                                          

A0A2I2YAM0_BAX-05       gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
A0A2I2YAM0_BAX-02       gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
A0A2I2YAM0_BAX-03       gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
A0A2I2YAM0_BAX-01       gtctcaagcgcatcggggacgaactggacag-taacatgg------agct
A0A2I2YAM0_BAX-04       --------------------------------------------------
A0A2I2ZF28_BOK-01       agctggagatgatccggcccagcgtctaccg-caacgtggcacgtcagct
A0A2I2Y8H5_BAK1-01      agctcgccatcacc-aggacgacatcaaccggcactatgacttcggagtt
A0A2I2YT72_BAK1-02      agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
A0A2I2YT72_BAK1-01      agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
A0A2I2YT72_BAK1-03      agctcgccatcatcggggacgacatcaaccgacgctatgac-tcagagtt
                                                                          

A0A2I2YAM0_BAX-05       gcagaggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2YAM0_BAX-02       gcagaggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2YAM0_BAX-03       gcagaggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2YAM0_BAX-01       gcagaggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2YAM0_BAX-04       -----ggatgat--------tgccgccgtggacacagactccccccgaga
A0A2I2ZF28_BOK-01       gcacatc---------tccctgcagtctgagcctgtggtgaccgatgcg-
A0A2I2Y8H5_BAK1-01      ccagaccatgctgcagcgtctgcagcccagggcagagaacgcctacgag-
A0A2I2YT72_BAK1-02      ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
A0A2I2YT72_BAK1-01      ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
A0A2I2YT72_BAK1-03      ccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgag-
                                            *** * *   * *   *    **   * * 

A0A2I2YAM0_BAX-05       ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2YAM0_BAX-02       ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2YAM0_BAX-03       ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2YAM0_BAX-01       ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2YAM0_BAX-04       ggtctttttccgagtggcagctga--------------------catgtt
A0A2I2ZF28_BOK-01       ----ttcctggccgtggctggcca--------------------catctt
A0A2I2Y8H5_BAK1-01      ----tacttcaccaagatcgcctc--------------------cagcct
A0A2I2YT72_BAK1-02      ----tacttcaccaagattgccac--------------------cagcct
A0A2I2YT72_BAK1-01      ----tacttcaccaagattgccac--------------------cagcct
A0A2I2YT72_BAK1-03      ----tacttcaccaagattgccaccaggccagcagcaacacccacagcct
                            *   *      *   *                        **   *

A0A2I2YAM0_BAX-05       ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2YAM0_BAX-02       ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2YAM0_BAX-03       ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2YAM0_BAX-01       ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2YAM0_BAX-04       ttctgacggcaacttcaactggggccgggttgtcgcccttttctactttg
A0A2I2ZF28_BOK-01       ctctgca---ggcatcacgtggggcaaggtggtgtccct----gtatgcg
A0A2I2Y8H5_BAK1-01      gtttgagagtggcatcaaccggggccgtgtggtggctctcctgggcttcg
A0A2I2YT72_BAK1-02      gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
A0A2I2YT72_BAK1-01      gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
A0A2I2YT72_BAK1-03      gtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcg
                         * **       * ***   *****   ** **  * **       *  *

A0A2I2YAM0_BAX-05       ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2YAM0_BAX-02       ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2YAM0_BAX-03       ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2YAM0_BAX-01       ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2YAM0_BAX-04       ccagcaaa----ctggtactcaaggccctgtgc---accaaggtgccgga
A0A2I2ZF28_BOK-01       gtggccgcagggctggccgt----ggactgtgtgaggcaggcccagcctg
A0A2I2Y8H5_BAK1-01      gctaccgt----ctggtctt----acac-gtct---accagcacagcctg
A0A2I2YT72_BAK1-02      gctaccgt----ctggccct----acac-gttt---accagcatggcctg
A0A2I2YT72_BAK1-01      gctaccgt----ctggccct----acac-gttt---accagcatggcctg
A0A2I2YT72_BAK1-03      gctaccgt----ctggccct----acac-gttt---accagcatggcctg
                            *       ****   *       * **      *        *   

A0A2I2YAM0_BAX-05       actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2YAM0_BAX-02       actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2YAM0_BAX-03       actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2YAM0_BAX-01       actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2YAM0_BAX-04       actga--tcagaaccatcatgggctggacgttgga---cttcctccggga
A0A2I2ZF28_BOK-01       ccatg-gtccacgccctcgtggactgcctggggga---gttcgtgc----
A0A2I2Y8H5_BAK1-01      actggcttcctgggcctggtgacccgcttcgtggt---cttcatgctgca
A0A2I2YT72_BAK1-02      actggcttcctaggccaggtgacccgcttcgtggttgacttcatgctgca
A0A2I2YT72_BAK1-01      actggcttcctaggccaggtgacccgcttcgtggttgacttcatgctgca
A0A2I2YT72_BAK1-03      a-------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       gcg----gctgttgggctggatccaagaccagggtggttgggtg------
A0A2I2YAM0_BAX-02       gcg----gctgttgggctggatccaagaccagggtggttgggggctgccc
A0A2I2YAM0_BAX-03       gcg----gctgttgggctggatccaagaccagggtggttg----------
A0A2I2YAM0_BAX-01       gcg----gctgttgggctggatccaagaccagggtggttg----------
A0A2I2YAM0_BAX-04       gcg----gctgttgggctggatccaagaccagggtggttg----------
A0A2I2ZF28_BOK-01       gcaagaccctggcaacctggctgcggagacgcggcggatggactgatgtc
A0A2I2Y8H5_BAK1-01      acacggcattgcccggtggatctcgcaga-ggggcggctgggtggcagcc
A0A2I2YT72_BAK1-02      tcactgcattgcccggtggattgcacaga-ggggtggctgggtggcagcc
A0A2I2YT72_BAK1-01      tcactgcattgcccggtggattgcacaga-ggggtggctgggtggcagcc
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       ---------------------------------------agactcctcaa
A0A2I2YAM0_BAX-02       ctggccgagtcactgaagcgactgatgtccctgtctccaggac------g
A0A2I2YAM0_BAX-03       ---------------------------------------ggac------g
A0A2I2YAM0_BAX-01       ---------------------------------------ggac------g
A0A2I2YAM0_BAX-04       ---------------------------------------ggac------g
A0A2I2ZF28_BOK-01       ctcaagtgtgtggtcagcac-------------------agaccct---g
A0A2I2Y8H5_BAK1-01      ccgga------------ctt-------------------gggcaat---a
A0A2I2YT72_BAK1-02      ctgaa------------ctt-------------------gggcaat---g
A0A2I2YT72_BAK1-01      ctgaa------------ctt-------------------gggcaat---g
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       gcctcctcacccccaccaccacgccctcaccactgcccctgccccaccgt
A0A2I2YAM0_BAX-02       gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
A0A2I2YAM0_BAX-03       gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
A0A2I2YAM0_BAX-01       gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
A0A2I2YAM0_BAX-04       gcctcctctcctactttgggacgcccacgtggcagaccgtg---------
A0A2I2ZF28_BOK-01       gcctccgctcccactggctggtagctgc-------actctgcagcttcg-
A0A2I2Y8H5_BAK1-01      gtcccatcctgaacgtgctggtggttgtgggtggggttctgctg----g-
A0A2I2YT72_BAK1-02      gtcccatcctgaacgtgctggtggttctgggtgtggttctgttg----g-
A0A2I2YT72_BAK1-01      gtcccatcctgaacgtgctggtggttctgggtgtggttctgttg----g-
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       cccttccccccgccactcctctgggaccctgggccttctggagcaggtca
A0A2I2YAM0_BAX-02       -----------accatctttgtgg-------------cgggagt-gctca
A0A2I2YAM0_BAX-03       -----------accatctttgtgg-------------cgggagt-gctca
A0A2I2YAM0_BAX-01       -----------accatctttgtgg-------------cgggagt-gctca
A0A2I2YAM0_BAX-04       -----------accatctttgtgg-------------cgggagt-gctca
A0A2I2ZF28_BOK-01       -----------gccg-cttcctga-------------aggctgc------
A0A2I2Y8H5_BAK1-01      -----------gcca-gtttgtgg-------------taagaag------
A0A2I2YT72_BAK1-02      -----------gcca-gtttgtgg-------------tacgaag------
A0A2I2YT72_BAK1-01      -----------gcca-gtttgtgg-------------tacgaag------
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       cagtggtgccctctccccatcttcagatcatcagatgtggtctataatgc
A0A2I2YAM0_BAX-02       ccgc----ctcactcaccatctgga----agaagatg-------------
A0A2I2YAM0_BAX-03       ccgc----ctcactcaccatctgga----agaagatg-------------
A0A2I2YAM0_BAX-01       ccgc----ctcactcaccatctgga----agaagatg-------------
A0A2I2YAM0_BAX-04       ccgc----ctcactcaccatctgga----agaagatg-------------
A0A2I2ZF28_BOK-01       --------cttcttcgtgctgctgc----cagagaga-------------
A0A2I2Y8H5_BAK1-01      --------attcttc----------------aaatca-------------
A0A2I2YT72_BAK1-02      --------attcttc----------------aaatca-------------
A0A2I2YT72_BAK1-01      --------attcttc----------------aaatca-------------
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       gtttttacgtgtctga----------------------------------
A0A2I2YAM0_BAX-02       ----------ggctgaggcccccagctgccttggactgtgtttttcctcc
A0A2I2YAM0_BAX-03       ----------ggctga----------------------------------
A0A2I2YAM0_BAX-01       ----------ggctga----------------------------------
A0A2I2YAM0_BAX-04       ----------ggctga----------------------------------
A0A2I2ZF28_BOK-01       -------------tga----------------------------------
A0A2I2Y8H5_BAK1-01      -------------tga----------------------------------
A0A2I2YT72_BAK1-02      -------------tga----------------------------------
A0A2I2YT72_BAK1-01      -------------tga----------------------------------
A0A2I2YT72_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2YAM0_BAX-05       ----
A0A2I2YAM0_BAX-02       ataa
A0A2I2YAM0_BAX-03       ----
A0A2I2YAM0_BAX-01       ----
A0A2I2YAM0_BAX-04       ----
A0A2I2ZF28_BOK-01       ----
A0A2I2Y8H5_BAK1-01      ----
A0A2I2YT72_BAK1-02      ----
A0A2I2YT72_BAK1-01      ----
A0A2I2YT72_BAK1-03      ----
                            

© 1998-2023Legal notice