Dataset for CDS BAX-like of Organism Cairina moschata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3C1E8_BAK1-01      atggtctggggttgggtttctattttttttttttttttttcgctctcttc
A0A8C3CAP9_BOK-01       atgg---------aagt---------------------------------
                        ****           **                                 

A0A8C3C1E8_BAK1-01      ttcttttccctcctcctccccggccctgctcgcttccttcccccgcgccg
A0A8C3CAP9_BOK-01       -------------------------------gctt----------cgccg
                                                       ****          *****

A0A8C3C1E8_BAK1-01      cgccgctgcgctccggggaggaggcaggaagggagcggcggggatggggc
A0A8C3CAP9_BOK-01       atcctcagtcttc---------------------gctgcagaggtga---
                          ** * *   **                     ** ** * * **    

A0A8C3C1E8_BAK1-01      agctccccggagggatgcgttagggctctccgggacccccccggcccgcc
A0A8C3CAP9_BOK-01       -------tggaggtgttcgacaggtctccc--------------------
                                *****  * **  *** *** *                    

A0A8C3C1E8_BAK1-01      tggaccccaccgggagccggtaaatctgatcctccccagc-----atctc
A0A8C3CAP9_BOK-01       ----actgacaaggagcttgtg----------tcccaagctaaggctctc
                             *  **  *****  **           **** ***      ****

A0A8C3C1E8_BAK1-01      tgcgatggcctcagggaacgacggagacccaccgagggcccacggacgcc
A0A8C3CAP9_BOK-01       tgt----------agagactacataaattcaaggctggttcgagca----
                        **            *  ** **  * *  **  *  **  *  * *    

A0A8C3C1E8_BAK1-01      ggggcagcaatgggcgcagactatcacaagagctcaattcagaagaccag
A0A8C3CAP9_BOK-01       --ggtgtcagttggagcaaacc------cgagtgcaatgca------cca
                          **   ** * ** *** **        ***  **** **      *  

A0A8C3C1E8_BAK1-01      gtggct--caggaaaccga-ggaggtgtttcggagctacgccttctaccg
A0A8C3CAP9_BOK-01       gtgcctggcgggaagctggccgaggtgtc-----------caccatactg
                        *** **  * **** * *   *******            *    *** *

A0A8C3C1E8_BAK1-01      ctaccaacaggagagagaagagagcggggaagaagtgcccttggacccgg
A0A8C3CAP9_BOK-01       ctgcggctgggagat------gagctggaata------cattcgccccaa
                        ** *     *****       **** ** *        * ** * ***  

A0A8C3C1E8_BAK1-01      agattgcggagatccagcaag--agctgggca-------gtaccgggagc
A0A8C3CAP9_BOK-01       cgtctaccggaacatcgcccgccagctgaacatctctctgcactcggaga
                         *  * * *  *    **  *  *****  **       * **  **** 

A0A8C3C1E8_BAK1-01      ctggtggggaggcgcctggccatcatcggtgatgacattaacaagcggta
A0A8C3CAP9_BOK-01       c-agtggtgacggac---gccttcctggctgtagcc--------------
                        *  **** ** *  *   *** ** * * **  * *              

A0A8C3C1E8_BAK1-01      cgacgccgagtttcgctacatgctgaaatccttgcagcccaccaaggaga
A0A8C3CAP9_BOK-01       --acgcagattttcaccgcaggcataa---cgtgggg-----caaggtgg
                          **** ** **** *  ** **  **   * **  *     ***** * 

A0A8C3C1E8_BAK1-01      acgcctacaattacttcatcacgatcgcctccagcctgtttgaaagcggc
A0A8C3CAP9_BOK-01       -----------tgtctctctacg--------------------cagtggc
                                   *   **   ***                     ** ***

A0A8C3C1E8_BAK1-01      attaactggggccgggtgatcgcgctgctgggcttcggctactgcatggc
A0A8C3CAP9_BOK-01       ag----cggggctgg----------cggtggactgcg--tgcggcac---
                        *      ***** **           * *** ** **  * * ***    

A0A8C3C1E8_BAK1-01      catccacgtctaccagcacggcgtaacaggcttcctccgccgcatcgccc
A0A8C3CAP9_BOK-01       ---------------gcacagc----cagccatggtgcacaccatcgtcg
                                       **** **    *** * *  * * *  ***** * 

A0A8C3C1E8_BAK1-01      gctacgtgacggagttcatgctgcacaaccgcatcgcccagtggatcgcc
A0A8C3CAP9_BOK-01       actgcctgggggagtttgt-ccgcaagaccttggtgacc--tggctgaaa
                         ** * **  ******  * * ***  ***     * **  *** *    

A0A8C3C1E8_BAK1-01      cagcagggaggatgggt-ggctgcactcgatctg--gacaatgtttacat
A0A8C3CAP9_BOK-01       aggcgaggaggctgggcagacatcacgaagtgtgttgtgaatactgaccc
                          **  ***** ****  * *  ***    * **  *  ***  * **  

A0A8C3C1E8_BAK1-01      gaa-----gtacatgctggcggtggtggcc-ctggtgatgg--tggggca
A0A8C3CAP9_BOK-01       cagccttcgctcccactggc--tcgtggctgctgtttgcagctttgggca
                         *      *  *   *****  * *****  *** *    *  * *****

A0A8C3C1E8_BAK1-01      tttagtggtgactataaggcttgggcttgaaactgtgactggccctgtct
A0A8C3CAP9_BOK-01       cttcctcaaggcgat----ctt---cttcgtgctg---------ctgcct
                         **  *   * * **    ***   ***    ***         *** **

A0A8C3C1E8_BAK1-01      ga-------
A0A8C3CAP9_BOK-01       gagagatga
                        **       

© 1998-2023Legal notice