Dataset for CDS MCL-1 of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2XZL8_MCL1-01      atgagtatggtgcagcccacaagccaagttctgaagccccaaggccgccc
A0A3Q2Y539_MCL1-01      atg---------------------------ccggagagtaaacgctttcc
                        ***                           * * **    ** **   **

A0A3Q2XZL8_MCL1-01      catgcgc--ccacaaaa-tggagtcgcggaaggcttattgcaatgcaact
A0A3Q2Y539_MCL1-01      cctgtataacttcaaggttggactcgtggacgctttaatg---------t
                        * **     *  ***   **** *** *** *  *** **         *

A0A3Q2XZL8_MCL1-01      ctccccccgtcgccgccgcgtccacatcgccgccacagcttcatcgggcc
A0A3Q2Y539_MCL1-01      tgcctccaaaggctgtcg---------------------ttcaaggatcc
                          ** **    ** * **                     ****  *  **

A0A3Q2XZL8_MCL1-01      gtggcgaccttgggcgccgttaactgcaacagcggggccgccaagccccg
A0A3Q2Y539_MCL1-01      atgg---cctcg--------cagctgcaggaggtggaacgtcg-------
                         ***   *** *         * *****  **  **  ** *        

A0A3Q2XZL8_MCL1-01      acctagcgccttggaaattctctgcaagggcggactagccaccatgaacc
A0A3Q2Y539_MCL1-01      -------------------ttctg--------------------------

A0A3Q2XZL8_MCL1-01      accgcaacaacagcgacgacgacttcgatgtggaaagcagcgacgactca
A0A3Q2Y539_MCL1-01      ------ataacagcgac------------atggatgaaggcgcccagccg
                              * *********             ****     *** * *  * 

A0A3Q2XZL8_MCL1-01      ccaccgagtacccccgactcccaggactcactagtcgccgacggccgcaa
A0A3Q2Y539_MCL1-01      ttgccg---------gagctccaaacccctcc---------cggcc---a
                           ***         **   ***   * * *          *****   *

A0A3Q2XZL8_MCL1-01      cgacgtggtggacgccgagaccaagggcctcattagacgttttctcacag
A0A3Q2Y539_MCL1-01      aggcgtcttggacaccgagacgagacgtctcatcggccgcttcctccgtg
                         * ***  ***** ******* *   * *****  * ** ** ***   *

A0A3Q2XZL8_MCL1-01      actttaccggcctgtcgactgctagctggaacgaaagcaaggcacattcg
A0A3Q2Y539_MCL1-01      actttaccgggctgtccactgctgcttggatccaaagcaaagcccagtcg
                        ********** ***** ******   **** * ******* ** ** ***

A0A3Q2XZL8_MCL1-01      accatgaaaagagtcgtggctaaggttttggaaaagcacaagtacaagta
A0A3Q2Y539_MCL1-01      acaatgaagagggtcgtgacgagactggtggacaagcacaggatcttatt
                        ** ***** ** ****** * *   *  **** ******* *  *   * 

A0A3Q2XZL8_MCL1-01      caatggtatcatcaacaaattgtctctggacgaccgaggggacaacgtga
A0A3Q2Y539_MCL1-01      caataacatggtcaacgaactgtcactggaccaaagagggctcgacaggt
                        ****   **  ***** ** **** ****** *  *****  * **  * 

A0A3Q2XZL8_MCL1-01      gcttcatcagtgaagtagccaagagcctgttttcggatgggacaaccaac
A0A3Q2Y539_MCL1-01      cctttgtcagccaggtggcccaaacggaattcgccaatgggaacattaac
                         ***  ****  * ** *** * *     **  *  ******  *  ***

A0A3Q2XZL8_MCL1-01      tgggggcgcgtggccagcttggtggcctttggggccattgtgtcccagca
A0A3Q2Y539_MCL1-01      tggggtcgcatcgccagcctgttggccttctgtgccgtgctgtctcaagc
                        ***** *** * ****** ** *******  * *** *  **** **   

A0A3Q2XZL8_MCL1-01      cctgaaagaaaagggccgggcccactgtgtggagccggtggccgatgaga
A0A3Q2Y539_MCL1-01      cttgaaagaaaatcagcaggagaggtgcgtggaactggtggcccaggagg
                        * **********    * **     ** ***** * ******* * *** 

A0A3Q2XZL8_MCL1-01      tctcttcgtatctgctgtcgcaccagcgcaactggctggtgaaaaacaac
A0A3Q2Y539_MCL1-01      tctcgacctacttgctgtcacaccagcgcacctggctagtgcagcacaac
                        ****  * **  ******* ********** ****** *** *  *****

A0A3Q2XZL8_MCL1-01      tcttgggatggctttgtacaattctttcgggaagtggatcctgagtctac
A0A3Q2Y539_MCL1-01      ggttgggatggatttgcagaattcttcaaggaagacgacctggagtctac
                          ********* **** * *******   *****  ** *  ********

A0A3Q2XZL8_MCL1-01      agtgaggaacacattaatggcctttgctggagtggctggcat-----tgg
A0A3Q2Y539_MCL1-01      agtgaggaatggcctcttcgcctttgttggtttggtcagcgtcactgcag
                        *********     *  * ******* ***  ***   ** *       *

A0A3Q2XZL8_MCL1-01      cgccacactggccctgttgatcaggtga
A0A3Q2Y539_MCL1-01      cgctacgctgtc-----tgattcgatga
                        *** ** *** *     ****  * ***

© 1998-2022Legal notice