Dataset for CDS BCL-2-like of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671LAP7_MCL1-01      atgactc-tgagtttggggaatagaccgatggctgcgttgggtgtcct--
A0A671LEY4_MCL1-01      atgactc-tgagtttagtcagaaga---acggctgcggtgagtctgctcg
A0A671K7W7_BCL2L1-      atgtctt------------------actataa----------c-------
A0A671K7W7_BCL2L1-      atgtctt------------------actataa----------c-------
A0A671QPE4_BCL2L1-      atgtctt------------------actataa----------c-------
A0A671L9M9_MCL1-01      atgttccctgggagtaaagtttcaaacgacagcggcttttggc-------
A0A671RQ00_MCL1-01      atgttccctgggagtaaagttttaaacgacaaaggcttttggc-------
                        ***                         *                     

A0A671LAP7_MCL1-01      --------------------------------------------------
A0A671LEY4_MCL1-01      gcgcgcacacggcgctcgtgcccgcggccgcactcaaagcgcggagcgag
A0A671K7W7_BCL2L1-      ----------------------------------------------cgag
A0A671K7W7_BCL2L1-      ----------------------------------------------cgag
A0A671QPE4_BCL2L1-      ----------------------------------------------cgag
A0A671L9M9_MCL1-01      ----------------------------------------------catg
A0A671RQ00_MCL1-01      ----------------------------------------------catg
                                                                          

A0A671LAP7_MCL1-01      -----------------cgcggaggaagcggacgccgcgctgaa------
A0A671LEY4_MCL1-01      gacgagctcgacgggtgcgcggatgaaccggacgccgcggggaa------
A0A671K7W7_BCL2L1-      aactgg--tggtatttttta--ttaaatataaactctcgcagag------
A0A671K7W7_BCL2L1-      aactgg--tggtatttttta--ttaaatataaactctcgcagag------
A0A671QPE4_BCL2L1-      aactgg--tggtatttttta--ttaaatataaactctcacagag------
A0A671L9M9_MCL1-01      cattggaatagcagctcttaacgtcaacaacagctcgagcgggtttagtc
A0A671RQ00_MCL1-01      cattggaataacagctcttaacgtcaacagcagctcgggcgggcttggtc
                                                 **    *   *     *        

A0A671LAP7_MCL1-01      -------gccgctgaggcccgggaccaacggcctgaaaggcctgcagctg
A0A671LEY4_MCL1-01      -------gccggtaagaccgggagcgaacggcctgagaggactacagctg
A0A671K7W7_BCL2L1-      --gaactacccctacaacca-cattgaatttacagaa------gacacaa
A0A671K7W7_BCL2L1-      --gaactacccctacaacca-cattgaatttacagaa------gacacaa
A0A671QPE4_BCL2L1-      --gaactacccctacaatca-cattgaatttacagaa------gacacaa
A0A671L9M9_MCL1-01      gcaagccacttgtaatgccagaactgaaagcccagaaccagttcacaggg
A0A671RQ00_MCL1-01      gcaagccactggtaatgccagaacggaaaccccagaaccagtttacaggg
                                *   *     *       **    * **              

A0A671LAP7_MCL1-01      gacggac-----ggttcgtgtc------cgcgggagacggctctctaccg
A0A671LEY4_MCL1-01      gacggac-----gcttcgtttc------cgcggcggacggatctctaccg
A0A671K7W7_BCL2L1-      atcggact----gatgcgg---------cggaagggaatgatgatga--g
A0A671K7W7_BCL2L1-      atcggact----gatgcgg---------cggaagggaatgatgatga--g
A0A671QPE4_BCL2L1-      atcggact----gatgcgg---------cggaagggaatgatgatga--g
A0A671L9M9_MCL1-01      aacggtctccaaggctcggtaccatcctcgcctgagacggactgcga--g
A0A671RQ00_MCL1-01      aacggactccagggctcggtaccatcctcgcctaaaccggattgcga--g
                          *** *     *   **          **         *      *  *

A0A671LAP7_MCL1-01      gccaccccggacccgcaggagctcggttc---------------cgacac
A0A671LEY4_MCL1-01      agcacaccggacccgcaggagctcggttccgccgaactggaccgcgacac
A0A671K7W7_BCL2L1-      gcggcagcaggaacgacgaacctcattaatggctccct--aaacggaaca
A0A671K7W7_BCL2L1-      gcggcagcaggaacgacgaacctcattaatggctccct--aaacggaaca
A0A671QPE4_BCL2L1-      gaggcagcaggaacgacgaccctcgttaatggctccct--gaacggaaca
A0A671L9M9_MCL1-01      gaaat---agatgattacacctccatctacgccgccctggaaatggacac
A0A671RQ00_MCL1-01      gaagtacaagatgaatacacgtccatctacgacgccctggaaatggacac
                                 *             *                     **   

A0A671LAP7_MCL1-01      gcggcagcttctgttggatttctatc--gcacgcacaccggaatgagtc-
A0A671LEY4_MCL1-01      gagacagcttttgttggatttctacc--gcacgcacaccggaatgtgtc-
A0A671K7W7_BCL2L1-      agtactggttccactgggaccccaccaaggtcccccacttcaacccccca
A0A671K7W7_BCL2L1-      agtactggttccactgggaccccaccaaggtcccccacttcaacccccca
A0A671QPE4_BCL2L1-      agtactggttccactgggaccccaccaaggtcccccgcttcaacccccca
A0A671L9M9_MCL1-01      gcgagagatt--attgacgctttcttaaaaagctttacaggactctctca
A0A671RQ00_MCL1-01      acgagagatt--attgacattttcttaaagaactttactggattccctca
                              * **    **                     *   *      * 

A0A671LAP7_MCL1-01      ----tcccggaccggaagcgtcatcacgcgttaccgacaatgaaacgcgt
A0A671LEY4_MCL1-01      ----cacaggaccggaagcagcaccacgcgttaccgacaatgactcaagt
A0A671K7W7_BCL2L1-      gcatcagacgaacgggactg-----ggggtctggacgctgtaaaggaggc
A0A671K7W7_BCL2L1-      gcatcagacgaacgggactg-----ggggtctggacgctgtaaaggaggc
A0A671QPE4_BCL2L1-      gcgtcagacaaacgggactg-----ggggtctggatgcagtaaaggaggc
A0A671L9M9_MCL1-01      ---ttataaaagtggaaaaa--aacaggttctgtctacgatgaagggggt
A0A671RQ00_MCL1-01      ---ttctaaaagtgggaata--aacaggttctggcaacgatgaatcgggt
                                  *  ** *          *   *     *  * *     * 

A0A671LAP7_MCL1-01      cgtcgcggacgtcgtcataaagcaccagatc------------acttaca
A0A671LEY4_MCL1-01      tgtcgcggacattctcctaaagcacgagatc------------gcataca
A0A671K7W7_BCL2L1-      gcttcgcgattctgccaacgagtttgagctgcgatattcccaagcattca
A0A671K7W7_BCL2L1-      gcttcgcgattctgccaacgagtttgagctgcgatattcccaagcattca
A0A671QPE4_BCL2L1-      gcttcgcgattctgccaacgagtttgagctgcgttattcccaagcattca
A0A671L9M9_MCL1-01      tgtggacagtctcgcggtgaagcacgaactg------------gcttaca
A0A671RQ00_MCL1-01      tgtggaaagtcttgtgatgaagcacgaactg------------gtttaca
                          *                 **    *  *                * **

A0A671LAP7_MCL1-01      gagggatgctgcagcatctgcagctggactctcagccggacgacttgagc
A0A671LEY4_MCL1-01      aaggaatgttgcagcgtctgcagctggaatctcaagcggacgacatgagc
A0A671K7W7_BCL2L1-      acgacctgtcctcgcagctccacatcacgcctgccacggcataccagagc
A0A671K7W7_BCL2L1-      acgacctgtcctcgcagctccacatcacgcctgccacggcataccagagc
A0A671QPE4_BCL2L1-      acgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagc
A0A671L9M9_MCL1-01      aaggtatgattgcacggctgaatctggagcagaaaggagaagatgtgagg
A0A671RQ00_MCL1-01      aaggtatgattgcacgtctgaatctggagcagaaaggagaagatgtgagt
                          *   **      *  **  *  *             *   *   *** 

A0A671LAP7_MCL1-01      ttcatcggctgtatagcaaagacgatgttcagagacgacaccaccaactg
A0A671LEY4_MCL1-01      ttcatcagctgtatagcagagacgatgttcaacgacaacaccaccaactg
A0A671K7W7_BCL2L1-      ttcg---agagcgtgatggatgaggtgttccgtgacggcgtc---aactg
A0A671K7W7_BCL2L1-      ttcg---agagcgtgatggatgaggtgttccgtgacggcgtc---aactg
A0A671QPE4_BCL2L1-      ttcg---agagcgtgatggatgaggtgttccgcgacggcgtc---aactg
A0A671L9M9_MCL1-01      tttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactg
A0A671RQ00_MCL1-01      ttcgtcaagactgtggcaacggaactcttcagcgatggcatcacaaactg
                        **           *           * ***   **   *  *   *****

A0A671LAP7_MCL1-01      gggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtc
A0A671LEY4_MCL1-01      gggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtc
A0A671K7W7_BCL2L1-      gggccgcatcgtgggactgtttgcctttggag------------gggctc
A0A671K7W7_BCL2L1-      gggccgcatcgtgggactgtttgcctttggag------------gggctc
A0A671QPE4_BCL2L1-      gggccgcatcgtgggactgtttgccttcggag------------gggctc
A0A671L9M9_MCL1-01      ggggcgcatttgcagcctgctgacttttggggcaatggtatgcaagcatc
A0A671RQ00_MCL1-01      gggtcgcattgccagcctgcttacttttggggcaatggtatctaagcatc
                        *** ** **     * *** *  * ** ** *             *  **

A0A671LAP7_MCL1-01      tgaaggagctgcagagagagcggtgcgtggagactgtggcccagcagatc
A0A671LEY4_MCL1-01      tgaaggagctgcagagagagcggtgcgtggagacggtggcccagcagatc
A0A671K7W7_BCL2L1-      tgtgtgttgagtgcgtggagaaggagatgagcccactagtgggaagcatc
A0A671K7W7_BCL2L1-      tgtgtgttgagtgcgtggagaaggagatgagcccactagtgggaagcatc
A0A671QPE4_BCL2L1-      tgtgtgttgagtgcgtggagaaggagatgagcccgctagtgggaaacatc
A0A671L9M9_MCL1-01      aaaatgatagaggacttggcaagtgtgtgagtctggtgggggaagagatc
A0A671RQ00_MCL1-01      agaatgataaaggacttagcaagtgtgtgagtctggtggggaaagagatc
                             *                *    **       * *        ***

A0A671LAP7_MCL1-01      tc--------ctcctatctgatctcagaacag----cacgactggctgct
A0A671LEY4_MCL1-01      tc--------ctcctatctgatctcagaacag----cacgactggctgct
A0A671K7W7_BCL2L1-      gcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
A0A671K7W7_BCL2L1-      gcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
A0A671QPE4_BCL2L1-      gcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
A0A671L9M9_MCL1-01      tc--------ttcctatcttctcacagaccaa----cgggactggctgct
A0A671RQ00_MCL1-01      tc--------ttcctatcttctcacaacccag----cgggactggctgct
                         *           *  ***      *   **     *    **** * * 

A0A671LAP7_MCL1-01      caacaacaagggctggcatgggttcgtggagttcttccgcgtggaggacg
A0A671LEY4_MCL1-01      caacaacaagggctggcatggattcgtggagtttttctgcgttgaggatg
A0A671K7W7_BCL2L1-      gagccaaggaggatgggaacgcttcgcagagatctt---tggaaaagatg
A0A671K7W7_BCL2L1-      gagccaaggaggatgggaacgcttcgcagagatctt---tggaaaagatg
A0A671QPE4_BCL2L1-      gagccaaggaggatgggaacgcttcgcagagatctt---tggaaaagatg
A0A671L9M9_MCL1-01      caaaaacaaagcatgggatggctttgtggaattttttcatgtcccggata
A0A671RQ00_MCL1-01      caaaaacaaagcatgggatggctttgtggaattttttcatgtcccaaata
                         *   *    *  *** *  * ** *  **  * **    *      *  

A0A671LAP7_MCL1-01      tggagtctgtggttcgcag--cgctctga------------tggcgg-tt
A0A671LEY4_MCL1-01      tggagtctgtgattcgtaa--tgctttga------------tggctg-tg
A0A671K7W7_BCL2L1-      cagtggcagagagcagaaaatcacaagaaaacttcaagaagtggttgctg
A0A671K7W7_BCL2L1-      cagtggcagagagcagaaaatcacaagaaaacttcaagaagtggttgctg
A0A671QPE4_BCL2L1-      cagcggcagagagcagaaaatcacaagaaaacttcaagaagtggttgctg
A0A671L9M9_MCL1-01      cagaggcagctatgagaag--cacattga------------tggtcattg
A0A671RQ00_MCL1-01      cagaagcggctgtgagaaa--cacattga------------tggccattg
                          *   * *      * *     *    *            ***    * 

A0A671LAP7_MCL1-01      gtgggatgtgctgggatcggcgccggtctcg--------ctctcctga--
A0A671LEY4_MCL1-01      gtgggatgcgctgggatcggcgccggtct-----------tctctttaaa
A0A671K7W7_BCL2L1-      gtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcaca
A0A671K7W7_BCL2L1-      gtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcaca
A0A671QPE4_BCL2L1-      gcgggaatgaccttgctcacgggggtcgtgggcgggtcactcattgcaca
A0A671L9M9_MCL1-01      gtggt-gtggcaacattcggagctgctcttg--------cttatttgata
A0A671RQ00_MCL1-01      gtagt-gtggctacattcggagctgcacttg--------cttatttgaca
                        *  *      *     **   *  *   *           *      *  

A0A671LAP7_MCL1-01      ------tccga----tga
A0A671LEY4_MCL1-01      aataattgtgaagtctga
A0A671K7W7_BCL2L1-      gaaacgcctg-----tga
A0A671K7W7_BCL2L1-      gaaacgcctg-----tga
A0A671QPE4_BCL2L1-      gaaacgcctg-----tga
A0A671L9M9_MCL1-01      -------cgg-----tga
A0A671RQ00_MCL1-01      -------cgg-----tga
                                 *     ***

© 1998-2020Legal notice