Dataset for CDS BCL-2-like of organism Sinocyclocheilus anshuiensis

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A671K7W7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacgacgaacctca
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcaaccccccagcatcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgatattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A671K7W7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacgacgaacctca
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcaaccccccagcatcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgatattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A671L9M9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttagtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccaag
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactctctcattataaaagtggaaaaaaacaggttctgtc
tacgatgaagggggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgaggtttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcaatggtatgcaagcatcaaaatgatagaggacttggcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
aattttttcatgtcccggatacagaggcagctatgagaagcacattgatggtcattggtggtgtggcaacattcggagct
gctcttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A671LAP7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=693 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggaggaagcggacgccgcgctgaagccgct
gaggcccgggaccaacggcctgaaaggcctgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcggcagcttctgttggatttctatcgcacgcacaccggaatgagtctc
ccggaccggaagcgtcatcacgcgttaccgacaatgaaacgcgtcgtcgcggacgtcgtcataaagcaccagatcactta
cagagggatgctgcagcatctgcagctggactctcagccggacgacttgagcttcatcggctgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaggag
ctgcagagagagcggtgcgtggagactgtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgct
caacaacaagggctggcatgggttcgtggagttcttccgcgtggaggacgtggagtctgtggttcgcagcgctctgatgg
cggttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A671LEY4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=783 residues).
atgactctgagtttagtcagaagaacggctgcggtgagtctgctcggcgcgcacacggcgctcgtgcccgcggccgcact
caaagcgcggagcgaggacgagctcgacgggtgcgcggatgaaccggacgccgcggggaagccggtaagaccgggagcga
acggcctgagaggactacagctggacggacgcttcgtttccgcggcggacggatctctaccgagcacaccggacccgcag
gagctcggttccgccgaactggaccgcgacacgagacagcttttgttggatttctaccgcacgcacaccggaatgtgtcc
acaggaccggaagcagcaccacgcgttaccgacaatgactcaagttgtcgcggacattctcctaaagcacgagatcgcat
acaaaggaatgttgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcagctgtatagcagagacgatg
ttcaacgacaacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaagga
gctgcagagagagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagggctggcatggattcgtggagtttttctgcgttgaggatgtggagtctgtgattcgtaatgctttgatg
gctgtggtgggatgcgctgggatcggcgccggtcttctctttaaaaataattgtgaagtctga
>gnl|bcl2dbcds|A0A671QPE4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaaacatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcacgggggtcgtgggcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A671RQ00_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaacgtcaacagcag
ctcgggcgggcttggtcgcaagccactggtaatgccagaacggaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctaaaccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaagaactttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggtttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacggaactcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttacttttggggcaatggtatctaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaaagcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgtggctacattcgga
gctgcacttgcttatttgacacggtga
© 1998-2020Legal notice