Dataset for CDS BCL-2 of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6RID6_BCL2-01      atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaa
A0A8C6RID6_BCL2-02      atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaa

A0A8C6RID6_BCL2-01      gtacatccactataagctgtcacagaggggctacgaatgggatgctggag
A0A8C6RID6_BCL2-02      gtacatccactataagctgtcacagaggggctacgaatgggatgctggag

A0A8C6RID6_BCL2-01      atgcggacgccgcgcccctgggggccacccccgccccgggcatcttttct
A0A8C6RID6_BCL2-02      atgcggacgccgcgcccctgggggccacccccgccccgggcatcttttct

A0A8C6RID6_BCL2-01      tccttgcctgggagcaacccaaccgccgctgtgcaccaggacccagccgc
A0A8C6RID6_BCL2-02      tccttgcctgggagcaacccaaccgccgctgtgcaccaggacccagccgc

A0A8C6RID6_BCL2-01      caggacctcgccgccgcgcctcccggctgcaatggctgggcaggcgctca
A0A8C6RID6_BCL2-02      caggacctcgccgccgcgcctcccggctgcaatggctgggcaggcgctca

A0A8C6RID6_BCL2-01      gcccggtgccacctgtggtccacctgaccctccgccaggctggggatgac
A0A8C6RID6_BCL2-02      gcccggtgccacctgtggtccacctgaccctccgccaggctggggatgac

A0A8C6RID6_BCL2-01      ttctcccgtcgttaccgccgcgacttcgcagagatgtccagccagctgca
A0A8C6RID6_BCL2-02      ttctcccgtcgttaccgccgcgacttcgcagagatgtccagccagctgca

A0A8C6RID6_BCL2-01      cctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
A0A8C6RID6_BCL2-02      cctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc

A0A8C6RID6_BCL2-01      tcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
A0A8C6RID6_BCL2-02      tcttcagggatggggtgaactgggggaggattgtggccttctttgagttc

A0A8C6RID6_BCL2-01      ggtggggtcatgtgtgtggagagcgtcaacagggagatgtcaccgctggt
A0A8C6RID6_BCL2-02      ggtggggtcatgtgtgtggagagcgtcaacagggagatgtcaccgctggt

A0A8C6RID6_BCL2-01      ggacaacatcgccctctggatgaccgactacctgaaccggcacctgcaca
A0A8C6RID6_BCL2-02      ggacaacatcgccctctggatgaccgactacctgaaccggcacctgcaca

A0A8C6RID6_BCL2-01      cctggatccaggataacggaggctgg---gatgcctttgtggaactgtat
A0A8C6RID6_BCL2-02      cctggatccaggataacggaggctgggtaggtgcacatctg--actgaag
                        **************************   * ***   * **  **** * 

A0A8C6RID6_BCL2-01      ggacccagtgtgcggcccctgtttgacttctcttggctgtctctgaagac
A0A8C6RID6_BCL2-02      gagtctgggtttcgg-----------------------------------
                        *   *  *  * ***                                   

A0A8C6RID6_BCL2-01      cctgctcagtctggccctggtaggggcctgcatcaccctgggtgcctatt
A0A8C6RID6_BCL2-02      --tgatcatttt----ctggt-------------accctggg--------
                          ** *** * *    *****             ********        

A0A8C6RID6_BCL2-01      tgggccacaagtga
A0A8C6RID6_BCL2-02      --------aggtag
                                * **  

© 1998-2023Legal notice