Dataset for CDS BCL2L2 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      atgggctggccaaacctgaaatacctccctctgggcctctcaccatatat
A0A8C2R4Z3_BCL2L2-      atgggctggccaaacctgaaatacctccctctgggcctctcaccatatat
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C2R4Z3_BCL2L2-      --------------------------------ttgacagaccgacttccc
A0A8C2R4Z3_BCL2L2-      tcatgccagttttttatgtttgactccaacagccgcccggatggcgaccc
A0A8C2R4Z3_BCL2L2-      tcatgccagttttttatgtttgactccaacagccgcccggatggcgaccc
A0A452ECF0_BCL2L2-      ----------------------------------------atggcgaccc
A0A8C2R4Z3_BCL2L2-      ----------------------------------------atggcgaccc
                                                                  * *  ***

A0A8C2R4Z3_BCL2L2-      ctaccgggatttgagaatttggcgcaattccccgccttagggg-------
A0A8C2R4Z3_BCL2L2-      cagcc------tcagccccagacaca----cgggctctagtggcagactt
A0A8C2R4Z3_BCL2L2-      cagcc------tcagccccagacaca----cgggctctagtggcagactt
A0A452ECF0_BCL2L2-      cagcc------tcagccccagacaca----cgggctctagtggcagactt
A0A8C2R4Z3_BCL2L2-      cagcc------tcagccccagacaca----cgggctctagtggcagactt
                        *  **      * **     * * **    *  **  *** **       

A0A8C2R4Z3_BCL2L2-      -gtggggtcttatttgattgccaagtaatatcccccaatggagccctagc
A0A8C2R4Z3_BCL2L2-      tgtgggctataagctgaggcagaaggggtatgttt--gtggagct-----
A0A8C2R4Z3_BCL2L2-      tgtgggctataagctgaggcagaaggggtatgttt--gtggagct-----
A0A452ECF0_BCL2L2-      tgtgggctataagctgaggcagaaggggtatgttt--gtggagct-----
A0A8C2R4Z3_BCL2L2-      tgtgggctataagctgaggcagaaggggtatgttt--gtggagct-----
                         ***** * * *  ***     ***   ***       ******      

A0A8C2R4Z3_BCL2L2-      tcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggccg
A0A8C2R4Z3_BCL2L2-      ---------------------------------------------ggccc
A0A8C2R4Z3_BCL2L2-      ---------------------------------------------ggccc
A0A452ECF0_BCL2L2-      ---------------------------------------------ggccc
A0A8C2R4Z3_BCL2L2-      ---------------------------------------------ggccc
                                                                     **** 

A0A8C2R4Z3_BCL2L2-      gggagggggccccggggggcgctgg-------ggactacgggaacggctt
A0A8C2R4Z3_BCL2L2-      cggggagggcccagcagctgacccgctacaccaagccatgcgggcagctg
A0A8C2R4Z3_BCL2L2-      cggggagggcccagcagctgacccgctacaccaagccatgcgggcagctg
A0A452ECF0_BCL2L2-      cggggagggcccagcagctgacccgctacaccaagccatgcgggcagctg
A0A8C2R4Z3_BCL2L2-      cggggagggcccagcagctgacccgctacaccaagccatgcgggcagctg
                         ** * ****** *  *    *  *          * * * *  * *** 

A0A8C2R4Z3_BCL2L2-      g----gagtctgaggaactggagcctgaggagctgct----gctggagcc
A0A8C2R4Z3_BCL2L2-      gagatgagtttga-gacccgcttccggcgcaccttctccgatctggcagc
A0A8C2R4Z3_BCL2L2-      gagatgagtttga-gacccgcttccggcgcaccttctccgatctggcagc
A0A452ECF0_BCL2L2-      gagatgagtttga-gacccgcttccggcgcaccttctccgatctggcagc
A0A8C2R4Z3_BCL2L2-      gagatgagtttga-gacccgcttccggcgcaccttctccgatctggcagc
                        *    **** *** ** * *   ** * * * ** **     ****   *

A0A8C2R4Z3_BCL2L2-      cgagccg-----gagcccgagcccga---agaggagc--cgccccggccc
A0A8C2R4Z3_BCL2L2-      tcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtct
A0A8C2R4Z3_BCL2L2-      tcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtct
A0A452ECF0_BCL2L2-      tcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtct
A0A8C2R4Z3_BCL2L2-      tcagctgcatgtgaccccgggttcggcccagcagcgcttcacccaggtct
                          *** *     ** **** *  **    **  * **  * *** ** * 

A0A8C2R4Z3_BCL2L2-      c------gcgcccccccgggagctccgg--------gccctg-ggcc---
A0A8C2R4Z3_BCL2L2-      ctgatgaactcttccaagggggccccaactggggtcgccttgtggccttc
A0A8C2R4Z3_BCL2L2-      ctgatgaactcttccaagggggccccaactggggtcgccttgtggccttc
A0A452ECF0_BCL2L2-      ctgatgaactcttccaagggggccccaactggggtcgccttgtggccttc
A0A8C2R4Z3_BCL2L2-      ctgatgaactcttccaagggggccccaactggggtcgccttgtggccttc
                        *       * *  **  *** ** **          *** ** ****   

A0A8C2R4Z3_BCL2L2-      --tggctcgggagcccc---------------cggcaaccaggaggagga
A0A8C2R4Z3_BCL2L2-      tttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgga
A0A8C2R4Z3_BCL2L2-      tttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgga
A0A452ECF0_BCL2L2-      tttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgga
A0A8C2R4Z3_BCL2L2-      tttgtctttggagccgcactgtgtgctgagagtgtcaacaaggagatgga
                          ** **  ****** *                * **** *****  ***

A0A8C2R4Z3_BCL2L2-      g------gaggagc-----cgggactggtcgagggtgacccgggggacgg
A0A8C2R4Z3_BCL2L2-      gccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgc
A0A8C2R4Z3_BCL2L2-      gccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgc
A0A452ECF0_BCL2L2-      gccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgc
A0A8C2R4Z3_BCL2L2-      gccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgc
                        *      * **  *     * *** ***  *  **    ** ** **** 

A0A8C2R4Z3_BCL2L2-      cgc-------------------cattgaggaccc----------------
A0A8C2R4Z3_BCL2L2-      ggctggctgactggatccacagcagtgggggctg----------------
A0A8C2R4Z3_BCL2L2-      ggctggctgactggatccacagcagtgggggctg----------------
A0A452ECF0_BCL2L2-      ggctggctgactggatccacagcagtgggggctgggcggagttcacagct
A0A8C2R4Z3_BCL2L2-      ggctggctgactggatccacagcagtgggggctgggcggagttcacagct
                         **                   ** ** ** *                  

A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaa
A0A8C2R4Z3_BCL2L2-      ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaa
                                                                          

A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      ctgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccc
A0A8C2R4Z3_BCL2L2-      ctgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccc
                                                                          

A0A8C2R4Z3_BCL2L2-      -ggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
A0A8C2R4Z3_BCL2L2-      -ggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
A0A8C2R4Z3_BCL2L2-      -ggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
A0A452ECF0_BCL2L2-      tgg-----------------------------------------------
A0A8C2R4Z3_BCL2L2-      tggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
                         **                                               

A0A8C2R4Z3_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A8C2R4Z3_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A8C2R4Z3_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgag
                                                                          

A0A8C2R4Z3_BCL2L2-      tccacctccgggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A8C2R4Z3_BCL2L2-      tccacctccgggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A8C2R4Z3_BCL2L2-      tccacctccgggcaatgctggcccagtgatcatgtccattgaggagaaga
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      tccacctccgggcaatgctggcccagtgatcatgtccattgaggagaaga
                                                                          

A0A8C2R4Z3_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A8C2R4Z3_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A8C2R4Z3_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      tggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
                                                                          

A0A8C2R4Z3_BCL2L2-      acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccg
A0A8C2R4Z3_BCL2L2-      acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccg
A0A8C2R4Z3_BCL2L2-      acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccg
A0A452ECF0_BCL2L2-      --------------------------------------------taaccg
A0A8C2R4Z3_BCL2L2-      acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccg
                                                                     *****

A0A8C2R4Z3_BCL2L2-      cgttactatactctgtgacaaatttagtggccatcccaaagggtttgcat
A0A8C2R4Z3_BCL2L2-      cgttactatactctgtgacaaatttagtggccatcccaaagggtttgcat
A0A8C2R4Z3_BCL2L2-      cgttactatactctgtgacaaatttagtggccatcccaaagggtttgcat
A0A452ECF0_BCL2L2-      ------------------------taggggcctt----------------
A0A8C2R4Z3_BCL2L2-      cgttactatactctgtgacaaatttagtggccatcccaaagggtttgcat
                                                *** **** *                

A0A8C2R4Z3_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccctggccttagat
A0A8C2R4Z3_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccctggccttagat
A0A8C2R4Z3_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccctggccttagat
A0A452ECF0_BCL2L2-      ---------------------------------tttcgctagc-------
A0A8C2R4Z3_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccctggccttagat
                                                          *** ** **       

A0A8C2R4Z3_BCL2L2-      gaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaa
A0A8C2R4Z3_BCL2L2-      gaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaa
A0A8C2R4Z3_BCL2L2-      gaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaa
A0A452ECF0_BCL2L2-      ----------------------------aagtga----------------
A0A8C2R4Z3_BCL2L2-      gaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaa
                                                    * ****                

A0A8C2R4Z3_BCL2L2-      cagaccaggcatcagcacaacagaccgaggtttcccacgagcccgatacc
A0A8C2R4Z3_BCL2L2-      cagaccaggcatcagcacaacagaccgaggtttcccacgagcccgatacc
A0A8C2R4Z3_BCL2L2-      cagaccaggcatcagcacaacagaccgaggtttcccacgagcccgatacc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cagaccaggcatcagcacaacagaccgaggtttcccacgagcccgatacc
                                                                          

A0A8C2R4Z3_BCL2L2-      gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggt
A0A8C2R4Z3_BCL2L2-      gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggt
A0A8C2R4Z3_BCL2L2-      gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggt
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggt
                                                                          

A0A8C2R4Z3_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac
A0A8C2R4Z3_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac
A0A8C2R4Z3_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac
                                                                          

A0A8C2R4Z3_BCL2L2-      atcatggtattccccttactaa
A0A8C2R4Z3_BCL2L2-      atcatggtattccccttactaa
A0A8C2R4Z3_BCL2L2-      atcatggt------ttctgtag
A0A452ECF0_BCL2L2-      ----------------------
A0A8C2R4Z3_BCL2L2-      atcatggtattccccttactaa
                                              

© 1998-2022Legal notice