Dataset for CDS BCL2L2 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A452ECF0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaaccgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A8C2R4Z3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=1119 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccctggagctggaagc
gatcaaagctcgagttagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatga
atatgagtccacctccgggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
tatgttggcaatgtggactatggtgcaacagcagaagagctagaagcacacttccacggctgtggttcagtcaaccgcgt
tactatactctgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtgagga
cttccctggccttagatgaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatc
agcacaacagaccgaggtttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattcta
cagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C2R4Z3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=1092 residues).
atgggctggccaaacctgaaatacctccctctgggcctctcaccatatattcatgccagttttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcactgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatgga
ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctg
gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtgg
ccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttat
ttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtttcccacga
gcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
tcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C2R4Z3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=1086 residues).
atgggctggccaaacctgaaatacctccctctgggcctctcaccatatattcatgccagttttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcactgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatgga
ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctg
gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
acagcagaagagctagaagcacacttccacggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtgg
ccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttat
ttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtttcccacga
gcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
tcgcgtctacaggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A8C2R4Z3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=1125 residues).
ttgacagaccgacttcccctaccgggatttgagaatttggcgcaattccccgccttagggggtggggtcttatttgattg
ccaagtaatatcccccaatggagccctagctcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggccggggagggggc
cccggggggcgctggggactacgggaacggcttggagtctgaggaactggagcctgaggagctgctgctggagcccgagc
cggagcccgagcccgaagaggagccgccccggccccgcgcccccccgggagctccgggccctgggcctggctcgggagcc
cccggcaaccaggaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggacccggagct
ggaagcgatcaaagctcgagttagggagatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagc
agatgaatatgagtccacctccgggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgt
tccatctatgttggcaatgtggactatggtgcaacagcagaagagctagaagcacacttccacggctgtggttcagtcaa
ccgcgttactatactctgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaaagagtcag
tgaggacttccctggccttagatgaatccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagacca
ggcatcagcacaacagaccgaggtttcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcg
attctacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
actaa
© 1998-2022Legal notice