Dataset for CDS BCL2L1 of organism Oryzias sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7YJI1_BCL2L1-      atgtccc---ggaacagagaactggttgttttctacgtgaagtataaact
A0A8C7XSQ2_BCL2L1-      atgtcccactgtaacagagagctggttcggttctatttagcctataagat
A0A8C7XSQ2_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
                        *** *     * ** * *     *          *  *    *****  *

A0A8C7YJI1_BCL2L1-      gtctcagaggaactaccccctcaaccacatagtgctcaatgagtctccga
A0A8C7XSQ2_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
A0A8C7XSQ2_BCL2L1-      gtcatgcagggactatcctgt----------gtccctgctgaagccc---
                        ***    *** **** **  *          ** *    ***  * *   

A0A8C7YJI1_BCL2L1-      acaggactgctgcgggggaggtgggcgagga-----gcacagcacggaga
A0A8C7XSQ2_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccactgcccggaac
A0A8C7XSQ2_BCL2L1-      acaga--cgatgggggagaaactgaagaggaccactccactgcccggaac
                        ****    * ** *** **    *  *****      *** ** ****  

A0A8C7YJI1_BCL2L1-      cgcacgccaacgggacgtttaacgggacaactcccgggaccccgccgctc
A0A8C7XSQ2_BCL2L1-      ggcaggccggtcagcagtgaggacggccagctgaggaggtcctg------
A0A8C7XSQ2_BCL2L1-      ggcaggccggtcagcagtgaggacggccagctgaggaggtcctg------
                         *** ***     *  **      ** ** **   * *  ** *      

A0A8C7YJI1_BCL2L1-      tccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgcagt
A0A8C7XSQ2_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
A0A8C7XSQ2_BCL2L1-      tccctgttgtg-----------------------ctagcatggacgccat
                        **** * ** *                       * * *********  *

A0A8C7YJI1_BCL2L1-      gaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccc
A0A8C7XSQ2_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
A0A8C7XSQ2_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttccatc
                         **     * ***   **  ***** * ***** ** *  ** * *   *

A0A8C7YJI1_BCL2L1-      tggccttcaacaacctgcacagccagctgcacatcacgcccgccacggcc
A0A8C7XSQ2_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
A0A8C7XSQ2_BCL2L1-      aaggttttagtgatctctccgtgcagcttcatatcactccggacacggcc
                          *  ** *   * **   *   ***** ** ***** ** * *******

A0A8C7YJI1_BCL2L1-      taccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaa
A0A8C7XSQ2_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
A0A8C7XSQ2_BCL2L1-      taccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaa
                        ***** * **** * *  *** ** * *********   **    *****

A0A8C7YJI1_BCL2L1-      ctggggccgcatcgtggggctcttcgcattcggcggggcgctgtgcgtgg
A0A8C7XSQ2_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggggcgctgtgtgtcg
A0A8C7XSQ2_BCL2L1-      ctgggggcgcgttgtgggtttgtttgtctttggtggggcgctgtgtgtcg
                        ****** *** * *****  * ** *  ** ** *********** ** *

A0A8C7YJI1_BCL2L1-      agtgcgttgagaaggagatgagccccctggtggaccggattgtggagtgg
A0A8C7XSQ2_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
A0A8C7XSQ2_BCL2L1-      agtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatgg
                        **** ** **** * * *** *    *****   *** ****  ** ***

A0A8C7YJI1_BCL2L1-      atgaccgtctacctggacaaccacatccagccctggatccagagccaagg
A0A8C7XSQ2_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
A0A8C7XSQ2_BCL2L1-      atgacccagtacctggatgagcaaataagtccatggatccacagtcatgg
                        ******   ********  * ** **    ** ******** ** ** **

A0A8C7YJI1_BCL2L1-      cggatgggagcgttttgctgaaatctttgggcaggaagccgcggctgaga
A0A8C7XSQ2_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgccgcagaag
A0A8C7XSQ2_BCL2L1-      aggatgggattgctttgcacggctgtatggccagaacggcgccgcagaag
                         ********  * *****     * * *** *** * * *** ** **  

A0A8C7YJI1_BCL2L1-      gcagaaggtctcaggagagcttcaagaagtggctgctggtggggatgacg
A0A8C7XSQ2_BCL2L1-      cgaggcgatttcaagagacgctgaagaagtggatgctggtcacagtggcc
A0A8C7XSQ2_BCL2L1-      cgaggcgatttcaagagacgctgaagaagtggatgctggtcacagtggcc
                          **  * * *** ****   * ********* *******     ** * 

A0A8C7YJI1_BCL2L1-      gtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtg
A0A8C7XSQ2_BCL2L1-      cttttaaccggactgctgctgggtgtgctcatcaccaagaaacg---gtg
A0A8C7XSQ2_BCL2L1-      cttttaaccggactgctgctgggtgtgctcatcaccaagaaacg---gtg
                         *    *****  * *** ****     ** ** ** *******   ***

A0A8C7YJI1_BCL2L1-      a
A0A8C7XSQ2_BCL2L1-      a
A0A8C7XSQ2_BCL2L1-      a
                        *

© 1998-2023Legal notice