Dataset for CDS BCL2L1 of organism Oryzias sinensis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgag
gcgatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgaggcgatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A8C7YJI1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcacagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
© 1998-2023Legal notice