Dataset for CDS BOK of Organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665UQP0_BOK-01      atggaggtcctgcggaggtcctctgtgtttgctgcagaggtcctggacgt
A0A665V1U7_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
                       ****** *  ****  * ************** ** **          **

A0A665UQP0_BOK-01      gtttgaccgatcgctgactgagaaggagctggtgtcccagtcaaaggctc
A0A665V1U7_BOK-01      gtttgaccgctcgcccaccgacaaggagctggtgtcccaggccaaagcac
                       ********* ****  ** ** ****************** * ** ** *

A0A665UQP0_BOK-01      tgtgcagagactacatcctttccagactcaaccagaacgggctgggatgg
A0A665V1U7_BOK-01      tgtgcagggactacattcattccaggctgaaccgtgccggggtaggctgg
                       ******* ******** * ****** ** ****    **** * ** ***

A0A665UQP0_BOK-01      tccaaggcagaagtgaacctctctccctcgaatgcagcactcgctgaagt
A0A665V1U7_BOK-01      tctaaccctgaacacggactggctgcttcaggtgggacgctgggagagat
                       ** **  * ***      **  ** * **   **   * ** *  **  *

A0A665UQP0_BOK-01      gtctttggttctcctgtgtctcggcgacgagctggaatgtatacagccca
A0A665V1U7_BOK-01      ctcgacggttctgctgtggttgggtaacgagctggaatacctacgcccca
                        **   ****** *****  * **  ************   ***  ****

A0A665UQP0_BOK-01      gtctgtaccggaacgtggcgcggcagctcaacatctctgttgccatggac
A0A665V1U7_BOK-01      atgtttaccgtaacgtagcacgacagcttaacatcacagtggcgtcggag
                        * * ***** ***** ** ** ***** ****** * ** **   *** 

A0A665UQP0_BOK-01      aacatggtctcggatgcctttatcggcgtggcaacagaaatcttctcaa-
A0A665V1U7_BOK-01      agcgtggtgtctgacgcctttctggctgtggctgcagacattttctccac
                       * * **** ** ** ****** * *  *****  **** ** ***** * 

A0A665UQP0_BOK-01      -----------------------caggtataacatggggtaaggtggtat
A0A665V1U7_BOK-01      agctttttcacttgcgtcattttcaggtgtaacgtggggaaaggtggtgt
                                              ***** **** ***** ******** *

A0A665UQP0_BOK-01      ccatgtatgcagtagctggagccctggcagtggactgtgtcagacaagga
A0A665V1U7_BOK-01      ctctatatgccgtggcaggggccttggcagtggactgcgtacgccacggt
                       *  * ***** ** ** ** *** ************* **  * ** ** 

A0A665UQP0_BOK-01      catccaactaatgtccacatcttagtggacagtctgggacagtttgtccg
A0A665V1U7_BOK-01      catccagccatggtccataccattgtcgactgcatgggggaatttgttag
                       ****** * *  ***** * * * ** *** *  ****  * *****  *

A0A665UQP0_BOK-01      gaagttcctggttccctggctgaagagacggggagggtggatggagatta
A0A665V1U7_BOK-01      taagagtttgacctcctggttgaaaaaaagagggggttggatggatgtca
                        ***    **    ***** **** * * * ** ** ********  * *

A0A665UQP0_BOK-01      ccaaatgtgtggtgaagagggatctcactcgtgaacactactggctgtcc
A0A665V1U7_BOK-01      caaaatgtgtggtgaacactgatcccaatttccactctcattggctgatg
                       * ************** *  **** ** *    *     * ******   

A0A665UQP0_BOK-01      tctgtcatcgagtcactgaagtacttcctcaccacgatgtatgtctacat
A0A665V1U7_BOK-01      actgcggtctttgcctttggacactatttgaaggccatagttttatacct
                        ***   **    *  *     ***   * *   * **   * * *** *

A0A665UQP0_BOK-01      catgaaggaaccatga
A0A665V1U7_BOK-01      cctcagggagaagtga
                       * * * ***    ***

© 1998-2023Legal notice