Dataset for CDS BOK of Organism Echeneis naucrates

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A665UQP0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Echeneis naucrates GN=BOK (length=642 residues).
atggaggtcctgcggaggtcctctgtgtttgctgcagaggtcctggacgtgtttgaccgatcgctgactgagaaggagct
ggtgtcccagtcaaaggctctgtgcagagactacatcctttccagactcaaccagaacgggctgggatggtccaaggcag
aagtgaacctctctccctcgaatgcagcactcgctgaagtgtctttggttctcctgtgtctcggcgacgagctggaatgt
atacagcccagtctgtaccggaacgtggcgcggcagctcaacatctctgttgccatggacaacatggtctcggatgcctt
tatcggcgtggcaacagaaatcttctcaacaggtataacatggggtaaggtggtatccatgtatgcagtagctggagccc
tggcagtggactgtgtcagacaaggacatccaactaatgtccacatcttagtggacagtctgggacagtttgtccggaag
ttcctggttccctggctgaagagacggggagggtggatggagattaccaaatgtgtggtgaagagggatctcactcgtga
acactactggctgtcctctgtcatcgagtcactgaagtacttcctcaccacgatgtatgtctacatcatgaaggaaccat
ga
>gnl|bcl2dbcds|A0A665V1U7_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Echeneis naucrates GN=BOK (length=657 residues).
atggagatgttgcgccgctcctctgtgtttgcggctgaagtgtttgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaagcactgtgcagggactacattcattccaggctgaaccgtgccggggtaggctggtctaaccctgaacacggac
tggctgcttcaggtgggacgctgggagagatctcgacggttctgctgtggttgggtaacgagctggaatacctacgcccc
aatgtttaccgtaacgtagcacgacagcttaacatcacagtggcgtcggagagcgtggtgtctgacgcctttctggctgt
ggctgcagacattttctccacagctttttcacttgcgtcattttcaggtgtaacgtggggaaaggtggtgtctctatatg
ccgtggcaggggccttggcagtggactgcgtacgccacggtcatccagccatggtccataccattgtcgactgcatgggg
gaatttgttagtaagagtttgacctcctggttgaaaaaaagagggggttggatggatgtcacaaaatgtgtggtgaacac
tgatcccaatttccactctcattggctgatgactgcggtctttgcctttggacactatttgaaggccatagttttatacc
tcctcagggagaagtga
© 1998-2023Legal notice