Dataset for CDS Unclassified of organism Takifugu rubripes

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|H2RZ55_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=498 residues).
atgtctaatagagagctggtagagaactgtttaatctacaaactctctcagaaatacccaggcactgtgtctccacccgc
aggtactggcagagaggctttgaatgcagctcttcggagcatggcaaataagtacgagcgggactttatggagcaagcgg
gtgacctctccccatacgtcgccgtgactaggaacaaggcaggttttaacaaggtgatggacgacatgttcagagatgaa
atcaactggggaacagttgtaggtctttttgtcgtgggcggcgccacttatgtgcaatctttcgagggcggcgcaagtga
accggtttgccacgttgcagactggatgacagattacctggaccaacggattaatccatggatcgagagtcaaggaggat
gggtgactttctctactcccacacaccaaagtgtgactgtttccctctgtgtcgggattgtgcttctgaaccccctcctg
acccggttcatattttaa
>gnl|bcl2dbcds|H2SIR7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=648 residues).
atgtctaatagagagctggtggagaactatttaatctacaaactctctcagaagaactactcaggcactctgctcagacc
aaagggtgcttcaagcggtttgctggtcgatagagagagcagtggaacgtctccatccacaggtactggcagagaggctg
tgatcgcagctcttcggagcatggcaaataagttcgagcaggactttattcagctagcgggtgacctctcctcatacgtc
gccatgactcggaaccaggcaagctttaacaaggtgatggatgacatgttcaggggtgaaatcaactggggaacagttgt
gggtctttttgtcgtgggcggcgccatttgtgtgcaatctgtcgagggtgacgcaagtgaaccggtttgccacattgcag
actggatggcggcttacctggacaaacggattaacccatggatcgagagtcaaggaggatgggtgagtgtaaaggagaga
gactcaaaatacagcttcctttgtgctgcacctgcacaaagtcaggaagaaaggcgtaaatggatactgggcggactggt
ggtgctggctggtgttttgatcattgttacaaaaaattatggtacattgcgtaaggcattttctcacttcatgtcttatt
ggtcgtag
>gnl|bcl2dbcds|H2UHW0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=636 residues).
atgtctaatagagagctggtagagaactatttaatctacaaactctctcagaagaactacccaggcactctgctcagacc
aaaggatgccttaagcggtttgctggttgatagagagagcagtggaacgtctccatccacaggtactggcagagaggatg
tgaacgcagctctttggagcatggcaaataagttcgagcaggactttattcagctagcaggtgacctctcctcatacggc
gccatgactcgtaaccaggcaagctttaacaaggtgatggacaacatgttcagtgatgaaatcaactggggaacagttgt
gggtctttttgtcgtgggcggcgccatttgtgggcaatctgtcgagggtgacgcaagtgaaccggtttgccacattgcag
actggatggcggcttacttggacaaacggattaacccatggattgagagtcaaggaggatgggattgctttgctgccatt
tatggggaagaagcctgcacaaacagagctcaggaagaaaggcataaatggatactgggcgaactggtggtgctggctgg
tgttttgatcatttttacaaaaaattatggtacattgcgtaatgcattttctcacttcatgtcttattggtcgtag
>gnl|bcl2dbcds|H2UHW1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes (length=630 residues).
cagacaccgggtgaaacagacggtgaggccatgctaatgcaaatattcggcagagtcttttatttgttaaatattgattt
tttttctccctgcactctgctcagaccaaaggatgcttcaagcggtttgctggttgatagagagagcagtggaacgtctc
catccgcaggtactggtagagaggctgtgatcgcagctcttcggagcatggcaaataagttcgagcaggactttattcag
ctagcaggtgacctctcctcatacggcgccgtgactcgtaaccaggcaagctttaacaagttgatggacaacatgttcag
tgatgaaatcaactggggaacaattgtgggtctttttgtcgtgggcggcgccatttgtgtgcaatctgtcgagggtagcg
caagtcaaccggtttgccacattgcagactggatgacagtttacctggacaaacggattaacccatggattgagaatcaa
ggaggatgggtgagtgtaaaggagagagactcaaaatacagcttcctttgtgctgcagttagagatttgatgaccaaaat
acaacctttattttttttttttagaatgactaacggccatgagttgattaggggaattgtattcatctga
© 1998-2020Legal notice